SNP molecular markers for rice genotyping and application thereof

By developing SNP molecular markers and KASP primer sets for rice breeding, the shortcomings of SSR marker technology in rice molecular fingerprinting analysis have been addressed, enabling efficient and economical genotyping and purity identification of rice breeding materials, reducing detection costs and increasing detection throughput.

CN115976260BActive Publication Date: 2025-12-26CHINA NAT SEED GRP CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211441663.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-17
Publication Date
2025-12-26
Estimated Expiration
2042-11-17

AI Technical Summary

Technical Problem

In existing technologies, SSR marker detection technology has poor ease of operation, low efficiency in data analysis, and poor data recording standardization in rice molecular fingerprint analysis, which leads to differences in the molecular fingerprints of breeding materials and increases the risk for seed companies.

Method used

We developed SNP molecular markers for rice breeding, analyzed the core parental population of breeding backbones using microarray technology, screened out effective SNP marker sets, and used KASP primer sets for genotyping and purity identification, thereby reducing detection costs and increasing detection throughput.

Benefits of technology

This technology enables efficient and economical genotyping and purity identification of rice materials, reduces testing costs and increases testing throughput, and ensures the authenticity and purity of breeding materials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115976260B_ABST
    Figure CN115976260B_ABST
Patent Text Reader

Abstract

The present application relates to the field of plant biotechnology and molecular breeding technology, in particular to SNP molecular markers for rice genotyping and application thereof. The present application provides a set of SNP molecular markers for rice genotyping, which can realize the authenticity and purity identification of rice materials by using much less SNP markers than the currently used SSR markers, greatly reducing the detection cost and improving the detection throughput and efficiency. The SNP marker technology based on KASP endpoint fluorescence detection provided by the present application can be used for the authenticity identification of rice, realizing the dual advantages of cost reduction and throughput increase. The rice molecular detection method established by the present application has good application value in rice breeding and production practice.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant biotechnology and molecular breeding technology, and particularly relates to SNP molecular markers for rice genotyping and application thereof. BACKGROUND

[0002] Under the background of the revitalization of seed industry, molecular fingerprint technology will become a powerful tool for crop breeding. The lack of standardized records of the molecular characteristics of materials using molecular fingerprint technology may lead to differences in molecular fingerprints of breeding materials obtained at different stages, greatly increasing the risk of seed companies.

[0003] In recent years, relevant standards for rice molecular fingerprint analysis have been introduced one after another. The SSR standard is currently widely used in the industry. Due to the characteristics of the detection technology itself, the SSR marker technology is significantly weaker than the SNPs marker detection technology in terms of experimental operation convenience, experimental data result analysis efficiency, data record standardization, and single instrument daily detection throughput.

[0004] In order to achieve more convenient, efficient and economical molecular fingerprint identification of a group of specified material groups and their derived offspring, it is of great significance to develop SNP markers for the identification of the core parent population of rice breeding. SUMMARY

[0005] The purpose of the present application is to provide SNP molecular markers for rice genotyping and application thereof.

[0006] In order to achieve the above purpose, the present application analyzes the core parent population of rice breeding by chip technology, obtains more than 50,000 SNPs variation information, and determines the SNPs marker group for identifying the parent population by using a specific screening scheme. It is verified through experiments that the SNPs marker group can be used for genotyping, authenticity and purity identification of the above-mentioned core parent population of rice breeding.

[0007] Specifically, the present application provides the following technical solutions:

[0008] In a first aspect, the present application provides SNP molecular markers for genotyping rice, which comprise any one or a combination of at least two of the following SNP molecular markers: F0119312673GA, R0136269938AG, F0136380590GA, R0206491684CT, R0204051573TC, R0327455062GA, R0507762619GC, F0523332421GA, R0601649489CT, R0620792855TC, F0819572912CT, R0819367050GA, R0908001195CT, R0921310853CT, F1013749894GT and F1109053928AG.

[0009] In some embodiments of the present application, the SNP molecular markers for genotyping rice comprise any one of the following SNP molecular markers: F0119312673GA, R0136269938AG, F0136380590GA, R0206491684CT, R0204051573TC, R0327455062GA, R0507762619GC, F0523332421GA, R0601649489CT, R0620792855TC, F0819572912CT, R0819367050GA, R0908001195CT, R0921310853CT, F1013749894GT and F1109053928AG.

[0010] In some embodiments of the present application, the SNP molecular markers for genotyping rice comprise a combination of any 2-16 of the following SNP molecular markers: F0119312673GA, R0136269938AG, F0136380590GA, R0206491684CT, R0204051573TC, R0327455062GA, R0507762619GC, F0523332421GA, R0601649489CT, R0620792855TC, F0819572912CT, R0819367050GA, R0908001195CT, R0921310853CT, F1013749894GT and F1109053928AG.

[0011] The molecular markers described above, except R0921310853CT and R0507762619GC, are named according to the following rules: the first letter represents the direction of the sequence (F represents the sense strand, and R represents the antisense strand), the second and third positions are the chromosome (for example: 01 represents chromosome 1), the fourth to eleventh positions represent the coordinates (MSU6.0), and the twelfth and thirteenth positions are the base variation type in the direction indicated by the first letter. For example, the SNP molecular marker F0119312673GA has a polymorphic site on the sense strand of rice chromosome 1 at coordinates (MSU6.0) 19312673, and the polymorphism is G / A. The first letter of R0921310853CT and R0507762619GC corresponds to the twelfth and thirteenth bases, which is different from the above rules.

[0012] Specifically, the specific information of the polymorphic sites of the above-mentioned molecular markers is shown in Table 1.

[0013] Table 1

[0014]

[0015]

[0016] Specifically, the molecular marker nucleotide sequence described above is one or more of the sequences shown as SEQ ID NO. 49-64, wherein the polymorphic site of the sequence shown as SEQ ID NO. 49 is at position 35, with polymorphism A / G; the polymorphic site of the sequence shown as SEQ ID NO. 50 is at position 39, with polymorphism T / C; the polymorphic site of the sequence shown as SEQ ID NO. 51 is at position 20, with polymorphism A / G; the polymorphic site of the sequence shown as SEQ ID NO. 52 is at position 20, with polymorphism A / G; the polymorphic site of the sequence shown as SEQ ID NO. 53 is at position 70, with polymorphism A / G; the polymorphic site of the sequence shown as SEQ ID NO. 54 is at position 44, with polymorphism T / C; the polymorphic site of the sequence shown as SEQ ID NO. 55 is at position 20, with polymorphism G / C; the polymorphic site of the sequence shown as SEQ ID NO. 56 is at position 20, with polymorphism A / G; the polymorphic site of the sequence shown as SEQ ID NO. 57 is at position 20, with polymorphism A / G; the polymorphic site of the sequence shown as SEQ ID NO. 58 is at position 81, with polymorphism A / G; the polymorphic site of the sequence shown as SEQ ID NO. 59 is at position 31, with polymorphism T / C; the polymorphic site of the sequence shown as SEQ ID NO. 60 is at position 38, with polymorphism T / C; the polymorphic site of the sequence shown as SEQ ID NO. 61 is at position 20, with polymorphism A / G; the polymorphic site of the sequence shown as SEQ ID NO. 62 is at position 22, with polymorphism T / C; the polymorphic site of the sequence shown as SEQ ID NO. 63 is at position 78, with polymorphism T / G; and the polymorphic site of the sequence shown as SEQ ID NO. 64 is at position 20, with polymorphism A / G.

