A method for preparing and purifying a peste des petits ruminants virus (PPRV) F protein nanobody and a neutralization test method for the nanobody

Abstract

The application discloses a kind of PPRV-F nanobody and nanobody preparation, purification and neutralization test method, and wherein, the PPRV-F nanobody includes the amino acid sequence shown in SEQ ID NO:1.The preparation and purification method of the nanobody provided in the application can obtain the PPRV-F nanobody with neutralization titer reaching 1:20.The nanobody prepared in the application can be used for the treatment, prevention of PPR and the detection of PPRV.

Description

Technical Field

[0001] This invention relates to small ruminant virus F protein nanobodies and methods for the preparation, purification, and neutralization assay of nanobodies. Background Technology

[0002] Peste des petits ruminants (PPR), also known as pseudorhinoceros plague or sheep plague, is an acute viral infectious disease caused by the peste des petits ruminants virus (PPRV). It primarily infects ruminants such as sheep and goats, and is characterized by fever, stomatitis, diarrhea, and pneumonia. Morbidity rates in susceptible animals can reach 100%, and mortality rates can reach 50%–100%. Due to its high morbidity and mortality rates, PPR is listed as a notifiable animal disease by the World Organisation for Animal Health (OIE) [International Animal Health Code (1999)]. In my country, it is listed as a Class A animal disease in the "List of Statutory Animal Diseases," indicating a serious threat requiring urgent and stringent mandatory prevention, control, and eradication measures.

[0003] The F gene is highly conserved in PPRV strains, encoding a GC-rich F protein (fusion protein) of 546 amino acids with a predicted molecular weight of 59.137 kDa. This high level of sequence conservation can explain the extensive cross-protection among different members of the Measlesvirus genus; for example, vaccines against RPDV (Rinderpest virus) can induce immunity against PPRV in animals. Homology of the F gene sequence among Paramyxoviridae families also explains the common fusion properties and conserved biological activities based on the F protein. In measlesviruses, the F protein, with the help of the H protein, mediates the fusion of the viral envelope with the cell membrane at the cell surface, thereby allowing the virus to enter mammalian cells, whereupon the viral genome gains a pathway to the host cell.

[0004] Currently, there is no effective treatment for peste des petits ruminants (PPR), and prevention is only possible through vaccination. When PPR occurs in a country or region, it is necessary to confirm the disease as soon as possible and take measures to prevent its further spread. Existing infected animals should be culled and quarantined as quickly as possible, the epidemic area should be demarcated, and pathogen monitoring should be carried out on surrounding animals.

[0005] In 1993, Belgian scholars Hamers-Casterman et al. reported the existence of naturally occurring heavy-chain antibodies lacking the light chain in camels. Similar antibodies were subsequently found in alpacas and some cartilaginous fish. Cloning the variable region of a heavy-chain antibody yields a single-domain antibody (variable domain of heavy chain of heavy-chain antibody, VHH), consisting of only one heavy chain variable region. Because the relative molecular mass of VHH is approximately 15 kDa, only 1 / 15 that of conventional antibodies, it has been renamed nanobody (Nb). It is currently the smallest naturally occurring antibody in terms of relative molecular mass. Nanobodies have attracted widespread attention in disease diagnosis, molecular detection, and treatment due to their stable physicochemical properties and ease of gene manipulation and cloning. Currently, nanobodies are mainly obtained through phage display technology. This technology amplifies the complete variable region gene of the antibody by PCR and clones it into a phage vector. An antibody library containing the complete gene sequence of the nanobody is constructed using E. coli. After the nanobody library is infected by helper phage, phage containing recombinant phage particles is released to form a phage antibody library. VHH is expressed on the surface of the recombinant phage. This technology directly links phenotype and genotype, combining the ability of antibody to recognize antigen with the ability of phage amplification, making the screening of specific antibodies more efficient. Invention Overview

[0006] This application provides an antibody targeting PPRV that is easy to synthesize and stably store, enabling rapid diagnosis of peste des petits ruminants (PPRV) through detection and treatment or prevention of PPRV using neutralizing antibodies. Furthermore, this application provides methods for the preparation, purification, and neutralization assay of the PPRV-targeting antibody. High-titer PPRV-F nanobodies can be obtained using these preparation and purification methods.

[0007] Specifically, this application relates to:

[0008] 1. A neutralizing antibody or antigen-binding fragment of small ruminant disease virus (PPRV) specifically binding to the PPRV F protein (PPRV-F), comprising three heavy chain complementarity-determining regions (CDR-H1, CDR-H2, and CDR-H3), wherein:

[0009] (a) The amino acid sequence of CDR-H1 (in this specification, CDR-H1 represents heavy chain CDR1) is shown in SEQ ID NO: 9 (SGSTFSNLAMG);

[0010] (b) The amino acid sequence of CDR-H2 (in this specification, CDR-H2 represents heavy chain CDR2) is shown in SEQ ID NO: 10 (SRGGGNTFYRDSVKGRFT);

[0011] (c) The amino acid sequence of CDR-H3 (in this specification, CDR-H3 represents heavy chain CDR3) is shown in SEQ ID NO: 11 (AARDGEYAVSVYYEYHYWG);

[0012] 2. The heavy chain variable region sequence of claim 1 comprises an amino acid sequence as shown in SEQ ID NO: 1, or the heavy chain variable region comprises an amino acid sequence having more than 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 1.

[0013] 3. The neutralizing antibody or antigen-binding fragment of the PPRV described in item 1 or 2, wherein the antibody is selected from: HcAb, nanobody, chimeric antibody, bivalent nanobody, multivalent nanobody, or fusion nanobody. The fusion nanobody may be formed by fusing VHH with a substance that can prolong the half-life of the nanobody in blood, and specific methods may be selected from, for example: polyethylene glycolation of VHH, binding to albumin, or fusion with the Fc terminus of an antibody, etc.

[0014] 4. The neutralizing antibody or antigen-binding fragment of the PPRV described in any one of items 1 to 3, wherein the antibody is a camel-derived VHH antibody.

[0015] 5. A complex comprising a neutralizing antibody or antigen-binding fragment of PPRV as described in any one of claims 1-4, and a functional compound, wherein the functional compound is selected from: therapeutic agents and labeling molecules. The labeling molecule may be selected from: enzyme labeling molecules such as horseradish peroxidase and alkaline phosphatase, fluorescent protein molecules, luciferin molecules, biotin molecules, isotopes, etc.

[0016] 6. A nucleic acid molecule comprising a polynucleotide sequence encoding a neutralizing antibody or an antigen-binding fragment of PPRV as described in any one of items 1-4.

[0017] 7. The nucleic acid molecule of claim 6, comprising: a polynucleotide sequence as shown in SEQ ID NO: 2, or a polynucleotide sequence having more than 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the polynucleotide sequence shown in SEQ ID NO: 2.

[0018] 8. A construct comprising the nucleic acid molecule described in claim 6 or 7, wherein the construct is selected from: phage particles, plasmids, viral vectors, or linear nucleic acids.

[0019] 9. A virus, bacteriophage, or cell that expresses or displays a neutralizing antibody or antigen-binding fragment of PP RV as described in any one of items 1-4, or comprises a nucleic acid molecule as described in item 6 or 7, or comprises a construct as described in item 8.

[0020] 10. A pharmaceutical composition for treating or preventing peste des petits ruminants (PPRV) or a kit for detecting PPRV, comprising: a neutralizing antibody or antigen-binding fragment of PPRV as described in any one of items 1-4, a complex as described in item 4, a nucleic acid molecule as described in item 6 or 7, a construct as described in item 8 or a virus, bacteriophage, or cell as described in item 9.

[0021] 11. A method for preparing a neutralizing antibody against PPRV or an antigen-binding fragment thereof as described in any one of items 1 to 4, comprising the following steps:

[0022] 1) Immunize camelids with PPRV-F;

[0023] 2) Identify and collect nucleic acids containing VHH-encoding nucleic acid sequences from camelids immunized with PPRV-F in 1), and construct a phage library displaying the VHH using phage display technology.

[0024] 3) Perform N phage panning on the phage library described in 2) to obtain a phage library with PPRV-F specificity;

[0025] 4) Obtain single clones from the phage library with PPRV-F specificity, and identify phage-positive single clones with high specificity for PPRV-F using PCR and / or phage ELISA technology, and identify and obtain the amino acid sequence of VHH or its antigen-binding fragment and / or its encoding nucleic acid sequence from the phage-positive single clones;

[0026] 5) Express the encoded nucleic acid sequence described in step 4) into a protein, and purify VHH from the protein using protein purification technology.

[0027] 12. The preparation method as described in item 11, wherein the camel is an alpaca.

