Electrochemical Nucleic Acid Sensors

Abstract

The present invention discloses an electrochemical nucleic acid sensor, including a sensing electrode and a nucleic acid molecule signal amplification system, wherein the sensing electrode includes an electrode substrate and an electrode interface, wherein the electrode substrate is used to electrically connect a data acquisition device, and the electrode interface is connected to the electrode substrate, and the electrode interface includes a probe layer, a fixed layer, and an electron transfer layer; the fixed layer is used to connect the probe layer and the electron transfer layer to the electrode substrate; the probe layer is used to specifically identify and capture the nucleic acid molecules to be tested in the sample to be tested, and the electron transfer layer is used to transmit the current signal generated in the biochemical reaction; the nucleic acid molecule signal amplification system is used to amplify the nucleic acid molecules to be tested captured by the probe layer and form sufficient nucleic acid double-stranded segments through nucleic acid hybridization, and is used to collect the electron transfer signal of the electroactive substance embedded in the nucleic acid double-stranded segment during the redox reaction. The electrochemical nucleic acid sensor of the present invention can realize the simple, rapid, sensitive, and specific direct detection of nucleic acid molecules of any length.

Description

Technical Field

[0001] The present application relates to the field of sensor technology, and in particular to an electrochemical nucleic acid sensor. Background Art

[0002] Nucleic acid, as a substance that carries biological genetic information, is often regarded as a representative of the corresponding biological identity and is used to assist in identifying and distinguishing the types and characteristics of organisms. Nucleic acid testing is a molecular diagnostic technology that directly detects biological genetic material. Currently, nucleic acid testing has been widely used in the early diagnosis of hepatitis B, AIDS, respiratory diseases and many other diseases.

[0003] Traditional nucleic acid detection technologies mainly include reverse transcription polymerase chain reaction (RT-PCR), reverse transcription loop-mediated isothermal amplification (RT-LAMP), reverse transcription recombinase polymerase amplification (RT-RPA), etc. The nucleic acid detection technology in traditional technology has high sensitivity and accuracy, but the detection time is usually about 3 hours, which greatly limits the efficiency of viral nucleic acid screening. In addition, since traditional nucleic acid detection technology relies on the amplification of nucleic acid molecules and requires special instruments and skilled technicians to operate, it can only be used for centralized testing in fixed places such as hospitals and laboratories where corresponding instruments are installed. It is difficult to be universally applicable to application scenarios such as resource-scarce areas or large-scale rapid testing, and there is an inevitable risk of virus leakage. Summary of the invention

[0004] Based on this, it is necessary to provide an electrochemical nucleic acid sensor to address the problems of long detection time, strong background signal and low detection sensitivity in the electrochemical detection method in the traditional technology. The electrochemical nucleic acid sensor of the present invention has the advantages of high detection sensitivity, low detection limit, short response time, high universality and low cost.

[0005] An embodiment of the present application provides an electrochemical nucleic acid sensor.

[0006] An electrochemical nucleic acid sensor, comprising:

[0007] A sensing electrode, wherein the sensing electrode comprises an electrode substrate and an electrode interface, wherein the electrode substrate is used to electrically connect to a data acquisition device, wherein the electrode interface is connected to the electrode substrate, wherein the electrode interface comprises a probe layer, a fixed layer and an electron transfer layer; wherein the fixed layer is used to connect the probe layer and the electron transfer layer to the electrode substrate; wherein the probe layer is used to specifically identify and capture nucleic acid molecules to be tested in a sample to be tested, and wherein the electron transfer layer is used to transmit current signals generated in a biochemical reaction; and

[0008] A nucleic acid molecule signal amplification system, which is used to amplify the nucleic acid molecules to be detected captured by the probe layer and form sufficient nucleic acid double-stranded segments through nucleic acid hybridization, and to collect electron transfer signals of electroactive substances embedded in the nucleic acid double-stranded segments during redox reactions.

[0009] In some of the embodiments, the electrode substrate is selected from a hard sensor substrate or a flexible sensor substrate, wherein the preparation material of the hard sensor substrate includes one or more of silicon wafer, glass, cycloolefin polymer, polystyrene, polycarbonate, polytetrafluoroethylene and polymethyl methacrylate, and the preparation material of the flexible sensor substrate includes one or more of polydimethylsiloxane, polyamide, polyurethane and polyethylene terephthalate.

[0010] In some of the embodiments, the probe layer contains a single-stranded nucleic acid probe with a group modification at the 5' end and / or the 3' end, and the probe layer recognizes and captures the nucleic acid molecule to be tested through the base complementary pairing between the single-stranded nucleic acid probe and the nucleic acid molecule to be tested in the sample to be tested, and the group in the group modification includes one or more of a thiol, an amino group and a carboxyl group.

[0011] In some embodiments, the fixing layer contains nanoparticles and / or chemical molecules, and the fixing layer connects the probe layer and the electron transfer layer to the electrode substrate through covalent bonding.