[0017] In some embodiments of the present application, the SNP molecular marker for genotyping rice comprises any one of the molecular markers with nucleotide sequences shown as SEQ ID NO. 49-64.

[0018] The sequences shown as SEQ ID NO. 49-64 are specifically as follows:

[0019] SEQ ID NO. 49:

[0020] CATTGTGGTACAGTATTCACGCAGCAATGCACAGGGTTTTCATCTAATGTTATAGG;

[0021] SEQ ID NO. 50:

[0022] TGTTTCAGGGACCGAGCTACGGCCTACGGGCAGCGACTTGTTTTTACCGTCATTTGCAGC;

[0023] SEQ ID NO. 51:

[0024] CCCGAAAGTTCAACGTCCAGTGATGAAAACCTTTCAGCACCCCCTTGTGTAGTGACATTTA;

[0025] SEQ ID NO. 52:

[0026] CACCATTGATCCTTCCATAGGCAACCTCACCTACCTGAGAAAGCTTGATCTCCCTGTGAATCATCTAACTGGTACCATCCCTTCAGAGCTTGGTCGTC;

[0027] SEQ ID NO. 53:

[0028] AGCATACCTCGTTCATGGCGCGTTTCGGAAGCTCTTGAATATGGACTAGTCGGTGTGAACGAGGGGATCATCTCAACAGAGGTAAGAAG;

[0029] SEQ ID NO. 54:

[0030] ACAAATGGAGGTCTAGAGAAGGATAAAGATTAGATTATTTTGACGACTACAGACTTTGTACAT;

[0031] SEQ ID NO. 55:

[0032] CACCATGGTTCTTGGTTAACTTGGATTCAACAACATGAATAATGTCCTGTGTGGA;

[0033] SEQ ID NO. 56:

[0034] ATTACAAGCGTTTCCATCAGCAATGCTCTCGATCGATTCAGCAACTTCGGTCTCTTTCCGGTGAGCTGGTT;

[0035] SEQ ID NO. 57:

[0036] ACAATCTGGCTTGATCTCCGCAACTGGTGATATTGAGTCACAAAGCACAGTTACTGAAGAACGTGAACTAGGTAGTGCATGA;

[0037] SEQ ID NO. 58:

[0038] CCAAGGACACACTAACGGTCTTTCCAAAAGAATCATGAAGATGACAAGATATCAGGACTTGTTGTTTTCTGACAATGGTAGAACCGTCCAACACCAATTA;

[0039] SEQ ID NO. 59:

[0040] GCACAAGCCAACGTATCATAAAGTGGGTGTCACGAATTCGCGTCGCTCAT;

[0041] SEQ ID NO. 60:

[0042] GGATCAATAACACGTCCGCCTGCACTAAATGCTGATTCTGAAGCTACAGGTGACACT;

[0043] SEQ ID NO. 61:

[0044] GTACTTATGATCGAGACATGCATGGTTTCATATATGCATGCAATGCATGGACCATGTACT;

[0045] SEQ ID NO. 62:

[0046] GGTTGTAAAATAAGTGGAGTGCCTGTATGTATCTGTATGCATGCACGGCA;

[0047] SEQ ID NO. 63:

[0048] CTTGGACCGGCAAACACATGCATGTGTGGCTACAGCAACTTGCTAATTAACTGGTATATGTGTCTCATTCACAAATGTGTAGCTTCCGTATCTAACA;

[0049] SEQ ID NO. 64:

[0050] CGGTGTCAGAGATCAGAATGGGGAGAAGAGGAGGAGGAGAGAGAAGCTAGA.

[0051] In some embodiments of the present application, the SNP molecular marker for genotyping rice comprises a combination of any 2-16 of the molecular markers with nucleotide sequences as shown in SEQ ID NO. 49-64.

[0052] The present application also provides one or more of the SNP molecular markers amplified by the KASP primer sets shown below: F0119312673GA: SEQ ID NO. 1-3; R0136269938AG: SEQ ID NO. 4-6; F0136380590GA: SEQ ID NO. 7-9; R0206491684CT: SEQ ID NO. 10-12; R0204051573TC: SEQ ID NO. 13-15; R0327455062GA: SEQ ID NO. 16-18; R0507762619GC: SEQ ID NO. 19-21; F0523332421GA: SEQ ID NO. 22-24; R0601649489CT: SEQ ID NO. 25-27; R0620792855TC: SEQ ID NO. 28-30; F0819572912CT: SEQ ID NO. 31-33; R0819367050GA: SEQ ID NO. 34-36; R0908001195CT: SEQ ID NO. 37-39; R0921310853CT: SEQ ID NO. 40-42; F1013749894GT: SEQ ID NO. 43-45; F1109053928AG: SEQ ID NO. 46-48.

[0053] The above SNP molecular markers can be used for genotyping the rice breeding core parent materials shown in Table 2, and then identifying the authenticity and purity of these rice breeding materials.

[0054] In a second aspect, the present application provides a primer set for genotyping rice, which comprises primer pairs for amplifying the above-mentioned SNP molecular markers.

[0055] Preferably, the primer set comprises one or more of the following primer pairs: the primer pair set forth in SEQ ID NO. 1 and 3, the primer pair set forth in SEQ ID NO. 2 and 3, the primer pair set forth in SEQ ID NO. 4 and 6, the primer pair set forth in SEQ ID NO. 5 and 6, the primer pair set forth in SEQ ID NO. 7 and 9, the primer pair set forth in SEQ ID NO. 8 and 9, the primer pair set forth in SEQ ID NO. 10 and 12, the primer pair set forth in SEQ ID NO. 11 and 12, the primer pair set forth in SEQ ID NO. 13 and 15, the primer pair set forth in SEQ ID NO. 14 and 15, the primer pair set forth in SEQ ID NO. 16 and 18, the primer pair set forth in SEQ ID NO. 17 and 18, the primer pair set forth in SEQ ID NO. 19 and 21, the primer pair set forth in SEQ ID NO. 20 and 21, the primer pair set forth in SEQ ID NO. 22 and 24, the primer pair set forth in SEQ ID NO. 23 and 24, the primer pair set forth in SEQ ID NO. 25 and 27, the primer pair set forth in SEQ ID NO. 26 and 27, the primer pair set forth in SEQ ID NO. 28 and 30, the primer pair set forth in SEQ ID NO. 29 and 30, the primer pair set forth in SEQ ID NO. 31 and 33, the primer pair set forth in SEQ ID NO. 32 and 33, the primer pair set forth in SEQ ID NO. 34 and 36, the primer pair set forth in SEQ ID NO. 35 and 36, the primer pair set forth in SEQ ID NO. 37 and 39, the primer pair set forth in SEQ ID NO. 38 and 39; the primer pair set forth in SEQ ID NO. 40 and 42, the primer pair set forth in SEQ ID NO. 41 and 42; the primer pair set forth in SEQ ID NO. 43 and 45, the primer pair set forth in SEQ ID NO. 44 and 45; the primer pair set forth in SEQ ID NO. 46 and 48, the primer pair set forth in SEQ ID NO. 47 and 48.

