A method for detecting novel coronavirus by constructing a colorimetric immunosensor based on metal-organic framework materials

A colorimetric immunosensor using MOF materials and aptamers addresses the limitations of existing SARS-CoV-2 detection methods by enabling direct, sensitive, and stable detection of the virus through a sandwich structure without nucleic acid extraction, enhancing detection efficiency and suitability for field use.

CN115980346BActive Publication Date: 2025-07-15YUNNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211680101.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-26
Publication Date
2025-07-15
Estimated Expiration
2042-12-26

AI Technical Summary

Technical Problem

Existing novel coronavirus detection methods such as real-time fluorescent RT-PCR and colloidal gold immunochromatography have problems such as strong equipment dependence, insufficient sensitivity and stability, making it difficult to achieve bedside detection and rapid screening.

Method used

The metal-organic framework material CuDBC is used to bind to aptamers that specifically recognize S proteins to construct a sandwich colorimetric immune sensor, and the principle of enzyme-linked immunology is used to directly identify S proteins on the surface of novel coronavirus particles to avoid nucleic acid extraction and amplification steps.

Benefits of technology

It realizes fast, ultra-sensitive and convenient novel coronavirus detection, with high specificity and stability, simplifies the detection process and reduces costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115980346B_ABST
    Figure CN115980346B_ABST
Patent Text Reader

Abstract

The present invention relates to a method for detecting novel coronavirus by constructing a colorimetric immunosensor based on metal-organic framework materials, and the method includes APT@CuDBC nanocomposites. The prominent innovation of the present invention lies in: for the first time, applying CuDBC nanomaterials to biosensors. By utilizing the characteristics that monoclonal antibodies and aptamers can specifically recognize novel coronavirus, instead of the gold standard qPCR method, nucleic acid extraction and amplification are not required, and novel coronavirus particles can be directly recognized. Combining the relatively high enzyme activity and stability of nanomaterials, the detection results can be judged by the naked eye and read by an ultraviolet spectrophotometer, and a sandwich-type novel coronavirus colorimetric immuno-biosensor is constructed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a preparation method of a colorimetric immunosensor and a detection method for novel coronavirus, and relates to a preparation method and application of a colorimetric sensor based on an enzyme-linked immunosorbent assay and metal-organic framework materials, belonging to the technical fields of functional materials and biosensing technology. Background Art

[0002] Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a single-stranded positive-sense RNA virus, belonging to the genus Betacoronavirus of the family Coronaviridae, order Nidovirales. It is spherical or oval-shaped, enveloped, with a diameter of 60-140 nm. The full-length genome is 29,903 bp (GenBank accession number MN908947). The genomic arrangement is 5'-ORF1ab-S-ORF3a-E-M-ORF6-ORF7a-ORF8-N-ORF10. Approximately two-thirds of the 5' end region encodes the viral RNA polymerase protein, and the remaining one-third encodes four structural proteins, spike protein (S), envelope protein (E), membrane protein (M), nucleocapsid protein (N), as well as some non-structural proteins and auxiliary proteins. The clinical manifestations of patients mainly include fever, fatigue, and dry cough. Upper respiratory symptoms such as nasal congestion and runny nose are rare, and anoxic and hypoxic states may occur. Approximately half of the patients develop dyspnea after about one week, and severe cases rapidly progress to acute respiratory distress syndrome, septic shock, refractory metabolic acidosis, and coagulation dysfunction.

[0003] Currently, the "gold standard" method for detecting novel coronavirus is real-time fluorescence RT-PCR detection. Real-time fluorescence PCR (polymerase chain reaction, PCR) detection of respiratory samples is a routine detection method for acute respiratory infectious diseases, with high sensitivity, good specificity, and mature application in pathogen detection. The real-time fluorescence RT-PCR detection method has played an important role in early diagnosis and screening. However, the disadvantage is that this method is affected by various factors such as sample type, collection time, sample quality, sample transportation and storage time and conditions, instrument equipment, reagents, and personnel operation methods, and is not suitable for bedside detection and on-site rapid screening. Immunological detection includes the detection of antigens and antibodies. The S protein, N protein, etc. on the surface of SARS-CoV-2 can be used as antigenic epitopes. Some companies have released 2019-nCoV novel coronavirus antigen detection reagents based on colloidal gold immunochromatography and rapid detection kits for novel coronavirus proteins with double antibody sandwich, but they rely on temperature-sensitive antibody reagents, and both the sensitivity and stability need to be improved. Summary of the Invention

[0004] The present invention is precisely to solve the above-mentioned problems and deficiencies, and provides a method for detecting novel coronavirus by constructing a colorimetric immunosensor based on metal-organic framework materials.

