CRISPRa Gene Activation System, Genetically Engineered Bacteria Containing the Same, and Their Applications
The CRISPRa gene activation system improves the expression of target genes in Candida vesus, solves the problem of inducer dependence without introducing exogenous gene sequences and traditional methods, and achieves flexible control and efficient expression, reducing the fermentation cost and cloning difficulty.
Patent Information
- Application Number
- CN202111222424.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-10-20
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2041-10-20
AI Technical Summary
In the prior art, it is difficult to improve the expression of the target gene without introducing exogenous gene sequences, and traditional methods require inducers and large-scale expression vectors, resulting in high fermentation costs and high cloning difficulties.
The CRISPRa gene activation system is adopted, including the dCas9 expression cassette, scRNA expression cassette and activator expression cassette, which binds the genome through the dCas9 protein and forms a CRISPR complex with scRNA and activator, directly improves the transcription level of the target gene and avoids the introduction of exogenous sequences and the use of inducers.
It has achieved flexible control of gene expression in Candida Visce, improved the expression level of the target gene, solved the uncontrollable problem of overexpression of exogenous genes, and reduced the fermentation cost and cloning difficulty.
Smart Images

Figure BDA0003313101780000101 
Figure BDA0003313101780000111
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of bioengineering, and particularly relates to a CRISPRa gene activation system, a genetically engineered bacterium containing the same, and their applications. Background Art
[0002] Candida viswanathii is a fungus produced from oil fields and has the ability to degrade crude oil. It has extremely high utilization value in the field of industrial biology. By modifying the metabolic pathway of Candida viswanathii, it can be used to synthesize long-chain dicarboxylic acids with alkanes as substrates. For example, Pictaggio et al. (Mol. Cell. Biol., 11(9), 4333-4339, 1991) reported that knocking out two alleles of POX4 and POX5 can effectively block the β-oxidation pathway, thus achieving a 100% conversion rate of the substrate. Therefore, Candida viswanathii is considered a microorganism with important industrial value.
[0003] We need to modify the genome and gene expression process of Candida viswanathii to achieve the purpose of controlling the product metabolic pathway. For example: in the metabolic pathway of long-chain dicarboxylic acids, the main pathway for synthesizing long-chain dicarboxylic acids is ω-oxidation. We hope to increase the expression of genes related to ω-oxidation. Usually, we will clone the gene to be overexpressed into a plasmid vector containing an inducible promoter, and then transform the plasmid into the engineered bacterium, and add an inducer during the culture process for overexpression. However, this method has some obvious defects: when there are many endogenous genes to be overexpressed, all genes need to be cloned into the vector plasmid in sequence, which will increase the size of the vector and the difficulty of cloning and transformation. At the same time, the expression of induced genes requires an inducer, which may increase the fermentation cost. Therefore, it is of research value to develop a controllable gene activation system in Candida viswanathii.
[0004] CRISPR activation, that is, CRISPRa technology, has gradually come into view. It can directly interact with the target gene in the genome without introducing an exogenous gene expression cassette, and improve the transcription level of the target gene. The principle of CRISPRa is to utilize the ability of dCas9 to bind but not digest double-stranded DNA, introduce a transcriptional activator into the CRISPR system, and localize the CRISPR system near the promoter of the target gene to improve its expression level. CRISPRa has been reported in model organisms in a variety of different forms, including: dCas9-VP64 reported by Gilbert et al., CRISPR-VPR reported by Chavez et al., Suntag reported by Chavez et al., and CRISPR-scRNA reported by Zalatan et al.
[0005] CRISPRa enables the simultaneous expression of multiple scRNAs (scaffold RNAs), which means that in theory, the use of the CRISPRa system can avoid the disadvantages of introducing a large number of foreign sequences in overexpression, directly control endogenous genes, and enhance their expression levels. At the same time, the CRISPRa system does not require the addition of other small molecule inducers during operation. Therefore, the development of the CRISPRa system in Candida viswanathii is of great significance for the genetic engineering transformation of chassis cells. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to overcome the defect of Candida viswanathii lacking in the prior art that can enhance the expression of target genes without introducing more foreign gene sequences, and to provide an application of a CRISPRa gene activation system in Candida viswanathii. The CRISPRa gene activation system of the present invention can enhance the expression of target genes without introducing more foreign gene sequences and can flexibly control the activation effect.
