A quadruple fluorescence detection kit for HPV-specific miR-34, miR-199, and miR-199

Abstract

This application relates to a quadruple fluorescence detection kit for HPV-specific miR-34, miR-199, and miR-199, which includes reverse transcription primers, probes, and upstream and downstream primers corresponding to miR-34, miR-199, and miR-199. In this application, the hairpin stem-loop method is used for reverse transcription of three human papillomavirus-specific microRNAs, and its product is a stable hairpin structure that specifically binds to small molecule microRNAs and excludes long-chain RNA interference. Therefore, it has stronger specificity and lower cost, and at the same time makes quadruple fluorescence quantitative PCR possible. In the quadruple fluorescence quantitative PCR of this application, four sets of primers for miR-34, miR-145, miR-199, and the internal reference, as well as four fluorescent probes, are added to the same reaction tube at the same time, and the fluorescence quantitative PCR is carried out simultaneously without interference. Under the condition of ensuring the detection sensitivity, the detection efficiency is improved. The miR-34, miR-145, and miR-199 quantitative reference products provided in this application can draw a standard curve and quantify the copy number concentration in the specimen, with higher accuracy than the current relative quantitative method.

Description

Technical Field

[0001] This application relates to the field of biomedical detection technologies, and particularly to a quadruple fluorescence detection kit for HPV-specific miR-34, miR-199, and miR-199. Background Art

[0002] Human Papillomavirus (HPV) is an epitheliotropic virus with high specificity. According to the pathogenicity, HPV is divided into two types: high-risk type and low-risk type. "Whether it can cause cancer" is the main indicator of the degree of risk. There are approximately 500,000 new cases of cervical cancer worldwide each year, which is the second most life-threatening malignant tumor for women after breast cancer. The etiological relationship between HPV and cervical cancer has been clarified. It takes a long time from HPV infection to the occurrence of cervical cancer. During this period, detecting whether HPV is infected can help with early detection and early treatment, thus effectively preventing the occurrence of cervical cancer.

[0003] Currently, the genotyping detection of human papillomavirus has been relatively mature after years of development. Most detection methods involve designing primers and probes for multiple different genotypes of HPV and then detecting through PCR. For example, the patents with publication numbers CN107488747A and CN102994647A both use the above methods for testing. However, the above testing methods all require taking exfoliated cervical cells through the vagina, which is an invasive sampling method. Therefore, for many underage, unmarried, or timid women, it will cause greater discomfort and fear.

[0004] According to existing research, the expression levels of miR-34, miR-145, and miR-199 are negatively correlated with the infection of human papillomavirus HPV. Therefore, the concentrations of miR-34, miR-145, and miR-199 in serum can be used to evaluate the damage caused by HPV virus activity to cervical cells, thereby inferring whether there is HPV infection. These three microRNAs can all be used as new biological indicators in clinical detection, which has important clinical significance. However, there is currently no systematic research on determining cervical cell damage through the expression levels of specific viruses.

[0005] Currently, the detection methods for miR-34, miR-145, and miR-199 also rely on PCR detection, mainly including the dye method and the probe method. Currently, both of these methods use the Ct value of the added standardized internal reference for relative quantification, and cannot accurately quantify the specific molecular copy number. The detection limit and sensitivity are unknown. Moreover, the existing methods are all single-channel and single-color detections. Each microRNA requires a separate tube for PCR, resulting in low detection efficiency.

[0006] In view of the above related technologies, the inventors believe that there are defects in the detection sensitivity and detection efficiency of human papillomavirus specific virus. Summary of the Invention

[0007] In order to improve the detection sensitivity and detection efficiency of human papillomavirus specific miR-34, miR-145 and miR-199, the present application provides a quadruple fluorescence detection kit for HPV specific miR-34, miR-199 and miR-199.

[0008] The quadruple fluorescence detection kit for HPV specific miR-34, miR-199 and miR-199 provided by the present application adopts the following technical solutions:

[0009] A quadruple fluorescence detection kit for HPV specific miR-34, miR-199 and miR-199, comprising the following primers and probes:

[0010] The miR-34 stem-loop reverse transcription primer is as shown in Sequence 1, specifically: TACGCTACATTGACGCCATTCGATGCATTAACGCCGGATCAGCTAGCGATTGAC,

[0011] The fluorescence probe for detecting miR-34 is as shown in Sequence 2, specifically: CGATCATCGGTAGCTCGATCGAGC,

[0012] The upstream primer for detecting miR-34 is as shown in Sequence 3, specifically: CAGTTAGCCTAGACTGCATC,