[0012] In some of the embodiments, the nanoparticles are selected from one or more of metal nanoparticles modified with amino, carboxyl or thiol chemical groups, carbon nanotubes and conductive polymers, and the chemical molecules are selected from one or more of 1-pyrenebutyric acid N-hydroxysuccinimide ester, 1-pyrenebutyric acid, (1-ethyl-(3-dimethylaminopropyl)carbodiimide, and N-hydroxysuccinimide.

[0013] In some embodiments, the electron transfer layer is made of a conductive material, wherein the conductive material is selected from a metal material, a conductive non-metal material, and a two-dimensional conductive nanomaterial.

[0014] In some embodiments, the conductive metal material includes one or more of gold, platinum, nickel and titanium;

[0015] And / or, the conductive non-metallic material includes one or more of carbon paste, carbon fiber and polyethylene dioxythiophene;

[0016] And / or, the two-dimensional conductive nanomaterial includes one or more of graphene, carbon nanotubes and metal nanoparticles.

[0017] In some of the embodiments, the electron transfer layer has a three-dimensional porous structure, and / or a planar network structure, and / or a three-dimensional skeleton structure.

[0018] In some embodiments, the nucleic acid molecule signal amplification system includes a molecular signal amplification system and a signal detection system;

[0019] The molecular signal amplification system includes three regions: a tag sequence, a pre-amplification sequence, and an amplification sequence. The tag sequence is used to identify and bind to the nucleic acid molecule to be detected; the pre-amplification sequence is used to bind and extend the tag sequence to provide a longer nucleic acid single strand for the hybridization of the amplification sequence; the amplification sequence is used for nucleic acid hybridization to form a sufficient nucleic acid double-stranded segment;

[0020] The signal detection system is composed of electroactive molecules, which include one or more of dye-type electroactive molecules, metal organic complex-type electroactive molecules, catalase-type electroactive molecules and organic small molecule-type electroactive molecules. The signal detection system is used to collect the electron transfer signal of the electroactive substance embedded in the double-stranded segment of the nucleic acid during the redox reaction process after being amplified by the molecular signal amplification system.

[0021] In some of the embodiments, the amplification sequence includes a multi-stage amplification sequence, and the amplification sequence levels of the multi-stage amplification sequence are 1-10 levels.

[0022] In some of the embodiments, the concentration ratio of the tag sequence, the pre-amplification sequence, and the amplification sequence is 1:(1-25):(1-100).

[0023] In some embodiments, the dye-based electroactive molecules include one or more of methylene blue, crystal violet, Nile blue and ethyl green;

[0024] And / or, the metal organic complex electroactive molecules include one or more of hexammineruthenium chloride, ferrocene and copper accumulator organic ligands;

[0025] And / or, the catalase-like electroactive molecules include one or more of aniline and thionine, etc. as examples;

[0026] And / or, the organic small molecule electroactive molecules include one or more of anthraquinone-2-sulfonic acid sodium salt, anthraquinone and cyclodextrin.

[0027] In some of the embodiments, when collecting the electron transfer signal of the electroactive substance embedded in the double-stranded segment of the nucleic acid during the redox reaction, the collection method includes one or more of differential pulse voltammetry, square wave voltammetry, cyclic voltammetry, electrochemical impedance spectroscopy, linear sweep voltammetry, alternating current voltammetry and anodic stripping voltammetry.

[0028] The electrochemical nucleic acid sensor can realize the simple, rapid, sensitive and specific direct detection of nucleic acid molecules of any length. Compared with the nucleic acid detection method in the traditional technology, the electrochemical nucleic acid sensor of the present invention has higher sensitivity, lower detection limit, shorter detection time, lower detection cost and wider application range, which meets the integration requirements of nucleic acid sensor devices. At the same time, the present invention can realize one-step operation, avoid the transfer of samples to be tested, and minimize the risk of pathogen leakage. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0030] In order to more completely understand the present application and its beneficial effects, the following description will be given in conjunction with the accompanying drawings. In the following description, the same reference numerals represent the same parts.

[0031] Figure 1 This is a schematic diagram of the preparation process of the electrochemical nucleic acid sensor according to one embodiment of the present invention;

[0032] Figure 2 A physical diagram of the microscopic topological structure of the electrode interface of the electrochemical nucleic acid sensor according to one embodiment of the present invention;

[0033] Figure 3 This is a graph showing the electrode interface reaction kinetics test results of the electrochemical nucleic acid sensor according to one embodiment of the present invention; Figure 3 In the figure, the horizontal axis is the square root of the scanning rate ([mV / s] 1 / 2 ), the ordinate is current (A);

[0034] Figure 4 This is a schematic diagram of a molecular signal amplification system of an electrochemical nucleic acid sensor according to an embodiment of the present invention;

[0035] Figure 5 This is a sensitivity test result diagram of the electrochemical nucleic acid sensor according to one embodiment of the present invention; Figure 5 In the figure, the abscissa is the concentration and the ordinate is the current (A);

[0036] Figure 6 This is a diagram showing the selectivity test results of the electrochemical nucleic acid sensor according to one embodiment of the present invention; Figure 6 In the figure, the horizontal axis is the sample and the vertical axis is the current (A).