[0028] 13. The preparation method as described in item 11 or 12, wherein identifying and collecting nucleic acid containing the VHH-encoded nucleic acid sequence in step 2) comprises two PCRs, wherein the two PCRs use two pairs of primers as shown in SEQ ID NO: 3 and 4 and SEQ ID NO: 5 and 6, respectively.

[0029] 14. The preparation method as described in items 11 to 13, wherein N in 3) is equal to 3, and the concentrations of PPRV-F used in the N phage screenings are, in order: 1 to 100 μg / mL, 0.1 to 50 μg / mL, and 0.01 to 50 μg / mL.

[0030] 15. The preparation method as described in items 11 to 13, wherein the phage needs to be co-infected with an assistant phage to obtain the next generation of phage, wherein the assistant phage is the M13 assistant phage.

[0031] 16. A method for purifying the neutralizing antibody or antigen-binding fragment of PPRV as described in any one of items 1 to 4, comprising:

[0032] 1) A mixture of neutralizing antibodies containing the PPRV or antigen-binding fragments thereof is added to a nickel column, wherein the packing material of the nickel column is Smart-NI;

[0033] 2) The neutralizing antibody or its antigen-binding fragment of the PPRV was eluted with a 250 mM imidazole solution.

[0034] 17. A method for determining the antibody titer of the neutralizing antibody or antigen-binding fragment of PPRV as described in any one of items 1-4.

[0035] In some specific implementations, the preparation method described in item 11 includes the following steps:

[0036] A) Immunize camelids with PPRV-F;

[0037] B) Collect lymphocytes from camel-like animals that have undergone step A), extract total RNA from the lymphocytes, and reverse transcribe the total RNA to prepare cDNA;

[0038] C) Using primers targeting the variable region coding sequence of the camel antibody, perform PCR on the cDNA in B) to amplify the DNA containing the nucleic acid coding sequence of the variable region of the camel antibody. Perform agarose gel electrophoresis on the amplification product and recover the band corresponding to the size of the DNA containing the nucleic acid coding sequence of the variable region of the camel antibody, which is the first round of PCR product.

[0039] D) Using primers targeting the VHH coding sequence of the hypervariable region of the camel, perform PCR on the first round PCR product to amplify the DNA containing the VHH coding nucleic acid sequence of the hypervariable region of the camel. Perform agarose gel electrophoresis on the amplified product and recover the band corresponding to the size of the DNA containing the VHH coding nucleic acid sequence of the hypervariable region of the camel, which is the second round PCR product.

[0040] E) The second round of PCR products are ligated to the first expression vector by gene recombination, and the first expression vector is transformed into competent cells of the first host bacteria. These first host bacteria mixtures containing the first expression vector constitute the primary antibody library.

[0041] F) Identify the proportion of positive first host bacteria containing camelid VHH-encoded nucleic acid sequences in the primary antibody library of E) and the diversity of camelid VHH-encoded nucleic acid sequences in the positive first host bacteria;

[0042] G) The primary antibody library is used in step 8) if the following conditions are met; otherwise, steps A) to G) or C) to G) are repeated:

[0043] The proportion of positive first host bacteria is greater than 90%, and

[0044] The diversity was indicated by the fact that all 30 sequencing results were independent sequences, demonstrating good diversity.

[0045] H) Pack phages with the primary antibody library that meets the conditions in G), i.e., obtain phages containing the VHH-encoding nucleic acid sequence of camel. Use a certain concentration of PPRV-F as an antigen-coating container, place the phages containing the VHH-encoding nucleic acid sequence of camel in the container for phage panning, screen phages with PPRV-F specificity through N phage panning, and infect the first host bacteria with the PPRV-F specific phages. The mixture of the first host bacteria infected by the phages is called the panned antibody library.

[0046] I) Spread the antibody library screened in H) onto a plate culture medium, culture and pick single clones, and identify the first positive single clone containing the nucleic acid sequence encoding VHH of camels by PCR.

[0047] J) Using the first positive monoclonal packaging phage, phages with high specificity for PPRV-F are screened by phage ELISA technology. The monoclonal from which the phage with high specificity for PPRV-F originates is the second positive monoclonal.

[0048] K) Sequencing the second positive monoclonal phage or its packaged PPRV-F-specific phage to obtain the amino acid sequence of the VHH that specifically binds to PPRV-F or its antigen-binding fragment or its encoding nucleic acid sequence.

[0049] L) The encoded nucleic acid sequence of step K) is ligated to a second expression vector, and the second expression vector is transfected into a second host bacterium for expression, thereby obtaining a second host bacterium that expresses VHH or its antigen-binding fragment that specifically binds to PPRV-F;

[0050] M) Extract the protein from the second host bacterium expressing VHH or its antigen-binding fragment that specifically binds to PPRV-F, and purify VHH therefrom.

[0051] In some specific embodiments, the primers in C) that target the antibody-coding sequence of the camel are as shown in SEQ ID NO: 3 and 4.

[0052] In some specific embodiments, the primers in D) targeting the VHH coding sequence of the camel are shown in SEQ ID NO: 5 and 6.

[0053] In some specific embodiments, the method for identifying the proportion of positive first host bacteria containing camel VHH-encoding nucleic acid sequences in the primary antibody library of E) includes the following steps:

[0054] a) The primary antibody library is spread on a plate culture medium and cultured to obtain a single clone of the first host bacterium;

[0055] b) Select a single clone of the first host bacterium and amplify the VHH-encoded nucleic acid sequence of the camel family using PCR;

[0056] c) Calculate the proportion of first host bacteria monoclonal strains that can obtain the target band of the camel VHH-encoded nucleic acid sequence out of all selected first host bacteria monoclonal strains, which is the proportion of positive first host bacteria containing the camel VHH-encoded nucleic acid sequence in the primary antibody library.

[0057] In some specific implementations, the primers used for PCR in b) are shown in SEQ ID NO:7 and SEQ ID NO:8.

[0058] In some specific implementations, N in H) is an integer greater than or equal to 3.

[0059] In some specific implementations, where N in H) equals 3, the concentrations of PPRV-F used in the N phage screenings are, in sequence: 1–100 μg / mL, 0.1–50 μg / mL, and 0.01–50 μg / mL.

[0060] In some specific embodiments, the first host bacterium is *E. coli* containing the F plasmid, the first expression vector is a phage particle, and the phage containing the VHH-encoding nucleic acid sequence of camelids and the phage with PPRV-F specificity are required to co-infect the first host bacterium with helper phages to obtain phages for the next phage panning. In some specific embodiments, the phage particle is an M13 phage particle, and the helper phage is an M13 helper phage. In some specific embodiments, the *E. coli* containing the F plasmid is *E. coli* TG1.

[0061] In some specific embodiments, the second expression vector in L) is selected from: Escherichia coli prokaryotic expression vector, yeast expression vector and baculovirus expression vector, preferably Escherichia coli expression vector, and wherein the second host bacterium is selected from: Escherichia coli, yeast and insect cells, preferably Escherichia coli. Attached Figure Description

[0062] Figure 1 This is a gel electrophoresis image of the first round of PCR amplification products, where M: DL2000 DNA Marker; n: PCR negative control; 1: VHHpprv first round PCR product;

[0063] Figure 2 This is a gel electrophoresis image of the second-round PCR amplification products, where M: DL2000 DNA Marker; 1-5: VHHpprv second-round PCR products;

[0064] Figure 3 Gel electrophoresis images for identifying the library capacity of primary nanobody libraries, where M: DL2000 DNA Marker; n: PCR negative control; 1-52: PCR products identified by the positive rate of the VHHpprv-p5E / TG1 library;

[0065] Figure 4 Gel electrophoresis images of the protein in the host bacterium lysate after expression of the small ruminant F protein nanobody in the second host bacterium, where 1: protein marker; 2: negative control lysate supernatant; 3: negative control lysate; 4: small ruminant F protein nanobody lysate supernatant; 5: small ruminant F protein nanobody lysate.

[0066] Figure 5 Image of the recombinant expression vector PPRV-Nb-pCSF;

[0067] Figure 6The image shows a gel electrophoresis image of the purified small ruminant F protein nanobody. In the image, 1: protein marker; 2: nanobody supernatant; 3: nanobody precipitate; 4: nanobody flow-through; 5-12: purified nanobody protein. Invention Details

[0068] Currently, there is no effective treatment for Peste des Petits Ruminants (PPRV), and prevention relies solely on vaccination. Establishing a rapid and effective PPRV detection method would provide technical support for eradicating PPRV. This application provides a solution to these problems. Using phage panning technology, this application creatively obtains a high-titer neutralizing antibody against PPRV. Because this antibody is a nanobody, it is easy to synthesize and mass-produce, and therefore can be used for the prevention and treatment of PPRV. Based on the antibody's good specificity for PPRV-F, it can also be used for the rapid detection of PPRV. Furthermore, this application provides a method for preparing and purifying the PPRV nanobody, which can be used for the industrial production of the PPRV nanobody.