[0013] The downstream primer for detecting miR-34 is as shown in Sequence 4, specifically: TCGATGCCAATCGTTACG;

[0014] The miR-145 stem-loop reverse transcription primer is as shown in Sequence 5, specifically: TCGATTGCCTAGCTGCAGTCGAAATGCTTCGGACGAACGTACGATCTGTGCAT,

[0015] The fluorescence probe for detecting miR-145 is as shown in Sequence 6, specifically: GTATAGAATTGCCATTGTACTCAG,

[0016] The upstream primer for detecting miR-145 is as shown in Sequence 7, specifically: GCTTACTAATCAGTATGTG,

[0017] The downstream primer for detecting miR-145 is as shown in Sequence 8, specifically: CTACGTAACCGTACGT;

[0018] The miR-199 stem-loop reverse transcription primer is as shown in Sequence 9, specifically: TAGCTTGAACTGGCCAATGGATGCATTCCAGGTGCTAAGGTACTGAC,

[0019] The fluorescence probe for detecting miR-199 is as shown in Sequence 10, specifically: CTGATTCCAGTCAAGTCAATGAGTC,

[0020] The upstream primer for detecting miR-199 is as shown in Sequence 11, specifically: TGCAATCCGATTCGTCATG,

[0021] The downstream primer for detecting miR-199 is as shown in Sequence 12, specifically: GTCAAGTTCCGATCGGC.

[0022] By adopting the above technical solution, the three specific viral microRNAs of the present invention are reverse-transcribed by the stem-loop method, which has stronger specificity and lower cost, and at the same time makes it possible for quadruple fluorescence quantitative PCR. Three sets of primers and three different fluorescence probes are designed for different specific viruses in this application, and fluorescence quantitative PCR detection is carried out simultaneously. They do not interfere with each other, and the results of three specific viruses can be obtained in one tube reaction, which greatly improves the detection efficiency while improving the detection sensitivity. At the same time, the degree of damage to cervical cells can be more accurately determined through the expression levels of the three specific viruses, improving the detection effect.

[0023] Preferably, the quadruple fluorescence quantitative PCR detection kit for human papillomavirus-specific miR-34, miR-199 and miR-199 also includes primers and probes for internal reference,

[0024] The stem-loop reverse transcription primer for internal reference is as shown in Sequence 13, specifically: ATCCATGGCTTAGCAGGTAGCTAGTCGAATGCTAGTCAGTCGATGTAAGC,

[0025] The fluorescence probe for detecting internal reference is as shown in Sequence 14, specifically: TGCATCGATACATGTACTAGTAATG,

[0026] The upstream primer for internal reference is as shown in Sequence 15, specifically: GTCTACTTAGTATCGTCT,

[0027] The downstream primer for internal reference is as shown in Sequence 16, specifically: CAGTTCGATCAGTAAG.

[0028] By adopting the above technical solution, adding a standardized internal reference to the kit in the present application can not only effectively monitor the existence of false negatives, but also correct the experimental operation errors generated in the microRNA extraction process and PCR process of different serum samples through the Ct value of the internal reference, and significantly improve the repeatability and stability of the experimental results.

[0029] Preferably, the kit further includes a quantitative reference product and a standardized internal reference:

[0030] The quantitative reference product sequence of miR-34 is shown in Sequence 17, specifically: ACTAGTTGCATGGTAAATCGTGCATCCCAGCGATAAGTGGATTGGTTCAGCGGTGCTGTACA;

[0031] The quantitative reference product sequence of miR-145 is shown in Sequence 18, specifically: CGATGTAATAGCTATGGGCTGCTCTTATCCTGATCGATCGATTTACAAACTAGTGCTAGGCG;

[0032] The quantitative reference product of miR-199 is shown in Sequence 19, specifically: CAGTCAGTCGATGGATAGTCATCTTCACACCGTGTTATCGATCGGACGTAGCGTAGTCAGC;

[0033] The standardized internal reference sequence is shown in Sequence 20, specifically:

[0034] UCAGUGGAUCGUGUCAGUUGGAC.

[0035] By adopting the above technical solution, the detection sensitivity can be further improved through the quantitative reference product, so as to better realize the detection of human papillomavirus specific virus.