[0037] Description of Reference Numerals

[0038] 10. Nucleic acid molecule to be tested; 20. Tag sequence; 30. Pre-amplification sequence; 31. Primary amplification sequence; 32. Secondary amplification sequence. DETAILED DESCRIPTION

[0039] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below.

[0040] In the description of the present invention, it should be understood that the terms "center", "longitudinal", "lateral", "length", "width", "thickness", "up", "down", "front", "back", "left", "right", "vertical", "horizontal", "top", "bottom", "inside", "outside", "clockwise", "counterclockwise", "axial", "radial", "circumferential" and the like indicate orientations or positional relationships based on the orientations or positional relationships shown in the accompanying drawings, and are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the referred device or element must have a specific orientation, be constructed and operated in a specific orientation, and therefore should not be understood as limiting the present invention.

[0041] In the present invention, unless otherwise clearly specified and limited, the terms "installed", "connected", "connected", "fixed" and the like should be understood in a broad sense, for example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection or an indirect connection through an intermediate medium, it can be the internal connection of two elements or the interaction relationship between two elements, unless otherwise clearly defined. For ordinary technicians in this field, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0042] In the present invention, unless otherwise clearly specified and limited, a first feature being "above" or "below" a second feature may mean that the first and second features are in direct contact, or the first and second features are in indirect contact through an intermediate medium. Moreover, a first feature being "above", "above" or "above" a second feature may mean that the first feature is directly above or obliquely above the second feature, or simply means that the first feature is higher in level than the second feature. A first feature being "below", "below" or "below" a second feature may mean that the first feature is directly below or obliquely below the second feature, or simply means that the first feature is lower in level than the second feature.

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0044] The present application provides an electrochemical nucleic acid sensor to solve the problems of long detection time, strong background signal and low detection sensitivity in the electrochemical detection method in the conventional technology. The electrochemical nucleic acid sensor will be described below in conjunction with the accompanying drawings.

[0045] The electrochemical nucleic acid sensor provided in the embodiments of the present application is exemplary, see Figure 1 As shown, Figure 1 Schematic diagram of the preparation of the electrochemical nucleic acid sensor provided in the embodiment of the present application. The electrochemical nucleic acid sensor of the present application can be used for nucleic acid detection, significantly improving the sensitivity and selectivity of nucleic acid detection, and is suitable for integration into automated microfluidic chips and miniaturized point-of-care (POCT) devices to construct a portable non-amplified nucleic acid detection device with universal application scenarios, realize portable rapid nucleic acid detection, and be applied to infectious disease diagnosis, large-scale virus screening, telemedicine and other scenarios.

[0046] In order to more clearly illustrate the structure of the electrochemical nucleic acid sensor, the electrochemical nucleic acid sensor will be introduced below with reference to the accompanying drawings.

[0047] Exemplarily, an electrochemical nucleic acid sensor includes a sensing electrode and a nucleic acid molecule signal amplification system. The sensing electrode includes an electrode substrate and an electrode interface. The electrode substrate is used to electrically connect a data acquisition device. The electrode interface is connected to the electrode substrate, and the electrode interface includes a probe layer, a fixed layer, and an electron transfer layer. The fixed layer is used to connect the probe layer and the electron transfer layer to the electrode substrate. The probe layer is used to specifically identify and capture the nucleic acid molecule to be tested in the sample to be tested, and the electron transfer layer is used to transmit the current signal generated in the biochemical reaction.

[0048] The nucleic acid molecule signal amplification system is used to amplify the nucleic acid molecules to be detected captured by the probe layer and form sufficient nucleic acid double-stranded segments through nucleic acid hybridization, and the nucleic acid molecule signal amplification system is also used to collect the electron transfer signal of the electroactive substance embedded in the nucleic acid double-stranded segment during the redox reaction.

[0049] In some embodiments, the electrode substrate is selected from a hard sensor substrate or a flexible sensor substrate. The hard sensor substrate is made of one or more materials selected from silicon wafer, glass, cycloolefin polymer (COC), polystyrene (PS), polycarbonate (PC), polytetrafluoroethylene (PTFE) and polymethyl methacrylate (PMMA), and the flexible sensor substrate is made of one or more materials selected from polydimethylsiloxane (PDMS), polyamide (PI), polyurethane (PU) and polyethylene terephthalate (PET).

[0050] In some embodiments, the probe layer contains a single-stranded nucleic acid probe with a group modification at the 5' end and / or the 3' end, and the probe layer recognizes and captures the nucleic acid molecule to be tested through the base complementary pairing between the single-stranded nucleic acid probe and the nucleic acid molecule to be tested in the sample to be tested, and the group in the group modification includes one or more of a thiol group (-SH), an amino group (-NH2) and a carboxyl group (-COOH).