[0005] Aptamers (APT), also known as artificial antibodies, are nucleic acids or polypeptides that are artificially screened and can specifically recognize targets. Compared with conventional antibodies, aptamers have the advantages of stability, low cost, easy synthesis and modification.

[0006] The purpose of the present invention is to use metal-organic framework (MOF) as a nanozyme, screen out APT that can specifically recognize the S protein, modify a thiol group at its 3'-end, combine with it, and prepare a nano-material with high enzyme activity and stability that can recognize the S protein. Using the principle of enzyme-linked immunosorbent assay, a "antibody-antigen-aptamer" sandwich structure is formed, and without nucleic acid extraction and amplification, the S protein on the surface of the novel coronavirus particles can be directly recognized, constituting a colorimetric immunosensor that can quickly and effectively detect the novel coronavirus.

[0007] In the present invention, metal-organic framework materials (MOF), as a new generation of nano-materials, have different topological structures by themselves, are stable and have high enzyme activity as nanozymes. The present invention selects APT that can specifically recognize the spike protein (S protein) on the surface of the novel coronavirus. By modifying a thiol group at its 3'-end, it can be combined with the nanozyme, and then combined with an antibody that can specifically recognize SARS-CoV-2 as the primary antibody to construct a sandwich-type SARS-CoV-2 colorimetric sensor. This detection method does not require nucleic acid extraction and amplification, directly detects the S protein on the surface of the virus particles of SARS-CoV-2, and improves the detection efficiency. The establishment of a rapid, hypersensitive and convenient detection method provides a solid foundation for the implementation of point-of-care testing.

[0008] The present invention is implemented by adopting the following technical solutions.

[0009] 1. Synthesize CuDBC according to previous literature reports and characterize it.

[0010] Disperse 5 - 10 mg of 8OH-DBC ligand and 2 - 10 mg of Cu(OAc)2·H2O in 100 - 1000 μL of DMF and 1 - 4 mL of H2O by ultrasonic for 10 - 60 min, and then place the reaction system in an oven for reaction. The reaction product is washed several times with H2O and acetone respectively, and dried under vacuum to obtain a black product.

[0011] The characterization methods include: transmission electron microscope image, infrared spectrum, XRD powder X-ray diffraction pattern, XPS photoelectron energy spectrum.

[0012] 2. Synthesis of APT@CuDBC nanocomposites The screened APT (sequence: ATTACCGATGGCTTGTTTGTAATGTAGGGTTCCGTCGGAT) that specifically recognizes the S protein was added to the CuDBC nanomaterial, shaken at 4 °C for 12 h, then 1-hexanethiol (HT) was added for blocking for 1 h, and after washing 3 times with PBST, it was reserved for use.

[0013] 3. Exploration of the reaction conditions of the colorimetric immunosensor

[0014] (1) Optimal incubation duration of the antigen

[0015] Add 50 μL of 1 μg / mL S protein monoclonal antibody (Ab1) solution to the enzyme-linked immunosorbent assay (ELISA) plate, incubate at 4 °C for 12 h, then block with BSA for 30 min, and then add 50 μL of 100 ng / mL S protein, and incubate for 10 min, 20 min, 30 min, 40 min, 50 min, 60 min, 70 min, 80 min, 90 min respectively. After washing, add APT@CuDBC and incubate for 45 min. Finally, add 200 μL of 2-(N-morpholino)ethanesulfonic acid (MES) buffer solution with pH = 6 and 50 mmol / L, 50 μL of 10 mM 4-aminopyridine (4-AP) and 50 μL of 10 mM 2-(2,4-dichlorophenoxy)propionic acid (2,4-DP) for color development, and measure the absorbance value at 510 nm using a UV-visible spectrophotometer. The detection result shows that the optimal incubation duration of the antigen is 30 min.