[0036] The detection method of the quadruple fluorescence detection kit for HPV specific miR-34, miR-199 and miR-199 includes the following steps:

[0037] S1 Extract microRNA from human serum or plasma to obtain microRNA;

[0038] S2 Reverse transcribe the extracted microRNA with a reverse transcription primer mixture to obtain cDNA;

[0039] S3 Perform PCR fluorescence detection on the reverse transcribed cDNA with a probe primer mixture, an upstream primer mixture and a downstream primer mixture, and miR-34, miR-199 and miR-199 and internal reference amplification curves can be obtained in different channels respectively;

[0040] Among them, the reverse transcription primer mixture is a mixture composed of miR-34 stem-loop reverse transcription primer, miR-199 stem-loop reverse transcription primer, miR-199 stem-loop reverse transcription primer and internal reference stem-loop reverse transcription primer;

[0041] The probe primer mixture is a mixture composed of miR-34 probe primer, miR-199 probe primer, miR-199 probe primer and internal reference probe primer;

[0042] The upstream primer mixture is a mixture composed of miR-34 upstream primer, miR-199 upstream primer, miR-199 upstream primer and internal reference upstream primer;

[0043] The downstream primer mixture is a mixture composed of miR-34 downstream primer, miR-199 downstream primer, miR-199 downstream primer and internal reference downstream primer.

[0044] In summary, the present application includes at least one of the following beneficial technical effects:

[0045] 1. In the present application, the hairpin stem-loop method is used for reverse transcription of three human papillomavirus-specific microRNAs. The product is a stable hairpin structure, which specifically binds to small molecule microRNAs and excludes the interference of long-chain RNAs. Therefore, it has stronger specificity and lower cost, and at the same time makes it possible for quadruple fluorescence quantitative PCR. In the quadruple fluorescence quantitative PCR in the present application, four sets of primers of miR-34, miR-145, miR-199 and internal reference and four different fluorescent probes are added into the same reaction tube at the same time, and the fluorescence quantitative PCR is carried out simultaneously without interference. Four results can be obtained from one tube reaction, and the detection efficiency is improved under the condition of ensuring the detection sensitivity.

[0046] 2. The miR-34, miR-145, miR-199 quantitative reference products provided in the present application can draw a standard curve and quantify the copy number concentration in the specimen, and have higher accuracy than the current relative quantitative method.

[0047] 3. By adding an external standardized internal reference, the kit of the present application can not only effectively monitor the existence of false negatives, but also correct the experimental operation errors generated in the process of microRNA extraction and PCR of different serum samples through the Ct value of the internal reference, and significantly improve the repeatability and stability of the experimental results. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 is the amplification curve of the miR-34 quantitative reference product with different concentrations in the present application.

[0049] Figure 2 It is the amplification curve of the quantitative reference product of different concentrations of miR-145 in this application.

[0050] Figure 3 It is the amplification curve of the quantitative reference product of different concentrations of miR-199 in this application.

[0051] Figure 4 It is the PCR amplification curve of miR-34 of healthy women in this application.

[0052] Figure 5 It is the PCR amplification curve of miR-145 of healthy women in this application.

[0053] Figure 6 It is the PCR amplification curve of miR-194 of healthy women in this application.

[0054] Figure 7 It is the PCR amplification curve of miR-34 of HPV-positive women in this application.

[0055] Figure 8 It is the PCR amplification curve of miR-145 of HPV-positive women in this application.

[0056] Figure 9 It is the PCR amplification curve of miR-194 of HPV-positive women in this application. Detailed implementation method

[0057] The primer and probe sequences of the quadruple fluorescence quantitative PCR detection kit in this application are shown in Table 1:

[0058] Table 1 Sequence information in this application

[0059]

[0060] Example 1. microRNA extraction

[0061] (1) Take 200 μl of serum / plasma and add it to a 1.5 ml centrifuge tube. Add 0.5 ml of Trizol reagent to each tube, and pipette and mix repeatedly with a pipette tip until the protein is completely dissolved. Add the internal reference to each tube to a final concentration of 0.2 nM, mix well, and place on ice for 15 minutes;

[0062] (2) Add 100 μl of pre-cooled chloroform to each tube and mix well by shaking;

[0063] (3) Centrifuge at 12,000 g for 15 min at 4 °C, transfer the supernatant, add an equal volume of pre-cooled phenol / chloroform (1:1), mix well by shaking, and centrifuge at 14,000 g for 10 min at 4 °C;

[0064] (4) Transfer the supernatant, add an equal volume of pre-cooled chloroform, mix well by shaking, centrifuge at 14,000 g for 15 min at 4°C;

[0065] (5) Transfer the supernatant, add an equal volume of isopropanol and glycogen (final concentration is 200 μg / ml), mix well by shaking, centrifuge at 16,000 g for 30 min at 4°C;

[0066] (6) Carefully pour off the supernatant, wash the precipitate once with 1 ml of 70% ethanol, centrifuge at 16,000 g for 10 min at 4°C;

[0067] (7) Discard the supernatant, wait for the ethanol to evaporate, add 10 μl of DEPC water to dissolve, and store at -80°C for later use.