[0051] The modification of the probe layer can be formed by deposition of a probe layer modification liquid. The probe layer modification liquid is mainly a 1-100 μM single-stranded nucleic acid probe modified with a special group. Preferably, a 5 μM thiol-modified single-stranded nucleic acid probe solution reduced with tris(2-carboxyethyl)phosphine (TCEP) is used as the probe layer modification liquid.

[0052] In some embodiments, the fixing layer contains nanoparticles and / or chemical molecules, and the fixing layer connects the probe layer and the electron transfer layer to the electrode substrate through covalent bonding.

[0053] In some embodiments, the nanoparticles are selected from one or more of metal nanoparticles modified with amino, carboxyl or thiol chemical groups, carbon nanotubes and conductive polymers. The chemical molecules are selected from one or more of 1-pyrenebutyric acid N-hydroxysuccinimide ester (PBASE), 1-pyrenebutyric acid (PBA), (1-ethyl-(3-dimethylaminopropyl) carbodiimide, and N-hydroxysuccinimide.

[0054] The group modification on the fixed layer surface can be formed by deposition of a fixed layer modification solution. The fixed layer modification solution can be prepared according to specific use needs, such as 0.1%-5% of metal nanoparticles, carbon nanotubes and conductive polymers by mass fraction in ultrapure water or high salt solution, or 1-10mM of chloroauric acid, chloroplatinic acid and other metal acidic compounds. Preferably, a 5mM chloroauric acid solution is prepared as the fixed layer modification solution using a mixed solution of 0.01M H2SO4 and 0.01M Na2SO4 as solvent.

[0055] In some embodiments, the electron transfer layer is made of a conductive material, wherein the conductive material is selected from a metal material, a conductive non-metal material, and a two-dimensional conductive nanomaterial.

[0056] In some embodiments, the conductive metal material includes one or more of gold, platinum, nickel and titanium.

[0057] In some embodiments, the conductive non-metallic material includes one or more of carbon paste, carbon fiber and polyethylene dioxythiophene.

[0058] In some embodiments, the two-dimensional conductive nanomaterial includes one or more of graphene, carbon nanotubes and metal nanoparticles.

[0059] In some of the embodiments, the electron transfer layer is formed into a three-dimensional porous structure such as foamed platinum, foamed gold, foamed nickel, foamed titanium, etc., and / or a planar mesh structure such as carbon fiber cloth, carbon fiber paper, carbon fiber yarn, etc., and / or a three-dimensional skeleton structure formed by modifying a non-conductive protein skeleton, polymer skeleton and porous ceramics with a two-dimensional conductive nanomaterial.

[0060] For example, in a specific embodiment, the electron transfer layer is a conductive carbon fiber paper with uniform pores formed by weaving 70 μm carbon fibers, such as Figure 2 As shown, gold nanoparticles are fixed on the surface of conductive carbon fiber paper by timed current electrodeposition to form a fixed layer. After activation, the fixed layer can be used to fix and modify the probe layer. The electron transfer layer, the fixed layer, and the probe layer together form the electrode interface of the electrochemical nucleic acid sensor. The nucleic acid probe with the nucleic acid capture sequence to be tested can recognize and hybridize the nucleic acid chain to be tested combined with the molecular signal amplification system, effectively capture the electroactive molecules embedded in the double-stranded segment, and carry out a rapid redox reaction with the help of cyclic voltage. At the same time, the electron transfer is completed efficiently, ensuring the specificity and sensitivity of the sensor detection.

[0061] The electron transfer layer in the present invention adopts a conductive material with good biocompatibility as a base material. By giving the conductive material a three-dimensional structure with a large specific surface area, on the one hand, the electron transfer ability of the electron transfer layer is significantly improved, and on the other hand, the fixation density of the probe layer on the electrode surface is greatly improved, providing more attachment sites for the nucleic acid capture probe, while achieving improved detection sensitivity and selectivity.

[0062] In some embodiments, the nucleic acid molecule signal amplification system includes a molecular signal amplification system and a signal detection system;

[0063] The molecular signal amplification system includes three regions: a tag sequence, a pre-amplification sequence, and an amplification sequence. The tag sequence is used to identify and bind to the nucleic acid molecule to be detected; the pre-amplification sequence is used to bind and extend the tag sequence to provide a longer nucleic acid single strand for the hybridization of the amplification sequence; the amplification sequence is used for nucleic acid hybridization to form a sufficient nucleic acid double-stranded segment;

[0064] The signal detection system is composed of electroactive molecules, which include one or more of dye-type electroactive molecules, metal organic complex-type electroactive molecules, catalase-type electroactive molecules and organic small molecule-type electroactive molecules. The signal detection system is used to collect the electron transfer signal of the electroactive substance embedded in the double-stranded segment of the nucleic acid during the redox reaction process after being amplified by the molecular signal amplification system.

[0065] In some of the embodiments, the amplification sequence includes a primary amplification sequence, a secondary amplification sequence, a tertiary amplification sequence and other multi-stage amplification sequences, and the amplification sequence levels of the multi-stage amplification sequence are 1-10 levels.