[0007] The present invention solves the above technical problems through the following technical solutions:
[0008] The first aspect of the present invention provides an application of a CRISPRa gene activation system in Candida viswanathii; in particular, an application in enhancing the expression of target genes in Candida viswanathii;
[0009] The CRISPRa gene activation system comprises: a dCas9 expression cassette, an scRNA expression cassette, and an activator expression cassette; wherein: the dCas9 expression cassette includes the dCas9 gene and a first promoter upstream thereof, the nucleotide sequence of the dCas9 gene is as shown in SEQ ID NO:1, and the nucleotide sequence of the first promoter is as shown in SEQ ID NO:2;
[0010] The scRNA expression cassette includes the nucleotide sequence encoding the scRNA and a third promoter upstream thereof, the nucleotide sequence of the third promoter is as shown in SEQ ID NO:7 or SEQ ID NO:8;
[0011] The activator expression cassette includes an activator gene and a second promoter upstream thereof, the nucleotide sequence of the second promoter is as shown in SEQ ID NO:4 or SEQ ID NO:5.
[0012] In some embodiments of the present invention, the nucleotide sequence of the activator gene is as shown in SEQ ID NO:3.
[0013] In some embodiments of the present invention, the nucleotide sequence encoding the scRNA comprises a recognition sequence and a structural sequence; the recognition sequence is a sequence complementary to 20 bases upstream of the PAM sequence, such as the NGG sequence, within 250 bases of the transcription start of the target gene; the structural sequence is as shown in SEQ ID NO:6.
[0014] In some specific embodiments of the present invention, the recognition sequence is as shown in any one of SEQ ID NOs:9-12.
[0015] Those skilled in the art should understand that in the present invention, the target gene is the gene whose expression level is to be increased by the CRISPRa gene activation system.
[0016] In some embodiments of the present invention, the Candida viswanathii is the strain with the preservation number CCTCC:M2020048.
[0017] In some embodiments of the present invention, the dCas9 expression cassette is integrated into the chromosome of the Candida viswanathii.
[0018] In some specific embodiments of the present invention, the first promoter with the nucleotide sequence as shown in SEQ ID NO:2 is promoter 1.0; the second promoters with the nucleotide sequences as shown in SEQ ID NO:4 or SEQ ID NO:5 are promoter 2.0 and promoter 2.1 respectively; the second promoters with the nucleotide sequences as shown in SEQ ID NO:7 or SEQ ID NO:8 are promoter 3.0 and promoter 3.1 respectively.
[0019] The second aspect of the present invention provides a CRISPRa gene activation system, which is as described in the first aspect.
[0020] In some embodiments of the present invention, the nucleotide sequence of the activator gene is as shown in SEQ ID NO:3.
[0021] In some embodiments of the present invention, the nucleotide sequence encoding the scRNA is as described in the first aspect.
[0022] In some specific embodiments of the present invention, the recognition sequence is as shown in any one of SEQ ID NOs:9-12.
[0023] The third aspect of the present invention provides a genetically engineered bacterium, which expresses the CRISPRa gene activation system as described in the second aspect, and the starting bacterium of the genetically engineered bacterium is Candida viswanathii.
[0024] In some embodiments of the present invention, the Candida viswanathii is the strain with the preservation number of CCTCC: M2020048.
[0025] The fourth aspect of the present invention provides a method for enhancing gene expression in Candida viswanathii, the method comprising:
[0026] (1) making the Candida viswanathii contain the dCas9 expression cassette in the CRISPRa gene activation system as described in the second aspect;
[0027] (2) designing the scRNA expression cassette and the activator expression cassette of the CRISPRa gene activation system as described in the second aspect according to the target gene whose expression is to be enhanced, and introducing them into the Candida viswanathii, thus obtaining the product.
[0028] In some embodiments of the present invention, the Candida viswanathii is the strain with the preservation number of CCTCC: M2020048.