[0068] Example 2. microRNA Reverse Transcription and Quadruple Fluorescent Quantitative PCR

[0069] 1. microRNA Reverse Transcription

[0070] Prepare the reaction solution: as shown in Table 2:

[0071] Table 2

[0072]

[0073] Note: The reverse transcription primer mixture is a mixture composed of miR-34, miR-145, miR-199 and the internal reference reverse transcription primer, and the concentrations of the three are all 10 μM.

[0074] Add the miRNA reaction mixture, reverse transcription primer mixture and BSA to the PCR thin-walled tube; then add the extracted microRNA to the above mixture, pipette and mix well; then put it into the PCR instrument for reverse transcription, and the conditions are: 42°C for 30 minutes, 70°C for 5 minutes; the obtained cDNA is placed in an ice box.

[0075] 2. Quadruple Fluorescent Quantitative PCR

[0076] Prepare the reaction solution: as shown in Table 3:

[0077] Table 3

[0078]

[0079] Note: The probe primer mixture is a mixture composed of miR-34, miR-145, miR-199 and the internal reference probe primer, and the concentrations of the three are all 2 μM; in the upstream primer and downstream primer mixture, the concentrations of the three are all 4 μM.

[0080] Take 5 μL of 2×PCR mixture, 2 probe primer mixtures, a mixture of upstream and downstream primers, and 10 μL of deionized water and add them to a 0.2 mL 8-strip PCR tube. Add 5 μL of reverse-transcribed cDNA to each tube and mix well. Place the PCR reaction tubes into a fluorescence quantitative PCR amplifier, and set the names of the samples to be tested and the concentrations of the quantitative reference products in the corresponding order; selection of the fluorescence detection channel: select the FAM channel to detect miR-34 through the software, select HEX to detect the internal reference, select VIC to detect miR-145, and select Cy5 to detect miR-199. The fluorescence quantitative PCR reaction conditions are as follows: 95°C for 3 minutes, enter the cycle: 95°C for 12 seconds, 60°C for 30 seconds (detect fluorescence), and run for 45 - 50 cycles to end. After the reaction ends, the instrument automatically saves the results. In the corresponding channel, the instrument's built-in software can be used for automatic analysis (or the starting value, ending value, and threshold line value of the baseline can be manually adjusted for analysis), and then record the Ct values and quantification results of the samples. The intersection point of the amplification curve and the threshold line is called Ct (i.e., cycle threshold, which refers to the number of cycles experienced when the fluorescence signal in the PCR reaction tube reaches the set threshold).

[0081] Example 3

[0082] Drawing of the standard curve:

[0083] Dilute the miR-34, miR-145, and miR-199 quantitative reference products (sequences can be seen in Table 4) into 5 concentration gradients respectively, and perform PCR amplification tests according to the above method. Their amplification curves are respectively as Figures 1 - 3 shown. Record the Ct values and quantification results of the samples according to the amplification curves, and obtain their standard curve equations respectively.

[0084] Table 4

[0085]

[0086] Testing:

[0087] Test the serum samples of 5 healthy women who are HPV negative. Perform PCR amplification tests according to the above method. The amplification curves of miR-34, miR-145, and miR-199 are respectively as Figures 4 - 6 shown.

[0088] Test the serum samples of 5 female patients with HPV positive and cervical intraepithelial neoplasia (CIN) II - III. Perform PCR amplification tests according to the above method. The amplification curves of miR-34, miR-145, and miR-199 are respectively as Figures 7 - 9 shown.

[0089] From Figures 1 - 3It can be seen that the curve will change according to the concentration of the quantitative reference. The PCR software can automatically obtain the fixed value results of each sample; finally, the result is corrected by the internal reference Ct value (calibration concentration = detection concentration / 2 -△内参Ct ). If the sample amplification curve is S-shaped, there is a Ct value and the fixed value result is ≥400 copies / mL, report the specific copy number concentration; if the fixed value result is ≤400 copies / mL, report the result as below the detection limit; if the sample amplification curve is flat, no Ct value is displayed or no fixed value result is displayed, it can be judged as positive. Any data without an amplification curve for the internal reference is invalid, and valid data should be obtained after rechecking before reporting the result.