[0066] In some of the embodiments, the length and number of nucleic acid chains in the tag sequence, the pre-amplification sequence, and the amplification sequence determine their respective concentration ratios, and the concentration ratio of the tag sequence, the pre-amplification sequence, and the amplification sequence is 1:(1-25):(1-100).

[0067] In some embodiments, the dye-based electroactive molecules include one or more of methylene blue (MB), crystal violet (CV), Nile blue (NB) and ethyl green (EG).

[0068] In some embodiments, the metal organic complex electroactive molecules include one or more of hexammineruthenium chloride, ferrocene and copper accumulator organic ligands.

[0069] In some embodiments, the catalase-like electroactive molecules include one or more of aniline (An) and thionine (TH), for example.

[0070] In some embodiments, the organic small molecule electroactive molecule includes one or more of anthraquinone-2-sulfonic acid sodium salt (AQMS), anthraquinone (AQ) and cyclodextrin (CD).

[0071] In some of the embodiments, when collecting the electron transfer signal of the electroactive substance embedded in the double-stranded segment of the nucleic acid during the redox reaction, the collection method includes one or more of differential pulse voltammetry (DPV), square wave voltammetry (SWV), cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), linear sweep voltammetry (LSV), alternating current voltammetry (ACV) and anodic stripping voltammetry (ASV).

[0072] The electrochemical nucleic acid sensor of the present invention uses a specific DNA single strand modified with a special group as a probe layer, and modifies the probe layer on the surface of the electron transfer layer by covalent bonding with the aid of a fixed layer, thereby ensuring the stability and specificity of nucleic acid detection. In addition, the present invention includes a specially designed nucleic acid molecule signal amplification system, which provides the system with sufficient nucleic acid double-stranded segments, and then the electroactive substance that can be embedded in the nucleic acid double-stranded segments will be fixed in the molecular signal amplification system, and will be fixed on the sensor surface as the nucleic acid chain to be detected is captured by the sensor probe layer, and finally, by collecting the electron transfer signal during the redox reaction of the electroactive substance, the concentration of the nucleic acid to be detected is converted, thereby realizing rapid, sensitive and accurate non-amplified nucleic acid detection.

[0073] Example 1

[0074] This embodiment provides an electrochemical nucleic acid sensor.

[0075] An electrochemical nucleic acid sensor comprises a sensing electrode and a nucleic acid molecule signal amplification system.

[0076] The sensing electrode comprises an electrode substrate and an electrode interface. The electrode substrate is used to electrically connect to a data collector. The electrode substrate is selected from a flexible sensor substrate, wherein the flexible sensor substrate is made of synthetic fiber paper.

[0077] The electrode interface can function alone or connected to the electrode substrate. The electrode interface includes a probe layer, a fixed layer and an electron transfer layer. The probe layer contains a single-stranded nucleic acid probe with a thiol (-SH) group modification at the 5' end and / or the 3' end. The modification of the probe layer is formed by deposition of a probe layer modification solution, wherein a 5μM thiol (-SH) modified single-stranded nucleic acid probe solution reduced by tris (2-carboxyethyl) phosphine (TCEP) is used as the probe layer modification solution. The probe layer is used to specifically identify and capture the nucleic acid molecules to be tested in the sample to be tested. The electron transfer layer is used to transmit the current signal generated in the biochemical reaction. The fixed layer is used to connect the probe layer and the electron transfer layer to the electrode substrate. The fixed layer contains nanoparticles, and the nanoparticles are selected from thiol-modified metal nanoparticles (specifically gold nanoparticles). The group modification on the surface of the fixed layer is formed by deposition of a fixed layer modification solution. The fixed layer modification solution is a metal nanoparticle prepared in ultrapure water or a high salt solution with a mass fraction of 0.1%-5%. The fixed layer connects the probe layer and the electron transfer layer to the electrode substrate through covalent bonding. When preparing the probe layer and the fixed layer, the following steps are included: the fixed layer modification liquid is dripped on the electrode substrate to modify the fixed layer by chronoamperometry deposition, the deposition voltage is -0.6-0.6V, and the deposition time is 50-5000s; after the deposition is completed, the fixed layer is activated, and then the probe layer is fixed by dripping the probe layer modification liquid on the surface of the electrode substrate, and the probe fixation time is 30-300min.

[0078] The electron transfer layer is made of a conductive material, for example, the electron transfer layer is a conductive carbon fiber paper with uniform pores formed by weaving 70μm carbon fibers. When the electron transfer layer is conductive carbon fiber paper, the preparation method of the electrode interface includes the following steps: gold nanoparticles are fixed on the surface of the conductive carbon fiber paper by a timed current electrodeposition method to form a fixed layer, and the fixed layer is activated after the deposition is completed. After activation, it can be used to fix and modify the probe layer, and the electron transfer layer, the fixed layer, and the probe layer together form the electrode interface of the electrochemical nucleic acid sensor.