[0056] Further preferably, the primers in the primer set are KASP marker primers.

[0057] In some embodiments of the application, the primer set comprises any one of the following KASP marker primer pairs:

[0058] F0119312673GA: SEQ ID NO. 1-3;

[0059] R0136269938AG: SEQ ID NO. 4-6;

[0060] F0136380590GA: SEQ ID NO. 7-9;

[0061] R0204051573TC: SEQ ID NO. 13-15;

[0062] R0204051573TC: SEQ ID NO. 13-15;

[0063] R0327455062GA: SEQ ID NO. 16-18;

[0064] R0507762619GC: SEQ ID NO. 19-21;

[0065] F0523332421GA: SEQ ID NO. 22-24;

[0066] R0601649489CT: SEQ ID NO. 25-27;

[0067] R0620792855TC: SEQ ID NO. 28-30;

[0068] F0819572912CT: SEQ ID NO. 31-33;

[0069] R0819367050GA: SEQ ID NO. 34-36;

[0070] R0908001195CT: SEQ ID NO. 37-39;

[0071] R0921310853CT: SEQ ID NO. 40-42;

[0072] F1013749894GT: SEQ ID NO. 43-45;

[0073] F1109053928AG: SEQ ID NO. 46-48.

[0074] In some embodiments of the application, the primer set comprises any 2-16 of the following KASP marker primer pairs:

[0075] F0119312673GA: SEQ ID NO. 1-3;

[0076] R0136269938AG: SEQ ID NO. 4-6;

[0077] F0136380590GA: SEQ ID NO. 7-9;

[0078] R0206491684CT: SEQ ID NO. 10-12;

[0079] R0204051573TC: SEQ ID NO. 13-15;

[0080] R0327455062GA: SEQ ID NO. 16-18;

[0081] R0507762619GC: SEQ ID NO. 19-21;

[0082] F0523332421GA: SEQ ID NO. 22-24;

[0083] R0601649489CT: SEQ ID NO. 25-27;

[0084] R0620792855TC: SEQ ID NO. 28-30;

[0085] F0819572912CT: SEQ ID NO. 31-33;

[0086] R0819367050GA: SEQ ID NO. 34-36;

[0087] R0908001195CT: SEQ ID NO. 37-39;

[0088] R0921310853CT: SEQ ID NO. 40-42;

[0089] F1013749894GT: SEQ ID NO. 43-45;

[0090] F1109053928AG: SEQ ID NO. 46-48.

[0091] The primer sets described above can be used for efficient amplification and detection of the SNP molecular markers described above, and further used for genotyping, authenticity and purity identification of the core parent materials of rice breeding (shown in Table 2).

[0092] In a third aspect, the present application provides a kit comprising the primer sets described above.

[0093] Preferably, the kit further comprises other PCR reaction reagents required for KASP technology detection, including but not limited to KASP premix, analysis premix, water, etc.

[0094] In a fourth aspect, the present application provides a rice breeding chip comprising the SNP molecular markers or detection reagents thereof described above.

[0095] The rice breeding chip can be used for genotyping, authenticity and purity identification of the core parent materials of rice breeding (shown in Table 2).

[0096] In a fifth aspect, the present application provides the following application of any one of the above SNP molecular markers, or the detection reagent thereof, or the above primer set, or the kit comprising the primer set:

[0097] (1) application in rice genotyping;

[0098] (2) application in rice variety identification;

[0099] (3) application in rice authenticity and / or purity identification;

[0100] (4) application in rice breeding material detection;

[0101] (5) application in rice seed or propagation quality monitoring;

[0102] (6) application in rice breeding chip preparation;

[0103] (7) application in rice molecular marker assisted breeding;

[0104] (8) application in rice germplasm resource molecular fingerprint analysis.

[0105] Preferably, in the above applications, the rice to be detected is the rice material or its progeny material in the core parent group of rice breeding shown in Table 2.

[0106] In a sixth aspect, the present application provides a rice genotyping method, which comprises detecting the genotype of the above SNP molecular marker in the rice to be detected, and obtaining the genotyping result of the rice to be detected.

[0107] In the above method, the genotype of the above SNP molecular marker in the rice to be detected can be detected by using the above primer set or kit.

[0108] In a seventh aspect, the present application provides a method for identifying the authenticity and / or purity of rice, which comprises detecting the genotype of the above SNP molecular marker in the rice to be detected, comparing the obtained genotype of the rice to be detected with the corresponding genotype of a reference sample, and judging the authenticity and / or purity of the rice.

[0109] In the above method, the genotype of the above SNP molecular marker in the rice to be detected can be detected by using the above primer set or kit.

[0110] In the above method, the reference sample is a standard control of the rice material.

[0111] The above technical solutions provided by the application all establish rigorous test schemes, and the expected effects are achieved through screening, comparison, testing, and application practice.

[0112] The application provides a set of SNP molecular markers for genotyping of rice, identifying authenticity and purity of rice, and the SNP molecular marker group can identify authenticity and purity of rice materials by using a number of SNP markers far less than 48 SSR markers currently used, thereby greatly reducing detection cost and improving detection throughput and efficiency.

[0113] In a breeding population based on more than 100 materials, theoretically, a single nucleotide polymorphism (SNP) with a binary state can distinguish 256 haplotypes at 8 polymorphic sites. By using the SNP marker technology based on KASP endpoint fluorescence detection provided by the application, authenticity of rice can be identified by using SNP markers far less than 48 SSR markers, and the dual advantages of reducing cost and increasing throughput are achieved. The method for molecular detection of rice established by the application has good application value in rice breeding and production practice. BRIEF DESCRIPTION OF DRAWINGS

[0114] Figures 1-4 Figure 2 is a type diagram of the Illumina chip genotyping effect in Example 2 of the application, wherein, Figure 1 : the qualified type is characterized by the same type of clustering, large distance between different types, and no abnormal type; Figure 2 : the unqualified type is characterized by an abnormal type with a low signal value or no signal value; Figure 3 : the unqualified type is characterized by a heterozygous genotype appearing under the premise of expected homozygous genotype in the parent population; Figure 4 : the unqualified type is characterized by more than two clustering types appearing under the premise of expected two homozygous genotypes.