[0069] definition

[0070] As used herein, the term "antibody" refers to a protein or polypeptide sequence derived from an immunoglobulin molecule that specifically binds to an antigen. Antibodies can be polyclonal or monoclonal, multi-chain or single-chain, or intact immunoglobulins, and can be derived from natural or recombinant sources. Antibodies can also be multimers of immunoglobulin molecules. The terms "heavy chain" ("CH"), "light chain" ("CL"), "heavy chain constant region," "light chain constant region," "light chain variable region" ("VL"), "heavy chain variable region" ("VH"), "framework region" ("FR"), and "complementarity-determining region" ("CDR") are components of an antibody, and different combinations can form different types of antibodies. For example, a conventional IgG antibody is a tetramer composed of two light chains and two heavy chains. The VL and VH are each composed of different CDRs and FRs. The CDR contains residues that contact the antigen and determine the antigen specificity of the VL and VH, while the FR maintains the variable region structure and determines the position of the CDR loop. Typically, the variable region and constant region of a heavy chain form a complete heavy chain, while the variable region and constant region of a light chain form a complete light chain.

[0071] In this paper, the term "nanobody" is used interchangeably with "variable domain antibody of heavy chain" or "VHH" (variable domain of heavy chain of heavy-chain antibody), referring to a single-domain antibody composed solely of the variable domain of the antibody heavy chain. Due to its nanoscale molecular size, it is called a nanobody. The variable domain of camel heavy chain antibodies is structurally very similar to that of human antibody heavy chain variable domains, containing three complementarity-determining regions (CDRs) and four framework regions (FRs) flanking each CDR. Nanobodies can bind tightly to antigens like normal antibodies, but unlike single-chain antibodies, they do not easily aggregate into clumps. Compared to traditional antibodies, nanobodies have advantages such as small relative molecular mass, high affinity, high stability, good solubility, low immunogenicity, strong penetration, and ease of modification and engineering.

[0072] As used herein, a "bivalent nanobody" is formed by the linking or fusion of two VHHs, wherein the antigen-binding sites contained in the two VHHs may be the same or different. Similarly, a "multivalent nanobody" is formed by the linking or fusion of multiple VHHs, each possessing an intact antigen-binding site. A bivalent nanobody can bind to two antigenic epitopes, while a multivalent nanobody can bind to multiple antigenic epitopes.

[0073] In this article, the “antigen-binding fragment” of VHH refers to a protein fragment that contains only a part of the complete VHH, usually including the antigen-binding site of the complete VHH, and thus retaining the ability to bind antigens.

[0074] As used herein, "fusion nanobody" refers to a novel fusion molecule formed by combining with other structures through, for example, genetic engineering or chemical reactions. These other structures are selected from, for example, molecules that can prolong the half-life of VHH (vitamin Haptic antigen), enzymes, antimicrobial peptides, or contrast agents. In the novel fusion molecule, the nanobody binds directionally to its target antigen, and the portion fused with the nanobody exerts the corresponding function. In clinical treatment, drugs often need to remain in the body for a sufficiently long time; however, nanobodies are cleared from the blood very quickly, which is detrimental to their effectiveness. Therefore, by fusing nanobodies with longer-lived molecules (such as albumin, the Fc terminus of antibodies, etc.), the duration of the nanobody in the blood can be increased, i.e., its half-life can be prolonged, thereby achieving better therapeutic effects.

[0075] As used herein, the term "HcAb" refers to a functional heavy chain antibody, known to be naturally produced by camels and sharks. Compared to conventional IgG antibodies, HcAbs do not contain light chain polypeptides and consist of a dimer formed by two heavy chains lacking a first constant region (CH1). The variable region of the heavy chain of a single HcAb can constitute a VHH.

[0076] As used herein, the term "chimeric antibody" refers to a novel antibody derived from one species (e.g., camel antibodies, VHH, etc.) whose constant region and / or FR structure are replaced with corresponding structures from another species. See, for example, PCT / US86 / 02269 and EP173,494.

[0077] In this paper, the term "therapeutic agent" refers to a molecule that ameliorates symptoms of peste des petits ruminants (PPRV) at its target site, kills PPRV, or inhibits any stage of the PPRV life cycle. The term "labeled molecule" refers to a molecule that, after binding to an antibody, can indicate the location or amount of the antibody through color, chemical reaction, excitation light, mass spectrometry, etc. Examples include, for instance, alkaline phosphatase, peroxidase, luciferase, luciferin, fluorescent proteins, and isotopes.

[0078] As used herein, the term "phageparticle" refers to a vector derived from filamentous phages. Its basic components primarily include the plasmid's origin of replication, selection markers, and intergenic spacer (IG region). It typically also contains negative and positive strand packaging sequences and origins of replication, the gene for the phage coat protein, restriction endonuclease recognition sites, a promoter, and a DNA fragment encoding a signal peptide. Furthermore, phageparticles may contain a molecular tag to facilitate the screening of phageparticle-based libraries. Phageparticles cannot independently assemble progeny phage particles; other structural and functional proteins required for their life cycle are provided by helper phages. Helper phages are mutant filamentous phages with extremely low DNA replication efficiency. Therefore, when helper phages co-infect the host bacterium with phageparticle-packaged phages, a large number of phageparticle-containing phages are packaged, while only a small number of helper phages are packaged.

[0079] As used in this article, "plasmid" refers to a DNA molecule other than chromosomes (or nucleoids) in organisms such as bacteria, yeast, and actinomycetes. It exists in the cytoplasm or nucleus, has the ability to replicate autonomously, and maintains a constant copy number in daughter cells, while expressing the genetic information it carries.

[0080] The term "vector" refers to a device that can introduce a multinucleotide sequence (such as a foreign gene) into a host cell to transform the host and promote the expression of the introduced sequence (such as transcription and translation). Vectors include plasmids, phage vectors, and viral vectors. Among them, "viral vectors" are vectors modified from viral genomes that introduce foreign genes into host cells through viral infection.

[0081] As used herein, the term "specific binding" refers to a binding affinity (the equilibrium dissociation constant KD for antigen-antibody binding) of at least 10. -6 The contact between the antibody and the antigen in M. In some respects, the antibody interacts with the antigen at least approximately 10. -7 M, preferred 10-8 M, 10 - 9 M, 10 -10 M, 10 -11 M or 10 -12 The affinity of M.

[0082] In this application, the terms "polynucleotide" or "nucleic acid" and "nucleic acid molecule" are used interchangeably, including but not limited to DNA, RNA, cDNA (complementary DNA), mRNA (messenger RNA), rRNA (ribosomal RNA), shRNA (small hairpin RNA), snRNA (small nuclear RNA), snoRNA (short nucleolar RNA), miRNA (microRNA), genomic DNA, synthetic DNA, synthetic RNA and / or tRNA.

[0083] The “identity” of sequences used in this article refers to the degree of similarity between amino acid sequences or nucleotide sequences as determined by sequence alignment software, such as BLAST.

[0084] Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0085] Neutralizing antibodies and their complexes

[0086] On the one hand, this application provides a neutralizing antibody against PPRV or its antigen-binding fragment, which specifically binds to PPRV-F and contains three heavy chain complementarity-determining regions (CDR-H1, CDR-H2, and CDR-H3), wherein:

[0087] (a) The amino acid sequence of CDR-H1 (in this specification, CDR-H1 represents heavy chain CDR1) is shown in SEQ ID NO: 9 (SGSTFSNLAMG);

[0088] (b) The amino acid sequence of CDR-H2 (in this specification, CDR-H2 represents heavy chain CDR2) is shown in SEQ ID NO: 10 (SRGGGNTFYRDSVKGRFT);

[0089] (c) The amino acid sequence of CDR-H3 (in this specification, CDR-H3 represents heavy chain CDR3) is shown in SEQ ID NO: 11 (AARDGEYAVSVYYEYHYWG);

[0090] In some embodiments, the heavy chain variable region sequence comprises an amino acid sequence as shown in SEQ ID NO: 1, or the heavy chain variable region comprises an amino acid sequence having more than 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 1.

[0091] In some embodiments, the neutralizing antibody of the PPRV is selected from: HcAb, nanobody (VHH), chimeric antibody, bivalent nanobody, multivalent nanobody, or fusion nanobody.

[0092] Those skilled in the art will understand that, since the heavy chain variable region consists of a CDR and a relatively conserved FR, the CDR sequence can be determined from the heavy chain variable region through sequence alignment. By replacing the FR of the heavy chain variable region with the FR of an antibody from another species, the immunogenicity of the antibody containing the heavy chain variable region can be reduced, making it more suitable for use in the other species. This method can be used to construct chimeric nanobodies.