[0079] The nucleic acid molecule signal amplification system includes a molecular signal amplification system and a signal detection system. The molecular signal amplification system includes three regions: a tag sequence, a pre-amplification sequence, and an amplification sequence; the pre-amplification sequence is used to combine and expand the tag sequence to provide a longer nucleic acid single chain for the hybridization of the amplification sequence; the amplification sequence includes a primary amplification sequence and a secondary amplification sequence. The length and number of nucleic acid chains in the tag sequence, pre-amplification sequence, primary amplification sequence, and secondary amplification sequence determine their respective concentration ratios.

[0080] The signal detection system is composed of electroactive molecules, and the electroactive molecules include dye electroactive molecules. The dye electroactive molecules include methylene blue (MB). During preparation, ultrapure water is used to prepare a 1-10mM methylene blue (MB) electroactive molecule solution, and the methylene blue (MB) electroactive molecule solution is dripped on the electrode interface surface and incubated for 5-20 minutes. After cleaning, electrochemical detection is performed on the redox characteristic peak section of the selected electroactive molecule.

[0081] Example 2

[0082] This embodiment provides a method for preparing an electrochemical nucleic acid sensor.

[0083] The preparation method of the electrochemical nucleic acid sensor is as follows: Figure 1 As shown, the following steps are included:

[0084] Step 1: Prepare the fixed layer modification solution and the probe layer modification solution.

[0085] A 5 mM chloroauric acid solution was prepared using a mixed solution of 0.01 M H2SO4 and 0.01 M Na2SO4 as solvent as the fixed layer modification solution; a 5 μM thiol-modified single-stranded nucleic acid probe solution reduced with tris(2-carboxyethyl)phosphine (TCEP) was used as the probe layer modification solution.

[0086] Step 2: Prepare sensing electrodes.

[0087] A carbon fiber working electrode, a standard counter electrode, and a reference electrode with a size of 18 mm in length and 15 mm in width were immersed in the fixed layer modification solution to form a three-electrode system. A steady-state voltage of -0.6 V was applied to the three-electrode system for electrodeposition for 300-500 seconds to form a uniform layer of gold nanoparticles on the surface of the carbon fiber working electrode, i.e., the fixed layer. Subsequently, 5 mM H2SO4 was used to activate the gold nanoparticles on the fixed layer to complete the modification of the fixed layer. 20 μL of the probe layer modification solution was added to the surface of the carbon fiber working electrode and incubated for 1 hour to form a probe layer, completing the preparation of the sensing electrode. After the preparation of the sensing electrode was completed, the reaction kinetic characteristics of the electrode interface at different cyclic voltammetry scan rates were tested in a potassium ferrocyanide solution. The test results are shown in FIG. Figure 3 As shown, Figure 3 In the figure, the horizontal axis is the square root of the scanning rate ([mV / s] 1 / 2 ), the ordinate is current (A).

[0088] Step 3: Nucleic acid molecule signal amplification system.

[0089] The nucleic acid molecule signal amplification system includes a molecular signal amplification system and a signal detection system. The molecular signal amplification system includes three regions: a label sequence, a pre-amplification sequence and an amplification sequence.

[0090] (1) Preparation of molecular signal amplification system: Designing the nucleic acid sequence of the molecular signal amplification system, performing two-stage amplification in the amplification sequence, including a primary amplification sequence and a secondary amplification sequence. The schematic diagram of the molecular signal amplification system is shown in FIG. Figure 4 Taking the artificially synthesized short single-stranded nucleic acid as the target nucleic acid sequence to be detected as an example, according to the ratio of 1:1:5:25 of the number of nucleic acid hybridization segments in the label sequence, pre-amplification sequence, primary amplification sequence and secondary amplification sequence, the following molecular signal amplification system nucleic acid sequence is designed:

[0091] Target nucleic acid sequence to be tested: 5′-TGGTTACTGCCAGTTAACTGGCAGTAACCA-3′;

[0092] The probe sequence of the molecular signal amplification system is as follows:

[0093] Tag sequence: 5′-TTGGATGATTGGCTT-3′;

[0094] Pre-amplification sequence:

[0095] 5'-ACCGAACACCCGAACAAAACCGAACACCCGAACAAAACCGAACA CCCGAACAAAACCGAACACCCGAACAAAACCGAACACCCGAACAAAAAG CCAATCATCCAA-3'

[0096] Primary Amplification Sequence:

[0097] 5'-TGTTCGGGTGTTCGGTAAAGTCATGCTGTCACTCAAAGTCATGCTG TCACTCAAAGTCATGCTGTCACTCAAAGTCATGCTGTCACTCAAAGTCATG CTGTCACTC-3';

[0098] Secondary Amplification Sequence:

[0099] 5'-GAGTGACAGCATGACCGACGGGCAAGGCTACTGACACGAA-3'.