[0115] Figures 5-20 Figure 2 is a type diagram of the Illumina chip genotyping effect in Example 2 of the application, wherein, Figure 5 : the marker F0119312673GA, Figure 6 : the marker F0136380590GA, Figure 7 : the marker R0136269938AG, Figure 8 : the marker R0206491684CT, Figure 9 : the marker R0204051573TC, Figure 10 : the marker R0327455062GA, Figure 11 : the marker F0523332421GA, Figure 12 : the marker R0507762619GC, Figure 13F0119312673 GA, Figure 14 F0119312673 GA, Figure 15 F0119312673 GA, Figure 16 F0119312673 GA, Figure 17 F0119312673 GA, Figure 18 F0119312673 GA, Figure 19 F0119312673 GA, Figure 20 F0119312673 GA.

[0116] Figures 21-36 F0119312673 GA, Figure 21 F0119312673 GA, Figure 22 F0119312673 GA, Figure 23 F0119312673 GA, Figure 24 F0119312673 GA, Figure 25 F0119312673 GA, Figure 26 F0119312673 GA, Figure 27 F0119312673 GA, Figure 28 F0119312673 GA, Figure 29 F0119312673 GA, Figure 30 F0119312673 GA, Figure 31 F0119312673 GA, Figure 32 F0119312673 GA, Figure 33 F0119312673 GA, Figure 34 F0119312673 GA, Figure 35 F0119312673 GA, Figure 36 F0119312673 GA.

[0117] Figures 37-52 F0119312673 GA, Figure 37 F0119312673 GA, Figure 38 F0119312673 GA, Figure 39 F0119312673 GA, Figure 40 F0119312673 GA, Figure 41R0204051573TC for marker Figure 42 R0327455062GA for marker Figure 43 R0507762619GC for marker Figure 44 F0523332421GA for marker Figure 45 R0601649489CT for marker Figure 46 R0620792855TC for marker Figure 47 F0819572912CT for marker Figure 48 R0819367050GA for marker Figure 49 R0908001195CT for marker Figure 50 R0921310853CT for marker Figure 51 F1013749894GT for marker Figure 52 F1109053928AG for marker DETAILED DESCRIPTION

[0118] Definitions of terms used in the present invention are as follows:

[0119] The term "single nucleotide polymorphism" or "SNP" or "SNP marker" or "SNP site" as used herein refers to a nucleotide sequence present in the genomic sequence of a chromosome, a change in the polynucleotide sequence caused by a difference in the nucleotide sequence (change of a single nucleotide - A, T, C or G) that results in the diversity of the genomic chromosome, and in turn allows different alleles (e.g., alleles from two different individuals) or different individuals to be distinguished from each other. The change can occur in the coding region of a gene or in the non-coding region (e.g., in the promoter region or its vicinity, or in an intron) or in an intergenic region.

[0120] The term "allele" as used herein refers to a different form of the same gene present in the homologous chromosomes in a given locus.

[0121] The term "SNP chip" or "chip" as used herein refers to a biochip that can analyze the presence of SNPs contained in the sample DNA by arranging and attaching several hundred to several hundred thousand of biomolecules such as DNA, DNA fragments, cDNA, oligonucleotides, RNA, or RNA fragments having a known sequence to a small solid substrate formed of glass, silicon, or nylon at a certain interval. Hybridization occurs between the nucleic acids contained in the sample and the ones fixed on the surface according to the degree of complementarity. By detecting and judging the hybridization, information about the genetic material contained in the sample can be obtained at the same time.

[0122] The main types of current DNA chips include: in-situ synthesis method, which uses modified oligonucleotide monomers to synthesize spatially combined sequences in-situ to form DNA chips, thereby directly synthesizing oligonucleotide arrays on a hard surface. Off-chip synthesis method, which involves using a spotting method to spot pre-synthesized sequences to specific sites to form DNA chips, thereby forming DNA arrays fixed on a glass substrate. Microbead method, which involves directly synthesizing DNA on coded microbeads or fixing pre-prepared sequences to coded microbeads, and then assembling them into microbead chips.

[0123] The term "molecular markers" or "polymorphic sites" used herein refers to genetic markers based on nucleotide sequence variations in genetic material between individuals, which are a direct reflection of genetic polymorphism at the DNA level. Compared with other genetic markers such as morphological markers, biochemical markers, and cytological markers, the advantages of DNA molecular markers include but are not limited to: most molecular markers are co-dominant, making it very convenient to select recessive traits; genomic variation is extremely rich, and the number of molecular markers is almost unlimited; DNA from different tissues at different stages of biological development can be used for marker analysis; molecular markers reveal variations from DNA; they are neutral and do not affect the expression of target traits and are not linked to undesirable traits; detection methods are simple and rapid. With the development of molecular biology techniques, there are dozens of DNA molecular marker techniques, which are widely used in genetic breeding, genome mapping, gene positioning, species relationship identification, gene library construction, gene cloning, etc. In the context of the present application, molecular markers generally refer to SNP markers.

[0124] The term "KASP" used herein refers to competitive allele-specific polymerase chain reaction, which can analyze gene mutations (SNP) and is expected to become the preferred technology platform for plant genome analysis.

[0125] The term "authenticity" used herein refers to the uniqueness of an organism, especially the uniqueness, consistency and stability of the species attribute of rice under different propagation sources, which is characterized by whether the comparison of the uniqueness, consistency and stability of the test sample and the standard sample is consistent.

[0126] The term "purity" used herein in the context of the present application refers to the content of the target seed in a batch of seeds, especially rice seeds.

[0127] To achieve the purpose of the present application, the present application first screens polymorphic sites capable of distinguishing the rice breeding core backbone parents by comparing chip detection data of 155 rice breeding core backbone parents, and obtains 16 polymorphic sites distributed in different chromosomes capable of completely distinguishing the rice breeding core backbone parents. Then primers capable of detecting the 16 polymorphic sites are developed, and the developed primers can be used to identify the authenticity and purity of rice.

[0128] Specifically, the present application provides the following technical solutions.

[0129] In a first aspect, the present application provides molecular markers for genotyping rice, comprising one or more of the following molecular markers: F0119312673GA, R0136269938AG, F0136380590GA, R0206491684CT, R0204051573TC, R0327455062GA, R0507762619GC, F0523332421GA, R0601649489CT, R0620792855TC, F0819572912CT, R0819367050GA, R0908001195CT, R0921310853CT, F1013749894GT, and F1109053928AG.