[0093] Nanobodies possess advantages such as high water solubility, high tolerance, high stability, low immunogenicity, and strong tissue penetration, making them easy to store and transport, and convenient for in vivo administration. Furthermore, due to their small molecular weight and simple structure, they can be encoded by a single gene, facilitating large-scale production and offering low cost. However, nanobodies have a short half-life and are cleared from serum more quickly than conventional antibodies, making it difficult for them to remain in target organs for an extended period during disease treatment, thus hindering their ability to exert their intended function. Therefore, in some implementations, VHH can be easily modified into new fusion molecules, i.e., fusion nanobodies, through genetic engineering and antibody conjugation techniques, thereby extending their half-life and achieving better therapeutic effects. In some specific implementations, VHH can be constructed into bispecific or multispecific antibodies, i.e., bivalent or multivalent nanobodies. In some specific implementations, VHH can be conjugated with antiserum albumin, PEGylated with VHH, or linked to the Fc fragment of Ig to construct fusion nanobodies.

[0094] In some embodiments, the antibody is a camel-derived antibody. In some embodiments, the antibody is a camel-derived nanobody. In some embodiments, the antibody is an alpaca-derived nanobody.

[0095] On one hand, this application also provides a complex comprising the aforementioned neutralizing antibody against PPRV or its antigen-binding fragment, and further comprising a functional compound. The functional compound is selected from: therapeutic agents or labeling molecules. In some embodiments, the therapeutic agent may be any drug that can interfere with PPRV replication, proliferation, and any other stage in the PPRV life cycle, such as interferon and other specific antibodies. In some embodiments, the labeling molecule may be selected from: enzyme-labeled molecules such as horseradish peroxidase and alkaline phosphatase, fluorescent protein molecules, fluorescein molecules, biotin molecules, isotopes, and other contrast agents.

[0096] Nucleic acid molecules, constructs, viruses, bacteriophages, and cells

[0097] On one hand, this application also provides a nucleic acid molecule encoding a neutralizing antibody or an antigen-binding fragment thereof of the aforementioned PPRV. In some embodiments, the nucleic acid molecule comprises: a polynucleotide sequence as shown in SEQ ID NO: 2, or a polynucleotide sequence having more than 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the polynucleotide sequence shown in SEQ ID NO: 2. In some embodiments, the nucleic acid molecule comprises a degenerate sequence of SEQ ID NO: 2, the degenerate sequence encoding the amino acid sequence in SEQ ID NO: 1. In some embodiments, the amino acid sequence encoded by the nucleic acid molecule is different from SEQ ID NO: 1, but has more than 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 1.

[0098] On the one hand, this application also provides a construct comprising a nucleic acid molecule encoding the aforementioned neutralizing antibody or its antigen-binding fragment for PPRV, wherein the construct is selected from: phage particles, plasmids, viral vectors, or linear nucleic acids. The construct can be used for the expression of the aforementioned neutralizing antibody or its antigen-binding fragment for PPRV.

[0099] On the other hand, this application also provides a virus, bacteriophage, or cell that expresses or displays the aforementioned neutralizing antibody or antigen-binding fragment of PPRV. In some embodiments, the virus, bacteriophage, or cell comprises the nucleic acid molecule encoding the aforementioned neutralizing antibody or antigen-binding fragment of PPRV. In some embodiments, the virus, bacteriophage, or cell comprises the aforementioned construct. In some embodiments, the cell is a bacterium (e.g., *Escherichia coli*), a fungus (e.g., *Saccharomyces cerevisiae*), a mammalian cell, or a plant cell. In some embodiments, the bacteriophage is selected from M13 bacteriophage or λ bacteriophage.

[0100] Pharmaceutical Composition

[0101] On one hand, this application also provides a pharmaceutical composition for treating or preventing peste des petits ruminants (PPRV). In some embodiments, the pharmaceutical composition comprises a neutralizing antibody against PPRV or an antigen-binding fragment thereof. In some embodiments, the pharmaceutical composition comprises a complex of the neutralizing antibody against PPRV or an antigen-binding fragment thereof. In some embodiments, the pharmaceutical composition comprises a nucleic acid molecule encoding the neutralizing antibody against PPRV or an antigen-binding fragment thereof. In some embodiments, the pharmaceutical composition comprises the aforementioned construct. In some embodiments, the pharmaceutical composition comprises the virus, bacteriophage, or cell. In some specific embodiments, the virus, bacteriophage, or cell displays the neutralizing antibody against PPRV or an antigen-binding fragment thereof on its surface, thereby directly exerting the inhibitory or neutralizing effect of the neutralizing antibody against PPRV upon administration to an animal. In some specific embodiments, the virus, bacteriophage, or cell comprises a nucleic acid encoding the neutralizing antibody against PPRV or an antigen-binding fragment thereof, and expresses the neutralizing antibody after entering the animal and reaching the target organ, thereby exerting an inhibitory or neutralizing effect on PPRV. In some implementations, the cells are bacteria or probiotics belonging to the normal gut flora, and can be administered orally to treat or prevent PPRV.

[0102] Therefore, on the other hand, this application also provides a method for preventing or treating PPRV infection, comprising administering the pharmaceutical composition to an animal infected with PPRV or a susceptible animal of PPRV.

[0103] Test kit

[0104] This application also provides a kit for the detection of PPRV. In some specific embodiments, the kit is an in vitro detection kit. In some embodiments, the kit is an immunoassay kit, such as an ELISA kit or an immunohistochemical kit, containing a neutralizing antibody against PPRV or an antigen-binding fragment thereof. In some embodiments, the kit is an in vivo non-invasive diagnostic kit containing the aforementioned complex. In some embodiments, the in vivo non-invasive diagnostic kit can be used with an imaging method selected from radioimmunoassay or targeted ultrasound contrast imaging. When used for radioimmunoassay, the complex is a complex of the aforementioned neutralizing antibody against PPRV or an antigen-binding fragment thereof with a radionuclide. When used for targeted ultrasound contrast imaging, the complex is a complex of the aforementioned neutralizing antibody against PPRV or an antigen-binding fragment thereof with an ultrasound contrast agent.

[0105] In a preferred embodiment, the neutralizing antibody against PPRV or its antigen-binding fragment contained in the detection kit is a nanobody. In immunoassay kits, due to their small size, nanobodies can be tightly bound to a solid-phase support at high density to capture trace amounts of antigen, thereby improving detection sensitivity. In in vivo non-invasive diagnostic kits, on the one hand, nanobodies have a short half-life in vivo, are easily metabolized and rapidly eliminated, thus reducing the retention time of contrast agents or imaging agents combined with them in vivo and improving safety; on the other hand, nanobodies have small molecules, good penetrability, and high affinity, thus exhibiting good tissue penetration and a high signal-to-noise ratio.

[0106] Preparation method

[0107] This application also provides a method for preparing the aforementioned neutralizing antibody against PPRV or its antigen-binding fragment, which includes the following steps:

[0108] 1) Immunize camelids with PPRV-F;

[0109] 2) Identify and collect nucleic acids containing VHH-encoding nucleic acid sequences from camelids immunized with PPRV-F in 1), and construct a phage library displaying the VHH using phage display technology.

[0110] 3) Perform N phage panning on the phage library described in 2) to obtain a phage library with PPRV-F specificity, where N is taken from any positive integer;

[0111] 4) Obtain single clones from the phage library with PPRV-F specificity, and identify phage-positive single clones with high specificity for PPRV-F using PCR and / or phage ELISA technology, and identify and obtain the amino acid sequence of VHH or its antigen-binding fragment and / or its encoding nucleic acid sequence from the phage-positive single clones;

[0112] 5) Express the encoded nucleic acid sequence described in step 4) into a protein, and purify VHH from the protein using protein purification technology.

[0113] Immunizing animals, phage display technology, establishing phage libraries, phage panning technology, PCR, phage ELISA, identifying and obtaining the amino acid sequence and / or the encoding nucleic acid sequence of VHH or its antigen-binding fragment in positive monoclonal antibodies, protein expression, and protein purification are all routine techniques in this field, and those skilled in the art can obtain their routine implementation steps by consulting relevant technical manuals.

[0114] However, for the preparation of a specific antibody or its antigen-binding fragment, the appropriate combination of the above techniques and the setting and adjustment of various parameters when using these techniques will affect the quality of the final antibody. Therefore, to obtain a high-quality specific antibody or its antigen-binding fragment, the preparation method cannot be directly deduced by those skilled in the art using existing technology.