[0016] (2) Optimal incubation duration of APT@CuDBC

[0017] Add 50 μL of 1 μg / mL Ab1 solution to the ELISA plate, incubate at 4 °C for 12 h, then block with BSA for 30 min, and then add 50 μL of 100 ng / mL S protein and incubate for 30 min. Add 50 μL of the prepared APT@CuDBC solution to the ELISA plate and incubate for 15 min, 30 min, 45 min, 60 min, 75 min, 90 min respectively. Finally, add 200 μL of MES buffer solution with pH = 6 and 50 mmol / L, 50 μL of 10 mM 4-AP and 50 μL of 10 mM 2,4-DP for color development, and measure the absorbance value at 510 nm using a UV-visible spectrophotometer. The detection result shows that the optimal incubation duration of APT@CuDBC is 45 min.

[0018] (3) Optimal pH value of the color reaction buffer: Add 50 μL of 1 μg / mL Ab1 solution to the enzyme-linked immunosorbent assay (ELISA) plate, incubate at 4 °C for 12 h, then block with BSA for 30 min. Next, add 50 μL of 100 ng / mL S protein and incubate for 30 min. Then, add 50 μL of the prepared APT@CuDBC solution to the ELISA plate and incubate for 45 min. Finally, add 200 μL of MES buffer solutions with different pH values (pH = 3, 4, 5, 6, 7, 8, 9), 50 μL of 10 mM 4-aminophenol (4-AP), and 50 μL of 10 mM 2,4-dichlorophenol (2,4-DP) for color development, and measure the absorbance at 510 nm using a UV spectrophotometer. The detection result shows that the optimal pH value of the color reaction buffer is 6.

[0019] (4) Optimal reaction temperature of the color reaction: Add 50 μL of 1 μg / mL Ab1 solution to the ELISA plate, incubate at 4 °C for 12 h, then block with BSA for 30 min. Next, add 50 μL of 100 ng / mL S protein and incubate for 30 min. Then, add 50 μL of the prepared APT@CuDBC solution to the ELISA plate and incubate for 45 min. Finally, add 200 μL of MES buffer solution with pH = 6, 50 μL of 10 mM 4-AP, and 50 μL of 10 mM 2,4-DP for color development. The color development temperatures are 30 °C, 40 °C, 50 °C, 60 °C, 70 °C, 80 °C, and 90 °C, and measure the absorbance at 510 nm using a UV spectrophotometer. The detection result shows that the optimal temperature of the color reaction is 60 °C.

[0020] 5. Measurement steps of S protein

[0021] (1) Add 50 μL of 1 μg / mL antibody (Ab1) that can specifically recognize S protein to the ELISA plate and incubate at 4 °C for 12 h;

[0022] (2) After washing 3 times with 100 μL of 0.1 mol / L PBST with pH = 7.2, add 50 μL of 1 mg / mL bovine serum albumin (BSA) to block for 30 min;

[0023] (3) After the blocking is completed, wash 3 times with 100 μL of 0.1 mol / L PBST with pH = 7.2, and then add 50 μL of antigens with different concentrations and incubate for 30 min;

[0024] (4) Wash 3 times with 100 μL of 0.1 mol / L PBST with pH = 7.2, add 50 μL of the synthesized APT@CuDBC in the above materials, incubate for 45 min, and wash the ELISA plate;

[0025] (5) Add 200 μL of MES buffer solution with pH = 6, 50 μL of 10 mM 4-AP, and 50 μL of 10 mM 2,4-DP. Perform color development at 60 °C for 15 min, measure the absorbance at OD510 nm, and plot the working curve.

[0026] In addition to the above technical solutions, the biomolecules that can be used by the present invention to identify the novel coronavirus can also be other biomolecules, such as the S protein polypeptide of the novel coronavirus, polyclonal antibodies, etc. The metal-organic framework material CuDBC in the present invention can also be replaced by other MOF materials with better enzyme activity.

[0027] The beneficial effects of the present invention are as follows: 1. It can be seen from the results of transmission electron microscopy and scanning electron microscopy that CuDBC is in a rod shape, with a length between 500 nm and 1 μm and a width between 50 nm and 100 nm, and the rods do not overlap with each other and have good dispersibility, indicating that the CuDBC material has been successfully synthesized.

[0028] 2. Infrared spectroscopy shows that the surface of the CuDBC composite material absorbs water (3443 cm-1), has the stretching vibration of the C-O single bond (1478 cm-1), the stretching vibration of the benzene ring (1628 cm-1), and the stretching vibration of the C-H single bond (1286 cm-1). All of the above indicate the successful synthesis of CuDBC.

[0029] 3. The results of X-ray photoelectron spectroscopy (XPS) show that due to Cu 2p3 、O 1s 、N 1s 、C 1s 、the binding energies appear as peaks at 938, 528, 400, and 284 eV respectively, proving the presence of Cu, O, N, and C in the nanomaterial, indicating the successful synthesis of the CuDBC material.