[0130] In a second aspect, the present application provides primer sets for genotyping rice, the primer set being selected from one or more of the following primer sets:

[0131] a primer pair as shown in SEQ ID NO. 1 and 3 and / or a primer pair as shown in SEQ ID NO. 2 and 3;

[0132] a primer pair as shown in SEQ ID NO. 4 and 6 and / or a primer pair as shown in SEQ ID NO. 5 and 6;

[0133] a primer pair as shown in SEQ ID NO. 7 and 9 and / or a primer pair as shown in SEQ ID NO. 8 and 9;

[0134] a primer pair as shown in SEQ ID NO. 10 and 12 and / or a primer pair as shown in SEQ ID NO. 11 and 12;

[0135] a primer pair as shown in SEQ ID NO. 13 and 15 and / or a primer pair as shown in SEQ ID NO. 14 and 15;

[0136] a primer pair as shown in SEQ ID NO. 16 and 18 and / or a primer pair as shown in SEQ ID NO. 17 and 18;

[0137] the pair of primers of SEQ ID NO. 19 and 21 and / or the pair of primers of SEQ ID NO. 20 and 21 ;

[0138] the pair of primers of SEQ ID NO. 22 and 24 and / or the pair of primers of SEQ ID NO. 23 and 24;

[0139] the pair of primers of SEQ ID NO. 25 and 27 and / or the pair of primers of SEQ ID NO. 26 and 27;

[0140] the pair of primers of SEQ ID NO. 28 and 30 and / or the pair of primers of SEQ ID NO. 29 and 30;

[0141] the pair of primers of SEQ ID NO. 31 and 33 and / or the pair of primers of SEQ ID NO. 32 and 33;

[0142] the pair of primers of SEQ ID NO. 34 and 36 and / or the pair of primers of SEQ ID NO. 35 and 36;

[0143] the pair of primers of SEQ ID NO. 37 and 39 and / or the pair of primers of SEQ ID NO. 38 and 39;

[0144] the pair of primers of SEQ ID NO. 40 and 42 and / or the pair of primers of SEQ ID NO. 41 and 42;

[0145] the pair of primers of SEQ ID NO. 43 and 45 and / or the pair of primers of SEQ ID NO. 44 and 45;

[0146] the pair of primers of SEQ ID NO. 46 and 48 and / or the pair of primers of SEQ ID NO. 47 and 48.

[0147] In a third aspect, the present application provides a pair of primers for genotyping of rice, the pair of primers being selected from the group consisting of a pair of primers for amplifying one or more of the following molecular markers: F0119312673GA, R0136269938AG, F0136380590GA, R0206491684CT, R0204051573TC, R0327455062GA, R0507762619GC, F0523332421GA, R0601649489CT, R0620792855TC, F0819572912CT, R0819367050GA, R0908001195CT, R0921310853CT, F1013749894GT and F1109053928AG.

[0148] In a fourth aspect, the present application provides a kit for genotyping of rice comprising primer pairs selected from the group consisting of primers for amplifying one or more of the following molecular markers: F0119312673GA, R0136269938AG, F0136380590GA, R0206491684CT, R0204051573TC, R0327455062GA, R0507762619GC, F0523332421GA, R0601649489CT, R0620792855TC, F0819572912CT, R0819367050GA, R0908001195CT, R0921310853CT, F1013749894GT and F1109053928AG.

[0149] In some embodiments, the kit further comprises other PCR reagents for KASP detection, including but not limited to DNA polymerase, preferably high-fidelity DNA polymerase, buffer, dNTPs, etc.

[0150] In a fifth aspect, the present application provides use of the molecular marker of the first aspect, the primer set of the second aspect, the primer pair of the third aspect or the kit of the fourth aspect for identifying the authenticity and / or purity of rice.

[0151] In a sixth aspect, the present application provides use of the molecular marker of the first aspect, the primer set of the second aspect, the primer pair of the third aspect or the kit of the fourth aspect for monitoring the quality of seed production or propagation of rice.

[0152] In a seventh aspect, the present application provides a method for genotyping of rice, comprising the step of identifying the genotype of the molecular marker of the first aspect.

[0153] In some embodiments, the genotype of the molecular marker of the first aspect is identified using the primer set of the second aspect, the primer pair of the third aspect or the kit of the fourth aspect.

[0154] In an eighth aspect, the present application provides a method for identifying the authenticity and / or purity of rice, comprising the step of identifying the genotype of the molecular marker of the first aspect, and,

[0155] comparing the result with the corresponding genotype of the reference sample, thereby determining the authenticity and / or purity of the rice.

[0156] In some embodiments of the present application, the genotype of the molecular marker of the first aspect is identified using the primer set of the second aspect, the primer pair of the third aspect or the kit of the fourth aspect.

[0157] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0158] Information on the core parent rice lines used in the following examples can be found on the China Rice Data Center website. The rice materials can be obtained through commercial channels or from China Seed Group Co., Ltd.

[0159] Example 1: Identification of polymorphic sites in haplotypes of 155 core backbone parents in rice breeding, and design, synthesis, and testing of marker sequences.

[0160] The development process of the SNP molecular markers of this invention is briefly summarized as follows:

[0161] 1. First round of filtering, tagging and filtering:

[0162] For 155 core parental lines of rice breeding backbone (Tables 2 and 3), using existing microarray genotype data, high-quality loci in the microarray were selected to improve the genotyping effect of the markers. Figure 1 ), remove low-quality sites ( Figure 2 , Figure 3 and Figure 4 Based on the detection rate of the labeled data, markers with low detection rates were removed, and sites containing invalid data were also removed. Using Primer3, markers were designed for the 500bp segments upstream and downstream of the SNP, and sites where marker design could not be successfully completed were removed. Based on the genotype of the microarray data, duplicate sites were removed, and the PIC (polymorphism information content) value of the site was calculated. Sites with a PIC of 0 were removed, resulting in a total of 4956 sites being screened.

[0163] 2. Second round of screening, SNP marker group calculation:

[0164] Calculate the PIC value for each locus. Select the locus with the highest PIC value as the first locus and use it to divide all materials into two groups. Calculate the weighted PIC value of the remaining loci within each group, calculated as the locus's PIC within the group multiplied by the number of materials in the group / the total number of materials, and sum these values. Select the locus with the highest weighted PIC value as the selected locus. Regroup the materials from the previous round and repeat these two steps until the total number of groups equals the total number of materials, or the total number of groups remains unchanged for two consecutive rounds. The resulting locus list is the selected list, yielding a total of 15 loci, which can completely distinguish 155 materials. Calculate the distance matrix between the 4956 loci and select approximately 10 loci closest to the selected locus as candidate loci, for a total of 165 loci selected for labeling design.

[0165] 3. Third round of screening, marking for development:

[0166] KASP markers were designed at 165 loci, a total of 77 markers were designed, and 24 markers with good typing effect were selected by parent experiment verification. The second round of screening process was repeated on 155 materials, and 16 markers were selected, which could distinguish 155 materials (Table 2 and Table 3).

[0167] 4. Fourth round of screening, hybrid F1 material verification: using the selected 16 markers to verify the F1 hybrid by experiment.