[0115] Examples of this application illustrate some preferred preparation methods. Final results show that these methods can successfully obtain highly specific neutralizing antibodies against or antigen-binding fragments of the aforementioned PPRV. For example, in some embodiments, the camel is an alpaca. In some embodiments, identifying and collecting nucleic acids containing VHH-encoding nucleic acid sequences includes two PCRs, each using primer pairs as shown in SEQ ID NO: 3 and 4 and SEQ ID NO: 5 and 6, respectively. In some embodiments, N equals 3, and the PPRV-F concentrations used in the N phage pannings are, sequentially: 10–20 μg / mL, 5–10 μg / mL, and 1–5 μg / mL. In some embodiments, the phage needs to be co-infected with a helper phage to obtain the next generation of phages, wherein the helper phage is the M13 helper phage.

[0116] In some implementations, the preparation method specifically includes the following steps:

[0117] A) Immunize camelids with PPRV-F;

[0118] B) Collect lymphocytes from camel-like animals that have undergone step A), extract total RNA from the lymphocytes, and reverse transcribe the total RNA to prepare cDNA;

[0119] C) Using primers targeting the antibody-coding sequence of the camel, perform PCR on the cDNA in B) to amplify the DNA containing the nucleic acid coding sequence of the camel antibody. Perform agarose gel electrophoresis on the amplification product and recover the band corresponding to the size of the DNA containing the nucleic acid coding sequence of the camel antibody, which is the first round PCR product.

[0120] D) Using primers targeting the VHH coding sequence of the camel, perform PCR on the first round PCR product to amplify the DNA containing the VHH coding nucleic acid sequence of the camel. Perform agarose gel electrophoresis on the amplified product and recover the band corresponding to the size of the DNA containing the VHH coding nucleic acid sequence of the camel, which is the second round PCR product.

[0121] E) The second round of PCR products are ligated to the first expression vector by gene recombination, and the first expression vector is transformed into competent cells of the first host bacteria. These first host bacteria mixtures containing the first expression vector constitute the primary antibody library.

[0122] F) Identify the proportion of positive first host bacteria containing camelid VHH-encoded nucleic acid sequences in the primary antibody library of E) and the diversity of camelid VHH-encoded nucleic acid sequences in the positive first host bacteria;

[0123] G) The primary antibody library is used in step 8) if the following conditions are met; otherwise, steps A) to G) or C) to G) are repeated:

[0124] The proportion of positive first host bacteria is greater than 90%, and

[0125] The diversity was indicated by the fact that all 30 sequencing results were independent sequences, demonstrating good diversity.

[0126] H) Pack phages with the primary antibody library that meets the conditions in G), i.e., obtain phages containing the VHH-encoding nucleic acid sequence of camel. Use a certain concentration of PPRV-F as an antigen-coating container, place the phages containing the VHH-encoding nucleic acid sequence of camel in the container for phage panning, screen phages with PPRV-F specificity through N phage panning, and infect the first host bacteria with the PPRV-F specific phages. The mixture of the first host bacteria infected by the phages is called the panned antibody library.

[0127] I) Spread the antibody library screened in H) onto a plate culture medium, culture and pick single clones, and identify the first positive single clone containing the nucleic acid sequence encoding VHH of camels;

[0128] J) Using the first positive monoclonal packaging phage, phages with high specificity for PPRV-F are screened by phage ELISA technology. The monoclonal from which the phage with high specificity for PPRV-F originates is the second positive monoclonal.

[0129] K) Sequencing the second positive monoclonal phage or its packaged PPRV-F-specific phage to obtain the amino acid sequence of the VHH that specifically binds to PPRV-F or its antigen-binding fragment or its encoding nucleic acid sequence.

[0130] L) The encoded nucleic acid sequence of step K) is ligated to a second expression vector, and the second expression vector is transfected into a second host bacterium for expression, thereby obtaining a second host bacterium that expresses VHH or its antigen-binding fragment that specifically binds to PPRV-F;

[0131] M) Extract the protein from the second host bacterium expressing VHH or its antigen-binding fragment that specifically binds to PPRV-F, and purify VHH therefrom.

[0132] In some specific embodiments, the primers in C) that target the antibody-coding sequence of the camel are as shown in SEQ ID NO: 3 and 4.

[0133] In some specific embodiments, the primers in D) targeting the VHH coding sequence of the camel are shown in SEQ ID NO: 5 and 6.

[0134] In some specific embodiments, the method for identifying the proportion of positive first host bacteria containing camel VHH-encoding nucleic acid sequences in the primary antibody library of E) includes the following steps:

[0135] a) The primary antibody library is spread on a plate culture medium and cultured to obtain a single clone of the first host bacterium;

[0136] b) Select a single clone of the first host bacterium and amplify the VHH-encoded nucleic acid sequence of the camel family using PCR;

[0137] c) Calculate the proportion of first host bacteria monoclonal strains that can obtain the target band of the camel VHH-encoded nucleic acid sequence out of all selected first host bacteria monoclonal strains, which is the proportion of positive first host bacteria containing the camel VHH-encoded nucleic acid sequence in the primary antibody library.

[0138] In some specific implementations, the primers used for PCR in b) are shown in SEQ ID NO:7 and SEQ ID NO:8.

[0139] In some specific implementations, N in H) is an integer greater than or equal to 3.

[0140] In some specific implementations, where N in H) equals 3, the concentrations of PPRV-F used in the N phage screenings are, in sequence: 1–100 μg / mL, 0.1–50 μg / mL, and 0.01–50 μg / mL.

[0141] In some specific embodiments, the first host bacterium is *E. coli* containing the F plasmid, the first expression vector is a phage particle, and the phage containing the VHH-encoding nucleic acid sequence of camelids and the phage with PPRV-F specificity are required to co-infect the first host bacterium with helper phages to obtain phages for the next phage panning. In some specific embodiments, the phage particle is an M13 phage particle, and the helper phage is an M13 helper phage. In some specific embodiments, the *E. coli* containing the F plasmid is *E. coli* TG1.

[0142] In some specific embodiments, the second expression vector in L) is selected from: Escherichia coli prokaryotic expression vector, yeast expression vector and baculovirus expression vector, preferably Escherichia coli expression vector, and wherein the second host bacterium is selected from: Escherichia coli, yeast and insect cells, preferably Escherichia coli.

[0143] Purification methods

[0144] This application also provides a method for purifying the aforementioned neutralizing antibody against PPRV or its antigen-binding fragment, comprising:

[0145] 1) A mixture of neutralizing antibodies containing the PPRV or antigen-binding fragments thereof is added to a nickel column, wherein the packing material of the nickel column is Smart-NI;

[0146] 2) The neutralizing antibody or its antigen-binding fragment of the PPRV was eluted with an imidazole solution of approximately 250 mM.

[0147] In some embodiments, the packing material may also be other packing materials with the same or similar adsorption capacity and pore size as Smart-NI. In some embodiments, the approximately 250 mM includes a range of 200-300 mM, such as 210-290 mM, 220-280 mM, 230-270 mM, 240-260 mM, etc.

[0148] The purification method described herein can be used in the purification steps of the aforementioned preparation method, and can also be used in any other mixture containing the aforementioned PPRV neutralizing antibody or antigen-binding fragment. As shown in the examples, the purification method can remove most protein impurities and achieve a neutralizing titer of 1:20 for the purified protein.

[0149] In addition, this application also provides a method for determining the antibody neutralizing titer of the aforementioned PPRV neutralizing antibody or its antigen-binding fragment.

[0150] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

[0151] It should be understood that the above description and the following embodiments are intended to illustrate, not limit, the scope of the invention. Other aspects, advantages, and modifications within the scope of the invention will be apparent to those skilled in the art. All other embodiments obtained by those skilled in the art based on the embodiments of the invention without inventive effort are within the scope of protection of the invention. Example

[0152] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments.

[0153] Example 1: Preparation of a primary nanobody library for peste des petits ruminants virus F protein

[0154] 1. Immunizing alpacas with peste des petits ruminants virus F antigen protein.

[0155] Alpacas were immunized with PPR F protein (Zhejiang Hailong Biotechnology Co., Ltd., protein batch number: G001190816-p122M1) via subcutaneous injection at multiple sites on the back. A total of four immunizations were administered, with an interval of 14 days between each immunization. Blood was collected 7 days after the last immunization. The specific immunization process is shown in Table 1 below.

[0156] Table 1. Immunization Schedule

[0157]

[0158] 2. ELISA detection of serum antibody titer

[0159] Coat 96-well plates with 200 ng / well of peste des petits ruminants virus (PPR) F protein and incubate overnight at 4°C. The next day, wash 6 wells with 0.1% PBST, then block with 200 μL / well of 3% BSA at 37°C for 2 h, followed by 5 washes with 0.1% PBST. Add 100 μL of serially diluted (2-fold) immunized alpaca serum to each well and incubate at 37°C for 1 h, discarding the serum. Wash 5 wells with 0.1% PBST, then add 100 μL / well of 1:15000 diluted HRP-labeled rabbit anti-alpaca IgG antibody and incubate at 37°C for 1 h. Wash 5 wells with 0.1% PBST. Add 100 μL / well of TMB chromogenic buffer, incubate in the dark for 20 min, and terminate the reaction with 50 μL / well of 2M H2SO4. Measure the absorbance at OD450 nm-OD630 nm using a microplate reader. Data analysis showed that the antibody titer was 1:50000.