[0029] The fifth aspect of the present invention provides a recombinant vector combination, the recombinant vector combination comprising a dCas9 recombinant vector encoding a nucleic acid of dCas9, and a composite recombinant vector encoding nucleic acids of scRNA and an activator; or the recombinant vector combination comprises a dCas9 recombinant vector encoding a nucleic acid of dCas9, an scRNA recombinant vector encoding a nucleic acid of scRNA, and an activator recombinant vector encoding a nucleic acid of an activator;
[0030] The nucleotide sequence of the dCas9 is as shown in SEQ ID NO:1; the scRNA is the scRNA of the CRISPRa gene activation system as described in the second aspect.
[0031] In some embodiments of the present invention, the backbone plasmid of the dCas9 recombinant vector or the composite recombinant vector is selected from pUC18, pUC19, pBR322, pACYC, pET, pSC101 and their derivative plasmids.
[0032] In some specific embodiments of the present invention, the backbone plasmid of the composite recombinant vector is pCIB2, and its nucleotide sequence is as shown in SEQ ID NO:13.
[0033] In the present invention, the CRISPRa gene activation system comprises three parts: dCas9 protein, scRNA, and an activator. The dCas9 protein can bind to genomic DNA. The scRNA is a small RNA with a fixed secondary structure region and a variable 20-base recognition sequence. The activator can promote the expression of a target gene. The scRNA contains functional domain secondary structures capable of binding to dCas9 and the activator respectively. After binding, a CRISPR complex is formed, and the scRNA serves as the backbone of the entire CRISPR complex. Meanwhile, the 20-base recognition sequence contained in the scRNA can recognize and bind to the complementary sequence in the genome and precisely position the dCas9 protein at a specific region of the genome. The activator region contains an RNA-binding region that can bind to the scRNA-binding domain and an activator region that may interact with the RNA transcription system. When the CRISPRa system is expressed in cells, dCas9, scRNA, and the activator form a CRISPR complex through the binding of their specific regions. The CRISPR complex will find the complementary region in the genome through the 20bp recognition sequence of the scRNA.
[0034] In the present invention, by editing the 20bp recognition sequence of the scRNA, the CRISPR complex is guided to the upstream promoter region where the target gene is located. The activator bound to the CRISPR complex will interact with the nearby RNA polymerase and its accessory proteins, enabling the RNA polymerase to bind to the promoter sequence more efficiently, thereby achieving the purpose of increasing the transcription level and thus enhancing gene expression.
[0035] In the present invention, the three parts of the CRISPRa gene activation system need to be expressed simultaneously in the chassis bacterium (i.e., Candida viswanathii).
[0036] In some embodiments of the present invention, in the Candida viswanathii of the present invention, the dCas9 protein is integrated into the genome of Candida viswanathii, and the activator recombinant protein and the scRNA are co-inserted into the same plasmid vector for expression.
[0037] When the CRISPRa system is correctly expressed in Candida viswanathii, the dCas9 protein will be guided to the nucleus by a PAM (Protospace adjacent motif) sequence that can be recognized, which is located upstream of the 5' end of the 20bp target site in the genome. Subsequently, the activator enters the nucleus; the scRNA binds to dCas9 through the dCas9-binding domain and binds to the activator through the activator-binding domain, forming a CRISPR complex. The CRISPR complex will find the complementary sequence in the genome through the 20bp recognition sequence of the scRNA and anchor the CRISPR complex upstream of the target gene promoter region.
[0038] In the present invention, the PAM sequence is conventional in the art, i.e., NGG.
[0039] After anchoring, the CRISPR complex bound upstream of the promoter interacts with the proteins of the activator domain RNA polymerase system, enabling the RNA polymerase to bind more efficiently to the promoter region of the target gene. This increases the transcriptional activity of the RNA polymerase, thereby enhancing the expression level of the target gene.
[0040] In the present invention, the dCas9 protein is a mutant of the Cas9 protein of S. pyogenes with two point mutations, D10A and H840A, and is expressed under the Candida viswanathii first promoter. Homologous arms of the Candida viswanathii γ integration site are inserted at both ends of this expression cassette and constructed into a cloning vector labeled with ampicillin antibiotic. This integration plasmid is digested with enzymes to linearize it and inserted into the Candida viswanathii γ integration site using the CRISPR-Cas9 editing method to obtain a dCas9 expression strain.