[0100] (2) Preparation of signal detection system: Use ultrapure water to prepare a 5 mM methylene blue electroactive dye molecule solution, add 20 μL of the electroactive molecule solution to the surface of the above-mentioned sensor electrode, incubate for 10 min, wash with ultrapure water, and then use linear sweep voltammetry to cyclically scan the -0.6-0.2 V voltage segment.

[0101] Compared with the existing non-amplified nucleic acid detection method, the electrochemical nucleic acid sensor prepared in this embodiment significantly improves the detection sensitivity and reduces the detection limit. The present invention shows a logarithmic linearity in the range of 0.1fM-1nM, and the minimum detection limit is 30aM. Figure 5 As shown, Figure 5 In the figure, the horizontal axis is concentration and the vertical axis is current (A); compared with the detection limit of 20fM-0.4μM and the minimum detection limit above 136aM in traditional technology, both are optimized by several orders of magnitude.

[0102] The electrochemical nucleic acid sensor prepared in this embodiment has excellent sequence selectivity. The target nucleic acid sequence to be detected is divided into a probe binding region and a molecular signal amplification system binding region. Four groups of specific nucleic acid molecules, including a probe binding region missing sequence (probe miss), a molecular signal amplification system binding region missing sequence (pre miss), a reverse sequence of the target nucleic acid sequence (reverse), and a full sequence random sequence (random), are designed with reference to the target nucleic acid sequence to be detected. The specific nucleic acid molecule sequences are as follows:

[0103] Probe miss:

[0104] 5'-AAAAACGTGGTTGACCTACAAAAAAATTGACGCATACAAA-3';

[0105] Molecular signal amplification system binding region missing sequence (pre miss):

[0106] 5'-TCTTCTCGTCCTCATCTTCTCGTTCCTCATCTTCTCGTT-3';

[0107] Reverse sequence of target nucleic acid sequence:

[0108] 5'-AAACATACGCAGTTAAAAAAACATCCAGTTGGTGCAAAAAACTCC TTGCTCTTCT-3';

[0109] Full sequence random sequence (random):

[0110] 5'-CTATACGAAATGCGATGCGATCGATCCCTAGCCTAGTTAG-3'.

[0111] The electrochemical nucleic acid sensor prepared in this example was used to detect 1 pM of the target nucleic acid molecule to be detected and 1 pM of the specific nucleic acid molecule. The test results are as follows: Figure 6 As shown, Figure 6In the figure, the horizontal axis is the sample and the vertical axis is the current (A). The results show that the electrochemical nucleic acid sensor prepared in this embodiment has almost no detection ability for nucleic acid molecules that cannot be captured by the probe layer (including probe miss group-specific nucleic acid molecules, random group-specific nucleic acid molecules and reverse group-specific nucleic acid molecules), and has a low current response signal for nucleic acid molecules that cannot bind to the molecular signal amplification system (pre miss group-specific nucleic acid molecules). The ratio of this signal to the signal of the target nucleic acid molecule to be detected is positively correlated with the cascade amplification factor of the molecular signal amplification system.

[0112] The electrochemical nucleic acid sensor of this embodiment is based on an electrochemical three-electrode system, and uses a molecular signal amplification system to identify and hybridize specific nucleic acid sequences, providing sufficient nucleic acid double-stranded segments for the embedding of electroactive substances, significantly increasing the concentration of electroactive signal molecules on the electrode surface. Redox-active electrical signal molecules undergo electron transfer under the action of cyclic voltage, and the electron transfer signal is amplified and output by the nucleic acid molecule signal amplification system, and finally the concentration of specific nucleic acid molecules in the sample to be tested is measured based on the electrical signal. The electrochemical nucleic acid sensor of this embodiment can quickly, sensitively and accurately detect nucleic acid molecules of any length.

[0113] In summary, the electrochemical nucleic acid sensor can achieve simple, rapid, sensitive and specific direct detection of nucleic acid molecules of any length. Compared with sensors in traditional technologies, the electrochemical nucleic acid sensor of the present invention is compact and portable, free from the dependence on large instruments and professional operators, and has the advantages of higher sensitivity, lower detection limit, shorter detection time, lower detection cost and wider application range, which meets the integration requirements of nucleic acid sensor devices. At the same time, the present invention does not require complicated sample pre-treatment process, can realize one-step operation, avoid the transfer of samples to be tested, and minimize the risk of pathogen leakage.