[0168] Table 2 Haplotype information of 155 rice breeding core backbone parents (1)

[0169]

[0170]

[0171]

[0172]

[0173]

[0174] Table 3 Haplotype information of 155 rice breeding core backbone parents (2)

[0175]

[0176]

[0177]

[0178]

[0179]

[0180] Note: Hom1 refers to homozygous genotype 1, Hom2 refers to homozygous genotype 2, wherein,

[0181] For F0119312673GA, Hom1 is TT, and Hom2 is CC;

[0182] For R0136269938AG, Hom1 is AA, and Hom2 is GG;

[0183] For F0136380590GA, Hom1 is GG, and Hom2 is AA;

[0184] For R0206491684CT, Hom1 is GG, and Hom2 is AA;

[0185] For R0204051573TC, Hom1 is TT, and Hom2 is CC;

[0186] For R0327455062GA, Hom1 is GG, and Hom2 is AA;

[0187] For R0507762619GC, Hom1 is CC, and Hom2 is GG;

[0188] For F0523332421GA, Hom1 is GG, and Hom2 is AA;

[0189] For R0601649489CT, Hom1 is GG, and Hom2 is AA;

[0190] For R0620792855TC, Hom1 is CC, and Hom2 is TT;

[0191] For F0819572912CT, Hom1 is AA, and Hom2 is GG;

[0192] For R0819367050GA, Hom1 is GG, and Hom2 is AA;

[0193] For R0908001195CT, Hom1 is AA, and Hom2 is GG;

[0194] For R0921310853CT, Hom1 is TT, and Hom2 is CC;

[0195] For F1013749894GT, Hom1 is AA, and Hom2 is CC;

[0196] For F1109053928AG, Hom1 is GG, and Hom2 is AA.

[0197] Through the third round of screening, 16 groups of successfully typed primer combinations were obtained, each primer combination consisting of three primers, and the sequences thereof are shown in SEQ ID NO. 1-48 (from SEQ ID NO. 1 to SEQ ID NO. 48, every three sequences are a primer combination), and the 48 primer sequences of the 16 molecular markers SEQ ID NO. 1-SEQ ID No. 48 were synthesized by Shanghai Biotechnology Co., Ltd. The sequences of the primers for the 16 polymorphic sites are as follows:

[0198] SEQ ID NO. 1 KRCI01S02 forward primer 1:

[0199] GAAGGTCGGAGTCAACGGATTCCTATAACATTAGATGAAAACT;

[0200] SEQ ID NO. 2 KRCI01S02 forward primer 2:

[0201] GAAGGTGACCAAGTTCATGCTCCTATAACATTAGATGAAAACC;

[0202] SEQ ID NO. 3 KRCI01S02 reverse primer: CATTGTGGTACAGTATTCAC;

[0203] SEQ ID NO. 4 KRCI01S05 forward primer 1:

[0204] GAAGGTCGGAGTCAACGGATTGCTGCAAATGACGGTAAAAACA;

[0205] SEQ ID NO. 5 KRCI01S05 forward primer 2:

[0206] GAAGGTGACCAAGTTCATGCTGCTGCAAATGACGGTAAAAACG;

[0207] SEQ ID NO. 6 KRCI01S05 reverse primer: TGTTTCAGGGACCGAGCTAC;

[0208] SEQ ID NO. 7 KRCI01S06 forward primer 1:

[0209] GAAGGTCGGAGTCAACGGATTCCCGAAAGTTCAACGTCCAG;

[0210] SEQ ID NO. 8 KRCI01S06 forward primer 2:

[0211] GAAGGTGACCAAGTTCATGCTCCCGAAAGTTCAACGTCCAA;

[0212] SEQ ID NO. 9 KRCI01S06 reverse primer: TAAATGTCACTACACAAGGG;

[0213] SEQ ID NO. 10 KRCI02S12 forward primer 1:

[0214] GAAGGTCGGAGTCAACGGATTCACCATTGATCCTTCCATAG;

[0215] SEQ ID NO. 11 KRCI02S12 forward primer 2:

[0216] GAAGGTGACCAAGTTCATGCTCACCATTGATCCTTCCATAA;

[0217] SEQ ID NO. 12 KRCI02S12 reverse primer: GACGACCAAGCTCTGAAGGG;

[0218] SEQ ID NO. 13 KRCI02S15 forward primer 1:

[0219] GAAGGTCGGAGTCAACGGATTCTTCTTACCTCTGTTGAGAT;

[0220] SEQ ID NO. 14 KRCI02S15 forward primer 2:

[0221] GAAGGTGACCAAGTTCATGCTCTTCTTACCTCTGTTGAGAC;

[0222] SEQ ID NO. 15 KRCI02S15 reverse primer: AGCATACCTCGTTCATGGCG;

[0223] SEQ ID NO. 16 KRCI03S05 forward primer 1:

[0224] GAAGGTCGGAGTCAACGGATTATGTACAAAGTCTGTAGTCG;

[0225] SEQ ID NO. 17 KRCI03S05 forward primer 2:

[0226] GAAGGTGACCAAGTTCATGCTATGTACAAAGTCTGTAGTCA;

[0227] SEQ ID NO. 18 KRCI03S05 reverse primer: ACAAATGGAGGTCTAGAGAAGGA;

[0228] SEQ ID NO. 19 KRCI05S07 forward primer 1:

[0229] GAAGGTCGGAGTCAACGGATTCACCATGGTTCTTGGTTAAC;

[0230] SEQ ID NO. 20 KRCI05S07 forward primer 2:

[0231] GAAGGTGACCAAGTTCATGCTCACCATGGTTCTTGGTTAAG;

[0232] SEQ ID NO.21KRCI05S07 Reverse primer: TCCACACAGGACATTATTCATG;

[0233] Forward primer 1 of SEQ ID NO.22KRCI05S09:

[0234] GAAGGTCGGAGTCAACGGATTATTACAAGCGTTTCCATCAG;

[0235] SEQ ID NO.23KRCI05S09 Forward Primer 2:

[0236] GAAGGTGACCAAGTTCATGCTATTACAAGCGTTTCCATCAA;

[0237] SEQ ID NO.24KRCI05S09 Reverse primer: AACCAGCTCACCGGAAAGAG;

[0238] SEQ ID NO.25KRCI06S04 Forward Primer 1:

[0239] GAAGGTCGGAGTCAACGGATTACAATCTGGCTTGATCTCCG;

[0240] SEQ ID NO.26KRCI06S04 Forward Primer 2:

[0241] GAAGGTGACCAAGTTCATGCTACAATCTGGCTTGATCTCCA;

[0242] SEQ ID NO.27KRCI06S04 Reverse primer: TCATGCACTACCTAGTTCACGT;

[0243] Forward primer 1 of SEQ ID NO.28KRCI06S05:

[0244] GAAGGTCGGAGTCAACGGATTTAATTGGTGTTGGACGGTTC;

[0245] SEQ ID NO.29KRCI06S05 Forward Primer 2:

[0246] GAAGGTGACCAAGTTCATGCTTAATTGGTGTTGGACCGGTTT;

[0247] SEQ ID NO. 30 KRCI06S05 reverse primer: CCAAGGACACACTAACGGTCT;

[0248] SEQ ID NO. 31 KRCI08S01 forward primer 1:

[0249] GAAGGTCGGAGTCAACGGATTATGAGCGACGCGAATTCGTA;

[0250] SEQ ID NO. 32 KRCI08S01 forward primer 2:

[0251] GAAGGTGACCAAGTTCATGCTATGAGCGACGCGAATTCGTG;

[0252] SEQ ID NO. 33 KRCI08S01 reverse primer: GCACAAGCCAACGTATCATA;

[0253] SEQ ID NO. 34 KRCI08S03 forward primer 1:

[0254] GAAGGTCGGAGTCAACGGATTAGTGTCACCTGTAGCTTCAG;

[0255] SEQ ID NO. 35 KRCI08S03 forward primer 2:

[0256] GAAGGTGACCAAGTTCATGCTAGTGTCACCTGTAGCTTCAA;

[0257] SEQ ID NO. 36 KRCI08S03 reverse primer: GGATCAATAACACGTCCGCC;

[0258] SEQ ID NO. 37 KRCI09S01 forward primer 1:

[0259] GAAGGTCGGAGTCAACGGATTGTACTTATGATCGAGACATA;

[0260] SEQ ID NO. 38 KRCI09S01 forward primer 2:

[0261] GAAGGTGACCAAGTTCATGCTGTACTTATGATCGAGACATG;

[0262] SEQ ID NO. 39 KRCI09S01 reverse primer: AGTACATGGTCCATGCATTG;

[0263] SEQ ID NO. 40 KRCI09S03 forward primer 1:

[0264] GAAGGTCGGAGTCAACGGATTGGTTGTAAAATAAGTGGAGTGT;

[0265] SEQ ID NO. 41 KRCI09S03 forward primer 2:

[0266] GAAGGTGACCAAGTTCATGCTGGTTGTAAAATAAGTGGAGTGC;

[0267] SEQ ID NO. 42 KRCI09S03 reverse primer: TGCCGTGCATGCATACAGAT;

[0268] SEQ ID NO. 43 KRCI10S05 forward primer 1:

[0269] GAAGGTCGGAGTCAACGGATTTGTTAGATACGGAAGCTACA;

[0270] SEQ ID NO. 44 KRCI10S05 forward primer 2:

[0271] GAAGGTGACCAAGTTCATGCTTGTTAGATACGGAAGCTACC;

[0272] SEQ ID NO. 45 KRCI10S05 reverse primer: CTTGGACCGGCAAACACATG;

[0273] SEQ ID NO. 46 KRCI11S03 forward primer 1:

[0274] GAAGGTCGGAGTCAACGGATTCGGTGTCAGAGATCAGAATG;

[0275] SEQ ID NO. 47 KRCI11S03 forward primer 2:

[0276] GAAGGTGACCAAGTTCATGCTCGGTGTCAGAGATCAGAATA;

[0277] SEQ ID NO. 48 KRCI11S03 reverse primer: TCTAGCTTCTCTCTCCTCCTCC.

[0278] Verification of the effect of 16 molecular markers on the authenticity identification of rice in Example 2

[0279] In order to verify the effect of the 16 molecular markers obtained in Example 1 on the authenticity identification of rice parents, it is necessary to test the actual detection and typing effect of the primer combination. DNA of 155 rice core backbone parents was used for experimental testing. By comparing the genotype of the reference sample with the actual detected genotype, it is determined whether the primer group achieves the expected detection effect. The specific operation steps of the detection method are as follows:

[0280] 1. Extraction of rice leaf genomic DNA:

[0281] Genomic DNA was extracted from rice leaf tissue according to the detection needs, and the DNA of young rice leaves was extracted using the standard procedure of Kangwei Plant Genomic Extraction Kit.

[0282] 2. DNA sample quality detection:

[0283] The protein and organic matter contamination level in the genomic DNA was measured by Nanodrop spectrophotometer. The A260 / 280 ratio of the genomic DNA should be between 1.8-2.0, and the A260 / 230 ratio should be between 1.8-2.2. The concentration of the DNA working solution was 10 ng / μl.

[0284] 3. Genotype detection:

[0285] Using the KASP marker primers of the 16 molecular markers obtained in Example 1, the reaction system and reaction procedure of KASP detection provided by LGC were used to produce the original genotype data of the detection sample, i.e. the genotype type of the sample at a specific site, such as homozygote hom1 (corresponding to genotype AA or TT or CC or GG), homozygote hom2 (corresponding to genotype TT or AA or GG or CC), standard heterozygote het (corresponding to genotype AG or TC or AT or AC or TG or CG), mixed (Un) or no amplification and hybridization signal (Un).

[0286] 4. Data analysis:

[0287] The analysis software of QuantStudio 12K Flex Real-Time PCR System instrument was used to analyze the data according to the custom-built typing interval, and the genotype of the sample was determined according to the following rules: Figures 21-36The shown way interprets and classifies the detection effect of molecular markers: (a) homozygote homl (corresponding to genotype AA or TT or CC or GG); (b) homozygote hom2 (corresponding to genotype TT or AA or GG or CC); (c) standard heterozygote het (corresponding to genotype AG or TC or AT or AC or TG or CG); (d) mixed (Un); (e) no amplification signal (Un).

[0288] 5. Result comparison - comparison of genotype detection identification results with actual genotypes:

[0289] The actual reference genotype is the genotype of the DNA of the sample obtained by illumina chip detection. The genotyping results obtained according to the above four steps are compared with the actual reference genotype, and the results are shown in Tables 4, 5 and Figures 5-20 and Figures 21-36 .

[0290] 6. Conclusion

[0291] Through the above five steps, the results show that for the genotypes of the detected materials, the coincidence degree of the detection results of the two methods is 97.14%, and the genotyping results can divide 155 materials into 155 groups, and the inconsistency appears in part of the KASP marker detection genotypes Het or Un. The results show that the 16 groups of primers screened in Example 1 can reliably genotype 155 rice materials, and provide reliable authenticity determination results. The same operation as described above can realize purity detection when detecting a plurality of single individuals.

[0292] Table 4 Genotype of 155 parents detected by 16 KASP markers (1)

[0293]

[0294]

[0295]

[0296]

[0297]

[0298] Table 5 Genotype of 155 parents detected by 16 KASP markers (2)

[0299]

[0300]

[0301]

[0302]

[0303]

[0304] Note: Hom1 refers to homozygous genotype 1, Hom2 refers to homozygous genotype 2, wherein,

[0305] For F0119312673GA, Hom1 is TT and Hom2 is CC;

[0306] For R0136269938AG, Hom1 is AA and Hom2 is GG;

[0307] For F0136380590GA, Hom1 is GG and Hom2 is AA;

[0308] For R0206491684CT, Hom1 is GG and Hom2 is AA;

[0309] For R0204051573TC, Hom1 is TT and Hom2 is CC;

[0310] For R0327455062GA, Hom1 is GG and Hom2 is AA;

[0311] For R0507762619GC, Hom1 is CC and Hom2 is GG;

[0312] For F0523332421GA, Hom1 is GG and Hom2 is AA;

[0313] For R0601649489CT, Hom1 is GG and Hom2 is AA;

[0314] For R0620792855TC, Hom1 is CC and Hom2 is TT;

[0315] For F0819572912CT, Hom1 is AA and Hom2 is GG;

[0316] For R0819367050GA, Hom1 is GG and Hom2 is AA;

[0317] For R0908001195CT, Hom1 is AA and Hom2 is GG;

[0318] For R0921310853CT, Hom1 is TT and Hom2 is CC;

[0319] For F1013749894GT, Hom1 is AA and Hom2 is CC;

[0320] For F1109053928AG, Hom1 is GG and Hom2 is AA.