[0160] 3. Construction of a nanobody phage display library

[0161] 3.1 Isolation of peripheral blood lymphocytes

[0162] Place the prepared centrifuge tubes, physiological saline, PBS, and lymphocyte separation medium into a clean bench and sterilize under UV light for 20-30 minutes. Dilute the blood sample by collecting anticoagulant blood from immunized alpaca samples and mixing it with an equal volume of physiological saline. During blood dilution, the volume of anticoagulant should be removed; for example, if 100 mL of fresh anticoagulant blood contains 10 mL of anticoagulant, then add 90 mL of physiological saline. Invert and mix the lymphocyte separation medium. Take six 15 mL centrifuge tubes and add 4 mL of lymphocyte separation medium to each. Pipette 4 mL of the diluted mixture and slowly add the diluted anticoagulant blood along the centrifuge tube wall onto the lymphocyte separation medium. Centrifuge at 2000 rpm at room temperature for 30 minutes. At this point, the cells in the centrifuge tube will separate into four layers from top to bottom: the first layer is the plasma layer; the second layer is a ring-shaped milky white lymphocyte layer; the third layer is the clear separation medium layer; and the fourth layer is the erythrocyte layer. Collect the second layer of cells using a pipette into another clean centrifuge tube. Add at least 6 mL of PBS to the centrifuge tube, mix thoroughly, centrifuge at 1000 rpm for 10 min, and discard the supernatant. Resuspend the lymphocytes in 6-8 mL of PBS, mix gently, centrifuge at 1000 rpm for 10 min, and discard the supernatant. Collect 6 tubes of cells into one tube; this is the isolated lymphocytes. Separate all blood samples using this method. Finally, resuspend the isolated lymphocytes in 4 mL of PBS and transfer them to a 1.5 mL RNase-free EP tube.

[0163] 3.2 Amplification of the VHH gene

[0164] 3.2.1 Preparation of cDNA

[0165] Total RNA was extracted from the lymphocytes obtained in 3.1 and cDNA was prepared by reverse transcription.

[0166] 3.2.2 First round of PCR amplification

[0167] Then, using cDNA as a template, the variable region fragment of the alpaca antibody was amplified using primers VHH1-F and VHH1-R. An appropriate amount of the PCR product was then subjected to 1% agarose gel electrophoresis for detection. The electrophoresis results are shown below. Figure 1 As shown, the sequences of primers VHH1-F and VHH1-R are as follows:

[0168] Primer VHH1-F sequence: 5'-GTCCTGGCTGCTCTTCTACAAGG-3' (SEQ ID NO: 3).

[0169] Primer VHH1-R sequence: 5'-GGTACGTGCTGTTGAACTGTTCC-3' (SEQ ID NO: 4).

[0170] 3.2.3 Second round of PCR amplification

[0171] Using the recovered product as a template for the second round of PCR, the hypervariable VHH fragment was amplified using primers VHH2-F and VHH2-R. An appropriate amount of the PCR product was then analyzed by 1% agarose gel electrophoresis. The electrophoresis results are shown below. Figure 2 As shown, the sequences of primers VHH2-F and VHH2-R are as follows:

[0172] Primer VHH2-F sequence:

[0173] 5'-TTTCTATTACTAGGCCCAGCCGCCCGCCCAAGTACAACTGGTC-3' (SEQ ID NO: 5).

[0174] Primer VHH2-R sequence:

[0175] 5'-AAGGAAAAAAGCGGCCGCCCCGGGCTGAGGCTTGG-3' (SEQ ID NO: 6).

[0176] 3.2.4 The obtained VHH gene fragment was ligated into the first expression vector and transformed into competent cells to construct an antibody immune library;

[0177] The VHH target gene fragment and the pCANTAB5E phage vector were double-digested with Sfi I and Not I restriction endonucleases, respectively, and recovered by agarose gel electroporation. The purified VHH target gene fragment was ligated to the double-digested phage vector pCANTAB5E using T4 DNA ligase. The ligation product was then transformed into freshly prepared E. coli TG1 competent cells (Amid Biosciences, Catalog#ETG1-201) via electroporation. The electroporator was set to 1.8 kV, and after electroporation, the cells were cultured at 37°C with shaking at 200 rpm for 1 h. 100 μL of the culture was serially diluted to calculate the electroporation efficiency. The remaining bacterial culture was plated on ampicillin-resistant solid plates and incubated overnight at 30°C.

[0178] The solidified colonies on the plates were washed with LB medium and collected into 250 mL sterile Erlenmeyer flasks. 100 μL of the bacterial culture was serially diluted and spread onto ampicillin-resistant plates. After overnight incubation, the number of colonies on each dilution plate was counted. The volume of the antibody library was calculated based on the colony count and dilution factor. Fifty single colonies were randomly selected and incubated overnight in 5 mL LB medium. Using the overnight culture as a template, PCR was performed using primers VHH3-F and VHH3-R to identify the proportion of positive clones. Plasmids were extracted from the positive clones and sent for third-party sequencing to identify the gene sequence diversity of the antibody library. The primer sequences VHH3-F and VHH3-R are as follows:

[0179] Primer VHH3-F sequence: CCATGATTACGCCAAGCTTTGGAGCC (SEQ ID NO: 7).

[0180] Primer VHH3-R sequence: CGATCTAAAGTTTTGTCGTCTTTCC (SEQ ID NO: 8).

[0181] As a result, the ligation product was transformed into freshly prepared E. coli TG1 competent cells via electroporation, yielding 1.2 × 10⁻⁶ transformants. 6 CFU / mL, conversion efficiency approximately 1.2 × 10⁻⁶ 5 CFU / 100ng. Transformants were plated on ampicillin-resistant plates and incubated overnight at 30°C. Colonies were harvested from the plates, yielding a final number of 5.0 × 10⁻⁶ transformants. 9 CFU / mL. Fifty single colonies were randomly selected from the diluted bacterial suspension plate for PCR identification. The PCR products were subjected to 1% agarose gel electrophoresis, and all colonies amplified the expected band size of approximately 700 bp, with a positive rate of 100%. The final library size was calculated to be 2 × 10⁻⁶. 10 CFU / mL. Figure 3 )

[0182] Example 2: Screening of the established primary nanobody library

[0183] The steps are as follows:

[0184] Selection of specific antibodies

[0185] (1) The VHH ligation product was electroporated into E. coli TG1 to form the primary antibody library (the steps are the same as in Example 1). One vial (1 mL) of the primary antibody library was added to 250 mL of 2×YT-G (2% glucose) medium and incubated at 37°C and 250 rpm for 1 h.

[0186] (2) Take the culture medium, determine the bacterial concentration, add 100 μg / mL Amp and Moi = 20:1 helper phage M13KO7, gently shake in a 37℃ water bath for 30 min, and then incubate in a 37℃ shaker for 30 min.

[0187] (3) Centrifuge at 4000 rpm for 10 min and carefully discard the supernatant;

[0188] (4) The bacterial pellet was suspended in 2×YT-AK medium at 2× volume (500mL) and incubated overnight at 37℃ and 220rpm.

[0189] (5) Centrifuge at 10,000 rpm for 20 min, and transfer the supernatant to another new tube for sieving.

[0190] (6) Add 100 mL of PEG (Aladdin, CAS 25322-68-3) / NaCl (Shanghai Guoyao, CAS 7647-14-5), incubate at 4°C on ice for no more than 1 hour;

[0191] (7) Centrifuge at 8000 rpm for 20 min at 4℃, discard the supernatant and drain.

[0192] (8) The phage pellet was resuspended in 5 mL of 2×YT medium (Shanghai Siger Biotechnology Co., Ltd., XG-S63629), and centrifuged again at 10000 rpm for 15 min. The supernatant was collected for later use. MPBS and phage supernatant were mixed in a ratio of MPBS:supernatant = 2:3. Cell debris interference was removed at room temperature and the mixture was treated for 20 min.

[0193] (9) Coat the immune tubes with F protein antigen one day in advance (coating amount 2mL / tube);

[0194] (10) After coating, wash the tube three times with PBS and pat dry.

[0195] (11) Block the immunotubes with blocking solution (2% skim milk PBS, MPBS) at 37°C for 2 hours;

[0196] (12) Discard the blocking solution, wash the tube three times with PBS, and pat dry.