[0114] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0115] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0116] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. An electrochemical nucleic acid sensor, characterized in that: include: A sensing electrode, wherein the sensing electrode comprises an electrode substrate and an electrode interface, wherein the electrode substrate is used to electrically connect to a data acquisition device, and the electrode interface is connected to the electrode substrate, and the electrode interface comprises a probe layer, a fixed layer, and an electron transfer layer; The fixing layer is used to connect the probe layer and the electron transfer layer to the electrode substrate; The probe layer is used to specifically identify and capture the nucleic acid molecules to be tested in the sample to be tested, the electron transfer layer is a three-dimensional porous structure, and / or a planar mesh structure, and / or a three-dimensional skeleton structure, and the electron transfer layer is used to transfer the current signal generated in the biochemical reaction; as well as A nucleic acid molecule signal amplification system, the nucleic acid molecule signal amplification system is used to amplify the nucleic acid molecules to be detected captured by the probe layer and form sufficient nucleic acid double-stranded segments through nucleic acid hybridization, and is used to collect electron transfer signals of electroactive substances embedded in the nucleic acid double-stranded segments during redox reactions. The nucleic acid molecule signal amplification system includes a molecular signal amplification system and a signal detection system; the molecular signal amplification system includes three regions: a label sequence, a pre-amplification sequence, and an amplification sequence. The label sequence is used to identify and bind to the nucleic acid molecules to be detected; the pre-amplification sequence is used to bind and expand the label sequence to provide a longer nucleic acid single strand for hybridization of the amplification sequence; the amplification sequence is used for nucleic acid hybridization to form sufficient nucleic acid double-stranded segments; the signal detection system is composed of electroactive molecules, the electroactive molecules include one or more of dye-type electroactive molecules, metal organic complex-type electroactive molecules, catalase-type electroactive molecules, and organic small molecule-type electroactive molecules, and the signal detection system is used to provide electron transfer signals of electroactive substances embedded in the nucleic acid double-stranded segments during redox reactions after being amplified by the molecular signal amplification system.

2. The electrochemical nucleic acid sensor according to claim 1, characterized in that The electrode substrate is selected from a hard sensor substrate or a flexible sensor substrate, wherein the preparation material of the hard sensor substrate includes one or more of silicon wafer, glass, cycloolefin polymer, polystyrene, polycarbonate, polytetrafluoroethylene and polymethyl methacrylate, and the preparation material of the flexible sensor substrate includes one or more of polydimethylsiloxane, polyamide, polyurethane and polyethylene terephthalate.

3. The electrochemical nucleic acid sensor according to claim 1, characterized in that: The probe layer contains a single-stranded nucleic acid probe with a group modification at the 5' end and / or the 3' end. The probe layer recognizes and captures the nucleic acid molecule to be tested through the base complementary pairing between the single-stranded nucleic acid probe and the nucleic acid molecule to be tested in the sample to be tested. The group in the group modification includes one or more of thiol, amino and carboxyl groups.

4. The electrochemical nucleic acid sensor according to claim 1, characterized in that: The fixed layer contains nanoparticles and / or chemical molecules, and the fixed layer connects the probe layer and the electron transfer layer to the electrode substrate through covalent bonding.

5. The electrochemical nucleic acid sensor according to claim 4, characterized in that: The nanoparticles are selected from one or more of metal nanoparticles modified with amino, carboxyl or thiol chemical groups, carbon nanotubes and conductive polymers, and the chemical molecules are selected from one or more of 1-pyrenebutyric acid N-hydroxysuccinimide ester, 1-pyrenebutyric acid, 1-ethyl-(3-dimethylaminopropyl)carbodiimide, and N-hydroxysuccinimide.

6. The electrochemical nucleic acid sensor according to any one of claims 1 to 5, characterized in that: The electron transfer layer is made of a conductive material, wherein the conductive material is selected from a metal material, a conductive non-metal material, and a two-dimensional conductive nanomaterial.

7. The electrochemical nucleic acid sensor according to claim 6, characterized in that: The conductive metal material includes one or more of gold, platinum, nickel and titanium; And / or, the conductive non-metallic material includes one or more of carbon paste, carbon fiber and polyethylene dioxythiophene; And / or, the two-dimensional conductive nanomaterial includes one or more of graphene, carbon nanotubes and metal nanoparticles.

8. The electrochemical nucleic acid sensor according to claim 1, characterized in that: The amplification sequence includes a multi-stage amplification sequence, and the amplification sequence levels of the multi-stage amplification sequence are 1-10 levels.

9. The electrochemical nucleic acid sensor according to claim 8, characterized in that: The concentration ratio of the label sequence, the pre-amplification sequence, and the amplification sequence is 1:(1-25):(1-100).

10. The electrochemical nucleic acid sensor according to claim 1, characterized in that: The dye-based electroactive molecules include one or more of methylene blue, crystal violet, Nile blue and ethyl green; And / or, the metal organic complex electroactive molecule includes one or more of hexammineruthenium chloride and ferrocene; And / or, the catalase-like electroactive molecules include one or more of aniline and thionine; And / or, the organic small molecule electroactive molecules include one or more of anthraquinone-2-sulfonic acid sodium salt, anthraquinone and cyclodextrin.

11. The electrochemical nucleic acid sensor according to any one of claims 1 to 5 and 7 to 10, characterized in that: When collecting the electron transfer signal of the electroactive substance embedded in the double-stranded segment of the nucleic acid during the redox reaction, the collection method includes one or more of differential pulse voltammetry, square wave voltammetry, cyclic voltammetry, electrochemical impedance spectroscopy, linear sweep voltammetry, alternating current voltammetry and anodic stripping voltammetry.

Images