[0321] Application of 16 molecular markers in the detection of authenticity of 89 F1 lines

[0322] In order to test the actual effect of the 16 molecular markers obtained in Example 1 in determining the authenticity of the F1 generation of rice, 89 F1 generation materials of rice were collected. They are the seeds harvested in 2020, after 100 grain mixed sampling, using Kangwei plant DNA extraction kit, qualified DNA samples were obtained, through the genotype detection of the aforementioned 16 molecular markers, the typing results were obtained, see Figures 37-52 and Table 6 and Table 7.

[0323] Table 6 Genotype information of 16 molecular markers for detection of 89 rice F1 (1)

[0324]

[0325]

[0326]

[0327]

[0328] Table 7 Genotype information of 16 molecular markers for detection of 89 rice F1 (2)

[0329]

[0330]

[0331]

[0332] Note: Hom1 refers to homozygous genotype 1, Hom2 refers to homozygous genotype 2, wherein,

[0333] For KRCI01S02, Hom1 is TT and Hom2 is CC;

[0334] For KRCI01S05, Hom1 is AA and Hom2 is GG;

[0335] For KRCI01S06, Hom1 is GG and Hom2 is AA;

[0336] For KRCI02S12, Hom1 is GG and Hom2 is AA;

[0337] For KRCI02S15, Hom1 is TT and Hom2 is CC;

[0338] For KRCI03S05, Hom1 is GG, and Hom2 is AA;

[0339] For KRCI05S07, Hom1 is CC, and Hom2 is GG;

[0340] For KRCI05S09, Hom1 is GG, and Hom2 is AA;

[0341] For KRCI06S04, Hom1 is GG, and Hom2 is AA;

[0342] For KRCI06S05, Hom1 is CC, and Hom2 is TT;

[0343] For KRCI08S01, Hom1 is AA, and Hom2 is GG;

[0344] For KRCI08S03, Hom1 is GG, and Hom2 is AA;

[0345] For KRCI09S01, Hom1 is AA, and Hom2 is GG;

[0346] For KRCI09S03, Hom1 is TT, and Hom2 is CC;

[0347] For KRCI10S05, Hom1 is AA, and Hom2 is CC; and

[0348] For KRCI11S03, Hom1 is GG, and Hom2 is AA.

[0349] The results show that 89 groups of F1 are divided into 87 groups by using 16 KASP marker genotypes, and 4 F1s are respectively classified into two groups of 2 F1s, and the total identifiable F1 ratio is 95.5%. Among them, 82 F1 combinations have no less than 6 polymorphic markers in 16 markers, the most polymorphic markers are 9, and the combinations with more than 9 polymorphic markers are 47, accounting for more than half.

[0350] The above results show that the 16 molecular markers provided by the application can help to monitor the authenticity of rice in the F1 generation grouping process, and the same operation can realize purity detection when detecting a plurality of single individuals. It has a positive contribution to guarantee the quality of F1 generation grouping of seeds.

[0351] While the application has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various modifications or changes can be made therein without departing from the spirit and scope thereof. Accordingly, it is intended that all such modifications and changes be included within the scope of the application as claimed.

Claims

1. A primer set for genotyping of rice, characterized by, The primer set consists of the following KASP marker primer pairs: primer pairs with sequences as shown in SEQ ID NO. 1-3, primer pairs with sequences as shown in SEQ ID NO. 4-6, primer pairs with sequences as shown in SEQ ID NO. 7-9, primer pairs with sequences as shown in SEQ ID NO. 10-12, primer pairs with sequences as shown in SEQ ID NO. 13-15, primer pairs with sequences as shown in SEQ ID NO. 16-18, primer pairs with sequences as shown in SEQ ID NO. 19-21, primer pairs with sequences as shown in SEQ ID NO. 22-24, primer pairs with sequences as shown in SEQ ID NO. 25-27, primer pairs with sequences as shown in SEQ ID NO. 28-30, primer pairs with sequences as shown in SEQ ID NO. 31-33, primer pairs with sequences as shown in SEQ ID NO. 34-36, primer pairs with sequences as shown in SEQ ID NO. 37-39, primer pairs with sequences as shown in SEQ ID NO. 40-42, primer pairs with sequences as shown in SEQ ID NO. 43-45, and primer pairs with sequences as shown in SEQ ID NO. 46-48.

2. A kit characterized in that, The kit comprises the primer set of claim 1.

3. Use of the primer set of claim 1 or the kit of claim 2 in rice genotyping.

4. Use of the primer set of claim 1 or the kit of claim 2 in identifying the authenticity of a rice parent, which comprises detecting the genotype of a rice parent to be tested using the primer set of claim 1, and comparing the obtained genotype of the rice parent to be tested with the corresponding genotype of a reference sample to determine the authenticity of the rice parent.

5. Use of the primer set of claim 1 or the kit of claim 2 in identifying the authenticity of a rice F1 line, which comprises detecting the genotype of a rice F1 line to be tested using the primer set of claim 1, and comparing the obtained genotype of the rice F1 line to be tested with the corresponding genotype of a reference sample to determine the authenticity of the rice F1 line.

6. Use of the primer set of claim 1 or the kit of claim 2 in rice purity identification.

7. A method of genotyping rice, comprising, The method comprises detecting the genotype of a rice to be tested using the primer set of claim 1 to obtain the genotyping result of the rice to be tested.

8. A method for identifying the authenticity of a rice parent, characterized by, The method comprises detecting the genotype of a rice parent to be tested using the primer set of claim 1, and comparing the obtained genotype of the rice parent to be tested with the corresponding genotype of a reference sample to determine the authenticity of the rice parent.

9. A method for identifying the authenticity of a rice F1 line, characterized by, The method comprises detecting the genotype of a rice F1 line to be tested using the primer set of claim 1, and comparing the obtained genotype of the rice F1 line to be tested with the corresponding genotype of a reference sample to determine the authenticity of the rice F1 line.

Citation Information

Patent Citations

  • SNP molecular marker combination for detecting rice Wx gene and application of SNP molecular marker combination

    CN113046349A

  • SNP (Single Nucleotide Polymorphism) molecular marker combination for identifying purity of rice line and application thereof

    CN114395639A