[0197] (13) Add the phage supernatant mixture treated in (8) to the sealed immunotherapy tube, 2 mL / tube, gently shake and incubate for 30 min, then let stand and incubate for 1.5 h;

[0198] (14) Discard the phage supernatant in the immunotherapy tube, wash 5 times with PBST (0.1%), then wash 3 times with PBS, and pat dry;

[0199] (15) Elution: Add host bacteria TG1 (OD600=0.5), 4mL / tube, and culture at 37℃ and 150rpm for 1h. At this time, the first round of screening is completed and the primary antibody library is obtained.

[0200] (16) Take the bacterial culture with shaking culture, make serial dilution with 2×YT medium, take 100μL of the dilution and spread it on SOBAG plate, incubate at 30℃ overnight, and calculate the amount of phage in the output screening step.

[0201] (17) Add Amp and 2% glucose to the primary storage tank to a final concentration of 100 μg / mL, and simultaneously add 4 × 10 10 M13KO7 helper phage was cultured at 37°C at low speed for 30 min, followed by shaking culture at 250 rpm for 30 min.

[0202] (18) Centrifuge at 5000 rpm at room temperature for 10 min, remove the supernatant, gently resuspend the cells in 100 mL of 2×YT-AK, and incubate overnight at 37℃ and 220 rpm.

[0203] (19) From step 5 above, perform a cyclical sieving to begin the next round of sieving;

[0204] (20) After four rounds of screening, the obtained bacterial culture was serially diluted, and 100 μL of the diluted solution was plated on SOBAG plates and incubated at 30°C for 20-24 h. The remaining bacterial culture was frozen at -80°C and labeled as a level IV antibody library.

[0205] Example 3: Phage-ELISA Identification of Antigen-Positive Recombinant Antibodies

[0206] 1. Monoclonal expression of recombinant antibodies from a level-four antibody library

[0207] (1) Randomly select single clones from the plates after the fourth round of dilution and incubate them overnight in 400 μL of 2×YT-AG medium;

[0208] (2) Identify positive clones by bacterial culture PCR. Arrange the positive clones in a 96-well plate and label the plate as MasterPlate.

[0209] (3) Take another new sterilized EP tube, and add 400 μL of solution containing 2.5 × 10⁻⁶ ppm to each tube. 10 2×YT-AG of pfu / mL M13KO7, this plate is marked as P1 Plate;

[0210] (4) Take 40 μL of bacterial culture medium from each tube in the Master Plate and transfer it to the P1 Plate;

[0211] (5) Place the EP tube in P1 Plate on a shaker and incubate at 37°C and 150 rpm for 2 hours.

[0212] (6) Centrifuge at 4000 rpm for 20 min, and carefully remove the supernatant;

[0213] (7) Add 400 μL of 2×YT-AK culture medium to each EP tube and incubate overnight at 37°C with shaking at 220 rpm;

[0214] (8) Centrifuge at 7000 rpm for 20 min, and store the supernatant at 4℃ for later use. The supernatant mentioned in this article is referred to as recombinant antibody solution.

[0215] 2. Phage ELISA

[0216] (1) Coating: ELISA plates were coated with F protein according to the optimal coating conditions, and positive and negative controls were set up;

[0217] (2) Washing: Discard the coating solution and wash 3 times with PBS; pat dry.

[0218] (3) Blocking: Add 2% MPBS to fill the wells and block at 37°C for 1.5 h;

[0219] (4) Washing: Discard the blocking solution, wash 3 times with PBS, and pat the ELISA plate dry.

[0220] (5) Add recombinant antibody solution: Mix 160 μL of recombinant antibody solution with 40 μL of MPBS in advance, incubate at room temperature for 20 min, add to the wells of the blocked ELISA plate, and react at 37°C for 2 h.

[0221] (6) Washing: Discard the liquid, wash 3 times with PBST, then wash 3 times with PBS, and pat dry;

[0222] (7) Add enzyme-labeled secondary antibody: Dilute HRP-labeled anti-M13 monoclonal antibody with 2% MPBS at a ratio of 1:4000, add 200 μL / well, and incubate at 37°C for 1 h;

[0223] (8) Washing: Discard the second antibody, wash as above, and pat dry;

[0224] (9) Color development: Add 200 μL / well TMB color development solution and develop at room temperature for about 45 min;

[0225] (10) Termination: Stop the color development with 200 μL / well stop solution and read the value at 450 nm using an ELISA reader.

[0226] The reactivity of phage supernatants corresponding to 94 monoclonal antibodies with F protein was detected by indirect ELISA. Based on the results of the indirect ELISA experiment, the 20 monoclonal antibodies with the best performance were selected. These 20 monoclonal antibodies showed good reactivity with F protein and weak reactivity with BSA protein.

[0227] (11) The selected monoclonal antibody bacterial groups that have good reactivity with F protein were amplified by PCR to obtain the phage-displayed nanobody gene and sequenced. Only the amino acid sequence of the small ruminant plague F protein nanobody was obtained: SEQ ID NO: 1 and the nucleotide sequence: SEQ ID NO: 2.

[0228] Meanwhile, using the method of comparing and analyzing with published nanoantibody sequences (http: / / www.vbase2.org / vbdnaplot.php), the CDR portions of the selected antibodies were confirmed as CDR-H1 shown in SEQ ID NO: 9, CDR-H2 shown in SEQ ID NO: 10, and CDR-H3 shown in SEQ ID NO: 11.

[0229] Example 4: Construction and identification of a second expression vector via recombination

[0230] 1. Expression of the peste des petits ruminants F protein nanobody

[0231] (1) Transform the recombinant nanobody vector PPRV-Nb-pCSF into BL21(DE3) competent cells to prepare expression cells. Take the expression cells that have been cultured overnight and inoculate them into 600ml LB medium containing 50μg / ml Amp at a ratio of 1:100. Shake at 37℃ and 220rpm until the OD600 of the cells is 0.5-0.8.

[0232] (2) Add IPTG inducer to 600ml LB medium to a final concentration of 0.1mM, and incubate at 22℃ for 5h at 160rpm;

[0233] (3) Centrifuge at 5000 rpm and 4℃ for 5 min, remove the supernatant and collect the bacterial cells, and store at -20℃;

[0234] (4) Ultrasonic disruption of bacterial cells

[0235] Disruption conditions: 150W power, 1s disruption, 1.5s interval, 20min total; lysis buffer: PBS, pH 7.4.

[0236] The bacterial protein expression results as determined by polyacrylamide gel electrophoresis are as follows: Figure 4 As shown in the image. The arrows indicate the location of the target protein band containing the tagged protein (VHH that specifically binds to PPRV-F). The recombinant expression vector PPRV-Nb-pCSF map is shown below. Figure 5 As shown.

[0237] 2. Purification of Small Ruminant Disease F Protein Nanobody

[0238] The disrupted bacterial cells were centrifuged at 12,000 rpm for 10 min at 4°C. The supernatant was collected for purification using a Smart-NI nickel column. Equilibration buffer: PBS, pH 7.4; Elution buffer: PBS, 250 mM imidazole, pH 7.4. The purification results are as follows: Figure 6 As shown.

[0239] Example 5: Determination of Neutralizing Antibody Titer for Small Ruminant Disease F Protein Nanobody

[0240] (1) The virus content is 10 4.15 TCID 50 / 100μl of small ruminant virus (PPRV) neutralizing antigen was diluted to 100 TCID using serum-free MEM culture medium. 50 / 100μl is the neutralizing antigen solution;

[0241] (2) The nanobody from Example 4 with a concentration of 2 mg / ml was serially diluted 2 times to 1:128 with serum-free MEM culture medium;

[0242] (3) Add the nanobodies of different dilutions (1:2 to 1:128) to a 96-well cell culture plate, repeating each dilution in 4 wells, 100 μl / well.

[0243] (4) Add the diluted PPRV neutralization antigen solution (virus content of 100 TCID) 50 Add 100 μl of the solution to each well of the 96-well cell culture plate, mix well by shaking for 2 min, incubate at 37°C for 1 h, and shake for 2 min every 0.5 h.

[0244] (5) Add Vero cell suspension, 100 μl / well, to the 96-well cell culture plate containing the neutralization solution. Incubate at 37°C and 5% CO2 for 6 days, and observe the cytopathic effect (CPE) daily.

[0245] (6) Set the virus back into the control group, and record the neutralizing antigen solution in (1) as 10. 0 Perform a 10-fold serial dilution to 10 -3 Take 10 0 10 -1 10 -2 and 10 -3 Four dilutions (each with a viral load of 100 TCID) 50 / 100μl, 10TCID 50 / 100μl, 1TCID 50 / 100μl and 0.1TCID 50 100 μl of the solution was seeded into 96-well cell culture plates, with each dilution repeated in quadruplicate.