[0030] 4. The results of X-ray diffraction (XRD) show that sharp diffraction peaks of CuDBC appear at 8.04°, 9.78°, 13.16°, 16.48°, 24.36°, 25.46°, and 26.6°. These peaks are consistent with the simulated XRD diffraction peaks of CuDBC, indicating the successful synthesis of the CuDBC material.

[0031] 5. As the concentration of the S protein increases, the absorbance signal detected at 510 nm increases, and there is a good linear relationship in the S protein concentration range of 0.001 - 2000 ng / mL. According to the change of the absorption peak value at 512 nm of the ultraviolet spectrophotometer, take the absorption peak value of each concentration, perform data analysis, use the logarithm of the virus concentration as the X-axis and the absorbance value as the Y-axis to construct a standard curve, and the obtained standard curve equation is Y = 0.0312 log[C] + 0.3045 (R 2= 0.9939)

[0032] 7. In the absence of S protein addition, the sensor shows no signal response to bovine serum albumin (BSA), lysozyme, Escherichia coli (E. coli), Staphylococcus aureus (S. aureus), Na + , Mg 2+ , Ca 2+ , Zn 2+ , Cl - . When the standard S protein (Spike+Mix) is added to the mixture, the sensor shows an obvious signal response, indicating that the sensor can specifically detect S protein.

[0033] In this paper, CuDBC nanomaterials were successfully prepared and applied to biosensors for the first time. Using the principle similar to enzyme-linked immunosorbent assay, through the sandwich recognition of "antibody-antigen-aptamer", monoclonal antibody and aptamer were used as recognition elements to specifically recognize S protein, and a colorimetric immunosensor was successfully constructed. The linear detection range of this sensor is 0.001 - 2000 ng / mL, and it has the advantages of simple operation, high specificity, good stability and low cost, providing a new method for the detection of novel coronavirus.

[0034] The present invention will be further explained below in conjunction with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 is the schematic diagram of the colorimetric immunosensor for detecting novel coronavirus of the present invention;

[0036] Figure 2 is the TEM (A) and SEM (B) images of CuDBC nanoparticles of the present invention;

[0037] Figure 3 is the FT-IR spectrum of CuDBC of the present invention (the abscissa represents the wave number);

[0038] Figure 4 is the photoelectron spectrum of CuDBC of the present invention (the abscissa represents the binding energy);

[0039] Figure 5 is the X-ray diffraction result of CuDBC of the present invention (the abscissa represents the diffraction angle);

[0040] Figure 6 is the result diagram of condition optimization of the present invention: (A). Result of the best incubation duration of Ab1; (B). Result of the best incubation duration of APT@CuDBC; (C). Result of the optimal pH value of the color reaction buffer; (D). Result of the best color reaction temperature;

[0041] Figure 7 is the linear detection range of the sensor of the present invention; (A) Relationship between ultraviolet absorption light intensity and target concentration; (B) Linear relationship between ultraviolet absorption change value and target concentration;

[0042] Figure 8 is the specific detection result diagram of the sensor of the present invention. Detailed implementation manners

[0043] The chemical reagents and solvents used in the examples are all of analytical grade; the antibodies used are all obtained by commercial methods.

[0044] Example 1:

[0045] Synthesize CuDBC

[0046] 8.6 mg of 8OH-DBC ligand and 6 mg of Cu(OAc)2·H2O are ultrasonically dispersed in 500 μL of DMF and 2 mL of H2O for 30 min, and then the reaction system is placed in an oven at 85 °C for reaction for 72 h. The reaction product is washed 3 times with H2O and acetone each, and dried at 60 °C under vacuum for 12 h to obtain a black product.

[0047] Example 2:

[0048] Synthesize APT@CuDBC nanocomposite

[0049] Add 100 μL of 1 μmol / L APT (sequence: ATTACCGATGGCTTGTTTGTAATGTAGGGTTCCGTCGGAT) that specifically recognizes the S protein screened out to 1 mL of 1 mg / mL CuDBC nanomaterial, oscillate at 4 °C for 12 h, add 100 μL of 50 mmol / L hexanethiol (HT) to block for 1 h, and wash 3 times with PBST and set aside.