[0090] from Figures 4 - 6 It can be seen that the serum samples of 5 HPV-negative and healthy women were tested and PCR amplification tests were performed according to the above method. The amplification curves of miR-34, miR-145, and miR-199 are as follows: Figures 4 - 6 As shown, it can be seen from the data in the figure that they are all greater than 400 copies / mL, indicating negative.

[0091] from Figures 4 - 6 It can be seen that the serum samples of 5 HPV-positive female patients with cervical intraepithelial neoplasia (CIN) II-III were tested. From the data in the figure, it can be seen that they were all less than 400 copies / mL, and the corresponding HPV was also positive. Therefore, it can be seen that HPV positivity is negatively correlated with the above-mentioned specific microRNA.

[0092] According to the above structures, miR-34, miR-145, and miR-199 have potential applications in determining cervical cell damage.

[0093] The above are all preferred embodiments of the present application, and the protection scope of the present application is not limited thereto. Therefore, any equivalent changes made according to the structure, shape, and principle of the present application should be included in the protection scope of the present application.

Claims

1. A quadruple fluorescence detection kit for HPV-specific miR-34, miR-145, and miR-199, characterized in that, It includes the following primers and probes: The reverse transcription primer for miR-34 by stem-loop method is as shown in Sequence 1, specifically: TACGCTACATTGACGCCATTCGATGCATTAACGCCGGATCAGCTAGCGATTGAC, The fluorescence probe for detecting miR-34 is as shown in Sequence 2, specifically: CGATCATCGGTAGCTCGATCGAGC, The upstream primer for detecting miR-34 is as shown in Sequence 3, specifically: CAGTTAGCCTAGACTGCATC, The downstream primer for detecting miR-34 is as shown in Sequence 4, specifically: TCGATGCCAATCGTTACG; The reverse transcription primer for miR-145 by stem-loop method is as shown in Sequence 5, specifically: TCGATTGCCTAGCTGCAGTCGAAATGCTTCGGACGAACGTACGATCTGTGCAT, The fluorescence probe for detecting miR-145 is as shown in Sequence 6, specifically: GTATAGAATTGCCATTGTACTCAG, The upstream primer for detecting miR-145 is as shown in Sequence 7, specifically: GCTTACTAATCAGTATGTG, The downstream primer for detecting miR-145 is as shown in Sequence 8, specifically: CTACGTAACCGTACGT; The reverse transcription primer for miR-199 by stem-loop method is as shown in Sequence 9, specifically: TAGCTTGAACTGGCCAATGGATGCATTCCAGGTGCTAAGGTACTGAC, The fluorescence probe for detecting miR-199 is as shown in Sequence 10, specifically: CTGATTCCAGTCAAGTCAATGAGTC, The upstream primer for detecting miR-199 is as shown in Sequence 11, specifically: TGCAATCCGATTCGTCATG, The downstream primer for detecting miR-199 is as shown in Sequence 12, specifically: GTCAAGTTCCGATCGGC; The kit also includes primers and probes for internal reference, The reverse transcription primer for internal reference by stem-loop method is as shown in Sequence 13, specifically: ATCCATGGCTTAGCAGGTAGCTAGTCGAATGCTAGTCAGTCGATGTAAGC, The fluorescence probe for detecting internal reference is as shown in Sequence 14, specifically: TGCATCGATACATGTACTAGTAATG, The upstream primer for internal reference is as shown in Sequence 15, specifically: GTCTACTTAGTATCGTCT, The downstream primer for internal reference is as shown in Sequence 16, specifically: CAGTTCGATCAGTAAG.

2. The quadruple fluorescence detection kit for HPV-specific miR-34, miR-145 and miR-199 according to claim 1, characterized in that, The kit also includes a quantitative reference product and a standardized internal reference: The sequence of the quantitative reference product for miR-34 is as shown in Sequence 17, specifically: ACTAGTTGCATGGTAAATCGTGCATCCCAGCGATAAGTGGATTGGTTCAGCGGTGCTGTACA; The sequence of the quantitative reference product for miR-145 is shown in Sequence 18, specifically: CGATGTAATAGCTATGGGCTGCTCTTATCCTGATCGATCGATTTACAAACTAGTGCTAGGCG; The quantitative reference product for miR-199 is shown in Sequence 19, specifically: CAGTCAGTCGATGGATAGTCATCTTCACACCGTGTTATCGATCGGACGTAGCGTAGTCAGC; The sequence of the normalization internal reference is shown in Sequence 20, specifically: UCAGUGGAUCGUGUCAGUUGGAC.

Images