[0246] (7) At the same time, normal cell control group (200 μl serum-free MEM culture medium + 100 μl Vero cell suspension), positive serum control group (100 μl positive serum + 100 μl neutralizing antigen + 100 μl Vero cell suspension) and nanobody toxicity control group (100 μl nanobody diluent + 100 μl serum-free MEM culture medium + 100 μl Vero cell suspension) were set up, and each was replicated in 4 wells;

[0247] (8) Based on the CPE, the neutralizing antibody titer of the nanobody was calculated using the Reed-Muench method. The statistics of the neutralization test data are shown in Table 2.

[0248] Table 2: Statistical Analysis of Neutralization Test Data

[0249]

[0250]

[0251] (9) Conditions for the experiment to be valid: Virus returns to the control group, 10 0 and 10 -1 CPE was observed in all cells of each well, 10 -2 CPE was observed in some pore cells, 10 -3 Cells in all wells grew normally, and no CPE was observed. No CPE should be observed in any well of the positive serum control group, normal cell control group, and nanobody toxicity control group.

[0252] (10) Substitute the results from Table 2 into the following formulas to perform the calculations:

[0253] Distance ratio = (Percentage above 50% - 50%) / (Percentage above 50% - Percentage below 50%) = (75 - 50) / (75 - 0) = 0.33

[0254] LG PD 50 = Logarithm of serum dilution higher than 50% + Logarithm of distance ratio × dilution factor = lg(1 / 16) + 0.33 × lg(1 / 2) = -1.2 + 0.33 × (-0.3) = -1.299

[0255] PD 50 =19.9067≈20

[0256] The neutralizing titer of the nanobody was found to be 1:20.

[0257] As shown in the above embodiments, the present invention provides a method for the preparation, purification, and neutralization test of small ruminant disease virus (PPR) F protein nanobodies. This method enables the industrial production of high-purity PPR F protein nanobodies, providing a new means and method for the effective prevention and control of PPR.

[0258] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the above embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the various embodiments of the present invention.

[0259]

[0260] sequence list <110> China Institute of Veterinary Drug Control Binzhou Animal Husbandry and Veterinary Research Institute, Shandong Province <120> A small ruminant peste des repens (PPRV) F protein nanobody and its preparation, purification, and intermediate treatment. and test methods <130> PE01536 <160> 11 <170> PatentIn version 3.5 <210> 1 <211> 135 <212> PRT <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 1 Ala Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Thr Gly 1 5 10 15 Gly Ser Met Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Asn 20 25 30 Leu Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Thr Arg Glu Arg 35 40 45 Val Ala Ala Ile Ser Arg Gly Gly Gly Asn Thr Phe Tyr Arg Asp Ser 50 55 60 Val Lys Gly Arg Phe Thr Ile Ser Lys Asp Asn Ala Lys Asn Thr Leu 65 70 75 80 Asn Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr 85 90 95 Cys Ala Ala Arg Asp Gly Glu Tyr Ala Val Ser Val Tyr Tyr Glu Tyr 100 105 110 His Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Glu Pro Lys 115 120 125 Thr Pro Lys Pro Gln Pro Gly 130 135 <210> 2 <211> 400 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 2 gcccaagtac aactggtcga gtctggggga ggattggtgc aaactggggg ctctatgaga 60 ctctcctgtg cagcctctgg aagcaccttc agtaacttag ccatgggctg gttccgccag 120 gctccaggca agactcgcga gcgtgttgca gcgattagtc ggggtggtgg taatacattt 180 tatagagact ccgtgaaggg ccgattcacc atctccaagg acaacgccaa gaacacgctg 240 aatctgcaaa tgaacagttt gaaacctgag gacacggccg tttattactg tgcggcgagg 300 gatggggaat atgccgtatc ggtgtactat gagtatcact actggggcca ggggacccag 360 gtcaccgtct cctcagaacc caagacgccc aagcctcagc 400 <210> 3 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 3 gtcctggctg ctcttctaca agg 23 <210> 4 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 4 ggtacgtgct gttgaactgt tcc 23 <210> 5 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 5 tttctattac taggcccagc cggccgccca agtacaactg gtc 43 <210> 6 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 6 aaggaaaaaa gcggccgccc cgggctgagg cttgg 35 <210> 7 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 7 ccatgattac gccaagcttt ggagcc 26 <210> 8 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 8 cgatctaaag ttttgtcgtc tttcc 25 <210> 9 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 9 Ser Gly Ser Thr Phe Ser Asn Leu Ala Met Gly 1 5 10 <210> 10 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 10 Ser Arg Gly Gly Gly Asn Thr Phe Tyr Arg Asp Ser Val Lys Gly Arg 1 5 10 15 Phe Thr <210> 11 <211> 19 <212> PRT <213> Artificial sequence <220> <223> Artificial sequence description: Artificially synthesized sequences <400> 11 Ala Ala Arg Asp Gly Glu Tyr Ala Val Ser Val Tyr Tyr Glu Tyr His 1 5 10 15 Tyr Trp Gly

Claims

1. A nanobody of peste des petits ruminants virus (PPRV) that specifically binds to the PPRV F protein (PPRV-F) and comprises three heavy chain complementarity-determining regions CDR-H1, CDR-H2, and CDR-H3, wherein: (a) The amino acid sequence of CDR-H1 is shown in SEQ ID NO: 9; (b) The amino acid sequence of CDR-H2 is shown in SEQ ID NO: 10; (c) The amino acid sequence of CDR-H3 is shown in SEQ ID NO:

11.

2. The PPRV nanobody of claim 1, wherein the heavy chain variable region sequence of the nanobody comprises an amino acid sequence as shown in SEQ ID NO: 1, or the heavy chain variable region of the nanobody comprises an amino acid sequence having more than 80% identity with SEQ ID NO:

1.

3. The PPRV nanobody of claim 1, wherein the heavy chain variable region of the nanobody comprises an amino acid sequence having more than 85% identity with SEQ ID NO:

1.

4. The PPRV nanobody of claim 1, wherein the heavy chain variable region of the nanobody comprises an amino acid sequence having more than 90% identity with SEQ ID NO:

1.

5. The PPRV nanobody of claim 1, wherein the heavy chain variable region of the nanobody comprises an amino acid sequence having more than 95% identity with SEQ ID NO:

1.

6. The PPRV nanobody of claim 1, wherein the heavy chain variable region of the nanobody comprises an amino acid sequence having more than 99% identity with SEQ ID NO:

1.

7. The PPRV nanobody according to any one of claims 1 to 6, wherein the antibody is a camel-derived VHH antibody.

8. A complex comprising a nanobody of PPRV according to any one of claims 1-7, and a functional compound, wherein the functional compound is a labeling molecule.

9. A nucleic acid molecule comprising a polynucleotide sequence encoding a nanobody of PPRV as described in any one of claims 1-7.

10. The nucleic acid molecule of claim 9, comprising: a polynucleotide sequence as shown in SEQ ID NO: 2, or a polynucleotide sequence having more than 80% identity with the polynucleotide sequence shown in SEQ ID NO:

2.

11. The nucleic acid molecule of claim 9, comprising a polynucleotide sequence having more than 85% identity with the polynucleotide sequence shown in SEQ ID NO:

2.

12. The nucleic acid molecule of claim 9, comprising a polynucleotide sequence having more than 90% identity with the polynucleotide sequence shown in SEQ ID NO:

2.

13. The nucleic acid molecule of claim 9, comprising a polynucleotide sequence having more than 95% identity with the polynucleotide sequence shown in SEQ ID NO:

2.

14. The nucleic acid molecule of claim 9, comprising a polynucleotide sequence having more than 99% identity with the polynucleotide sequence shown in SEQ ID NO:

2.

15. A construct comprising the nucleic acid molecule of any one of claims 9-14, wherein the construct is selected from: phage particles, plasmids, viral vectors, or linear nucleic acids.

16. A virus, bacteriophage, or cell that expresses or displays a nanobody of PPRV according to any one of claims 1-7, or comprises a nucleic acid molecule according to any one of claims 9-14, or comprises a construct according to claim 15.

17. A pharmaceutical composition for treating or preventing peste des petits ruminants (PPRV) or a kit for detecting PPRV, comprising: a nanobody according to any one of claims 1-7, a complex according to claim 8, a nucleic acid molecule according to any one of claims 9-14, a construct according to claim 15, or a virus, bacteriophage, or cell according to claim 16.

18. A method for purifying the PPRV nanobody according to any one of claims 1-7, comprising: 1) A mixture of nanobodies containing the PPRV is added to a nickel column, wherein the nickel column is filled with Smart-NI; 2) The PPRV nanobody was eluted with a 200-500 mM imidazole solution.

Images