[0050] Example 3:

[0051] Figure 1 is the schematic diagram of the colorimetric immunosensor for detecting the S protein of the novel coronavirus. First, add 50 μL of 1 μg / mL antibody (Ab1) that can specifically recognize the S protein to the enzyme-linked immunosorbent assay (ELISA) plate, and incubate at 4 °C for 12 h. After washing 3 times with PBST, add 50 μL of 1 mg / mL bovine serum albumin (BSA) to block for 30 min. After the blocking is completed, after washing 3 times with PBST, add 50 μL of antigens with different concentrations and incubate for 30 min. After washing the plate 3 times, add 50 μL of the APT@CuDBC nanomaterial synthesized in the above materials, incubate for 45 min, and wash the ELISA plate.

[0052] When the target antigen is present, a sandwich structure of antibody-antigen-aptamer@nanomaterials has been formed in the enzyme-linked immunosorbent assay (ELISA) plate. Combining the enzyme activity of the nanocomposite, after adding the substrate, the color can change from colorless to red. At the same time, an ultraviolet spectrophotometer can also be used to read the absorbance value, so as to detect the novel coronavirus.

[0053] The outstanding innovation of the present invention lies in:

[0054] 1. For the first time, CuDBC nanomaterials are applied to biosensors.

[0055] 2. Utilizing the property that monoclonal antibodies and aptamers can specifically recognize the novel coronavirus, instead of the gold standard qPCR method, without nucleic acid extraction and amplification, directly recognizing the novel coronavirus particles, combining the relatively high enzyme activity and stability of the nanomaterials, the detection results can be judged by the naked eye and read by an ultraviolet spectrophotometer, and a sandwich-type colorimetric immunosensor for the novel coronavirus is constructed.

[0056]

[0057] The above are only some specific embodiments of the present invention, and the well-known specific content or common knowledge in the solution is not described in detail here (including but not limited to abbreviations, contractions, and units commonly used in the art). It should be noted that the above embodiments do not limit the present invention in any way. For those skilled in the art, any technical solutions obtained by means of equivalent replacement or equivalent transformation fall within the protection scope of the present invention. The protection scope required by this application should be determined by the content of its claims, and the specific implementation manners described in the specification can be used to explain the content of the claims.

Claims

1. A method for detecting novel coronavirus by constructing a colorimetric immunosensor based on metal-organic framework materials for non-diagnostic purposes, characterized in that, The method described above includes the following steps: Step 1) Synthesize CuDBC and characterize it; The 8OH-DBC ligand and Cu(OAc)2·H2O are ultrasonically dispersed in DMF and H2O for 10 - 60 min, and then the reaction system is placed in an oven for reaction; the reaction product is washed several times with H2O and acetone respectively, and dried under vacuum to obtain a black product; Step 2) Synthesize APT@CuDBC nanocomposite The APT specifically recognizing the S protein screened is added to the CuDBC nanomaterial, shaken, hexanethiol HT is added for blocking, and after washing with PBST, it is reserved for use; The APT sequence specifically recognizing the S protein is: ATTACCGATGGCTTGTTTGTAATGTAGGGTTCCGTCGGAT; The measurement steps of the S protein are as follows: (1) Add the antibody Ab1 specifically recognizing the S protein to the enzyme-linked immunosorbent assay (ELISA) plate and incubate at 4 °C for 12 h; (2) After washing with PBST with pH = 7.2, add bovine serum albumin (BSA) for blocking for 30 min; (3) After the blocking is completed, wash with PBST with pH = 7.2, and then add antigens with different concentrations for incubation; (4) Wash with PBST with pH = 7.2, add APT@CuDBC, incubate, and wash the ELISA plate; (5) Add MES buffer solution, 4-AP and 2,4-DP, and develop color at 60 °C for 15 min, then measure the absorbance at OD 510 nm to draw a working curve; The linear detection range of the sensor is 0.001 - 2000 ng / mL.

2. A method for detecting novel coronavirus by constructing a colorimetric immunosensor based on metal-organic framework materials for non-diagnostic purposes according to claim 1, characterized in that, The incubation time of the antigen is 30 min.

3. A method for detecting novel coronavirus by constructing a colorimetric immunosensor based on metal-organic framework materials for non-diagnostic purposes according to claim 1, wherein, The incubation time for adding APT@CuDBC is 45 min.

4. A method for detecting novel coronavirus by constructing a colorimetric immunosensor based on metal-organic framework materials for non-diagnostic purposes according to claim 1, characterized in that, The pH of the MES buffer solution is 6.