[0041] Both the scRNA and the activator protein are expressed in the same plasmid. The general structure and sequence of the scRNA have been reported in the literature by Zalatan et al. (Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds, Cell 160, 339-350, 2015-01-15). The expression cassettes of the scRNA and the activator are jointly constructed in a cloning vector containing an ampicillin antibiotic label.
[0042] The activator can be conventional in the art, such as MCP-VP64, and its nucleotide sequence is as shown in SEQ ID NO:3.
[0043] MCP-VP64 is a recombinant protein. MCP is responsible for binding to the scRNA. It can bind to the MS2 structural recognition domain in the scRNA, enabling it to bind to the CRISPR complex. VP64 can interact with the RNA polymerase transcription system, thereby enhancing the expression efficiency of the target gene.
[0044] In the present invention, the sequence of the full domain of the scRNA containing a 20bp recognition sequence in the plasmid vector, due to its variability, is represented by 20 "N" bases. The subsequent sequence is the structural sequence in the scRNA that recognizes dCas9 and the hairpin sequence that recognizes the activator.
[0045] Based on the common knowledge in the art, the above preferred conditions can be arbitrarily combined to obtain various preferred embodiments of the present invention.
[0046] The reagents and raw materials used in the present invention are all commercially available.
[0047] The positive and progressive effects of the present invention are as follows:
[0048] The CRISPRa gene activation system of the present invention can flexibly regulate different endogenous genomic genes without adding an inducer and without constructing a large-scale expression vector through the selection of promoters, and is a tool for developing a reliable method to up-regulate gene expression in Candida viswanathii. The present invention overcomes the above disadvantages of traditional methods, has a controllable activation effect on gene expression, solves the problems of uncontrollable expression level or the need to use small molecule inducing reagents in overexpression of foreign genes, makes the means of gene expression regulation in Candida viswanathii richer and more flexible, can quickly introduce regulatory elements to activate multiple different target genes, and solves the limitation of the space that can be borne by the overexpression vector of foreign genes. Specific Embodiments
[0049] The present invention will be further illustrated by the following examples, but the present invention is not limited to the scope of the examples described herein. For the experimental methods without specific conditions noted in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product instructions.
[0050] The preservation number of the Candida viswanathii strain used in the examples is CCTCC: M2020048, and the culture method can be referred to CN111748480A.
[0051] The gene synthesis method and PCR amplification method used in the examples are all conventional in the art.
[0052] The Gibson recombination (Thermo-Invitrogen GeneArt TM Gibson AssemblyHiFi reagent master mix A46629) method and transformation method (see Molecular Cloning: A Laboratory Manual) used in the examples are all conventional in the art.
[0053] The plasmid recovery kit used in the examples is AxyPrep Plasmid Miniprep Kit AP-MN-P-250.
[0054] The ScaI restriction endonuclease used in the examples is Thermo FastDigest ScaI FD0434.
[0055] The Escherichia coli used in the examples is Top10.
[0056] Example 1: Construction of a strain expressing the CRISPRa gene activation system
[0057] First step: Construction of a strain with integrated and expressed dCas9
[0058] 1. Amplify the dCas9 gene fragment shown in SEQ ID NO:1 and the promoter 1.0 fragment shown in SEQ ID NO:2 by PCR respectively.
[0059] 2. Using the Gibson recombination method, mix, assemble the plasmid vector pUC19, the dCas9 gene fragment, the promoter 1.0 fragment and the Gibson recombination enzyme premix at a volume ratio of 1:0.75:0.75:2.5, and incubate at 50 °C for 15 - 30 min to obtain the dCas9 recombinant plasmid.
[0060] 3. Transform the obtained dCas9 recombinant plasmid into Escherichia coli by chemical transformation. Spread the transformed bacteria on an LB plate containing 40 μg / mL ampicillin antibiotic and culture overnight at 37 °C.
[0061] 4. Pick a single colony on the plate into 5 mL of LB + 40 μg / mL ampicillin liquid medium, culture overnight with shaking, and then extract the plasmid using a plasmid recovery kit to harvest the purified dCas9 integrated plasmid.
[0062] 5. Digest the dCas9 integrated plasmid with ScaI restriction endonuclease to obtain the linearized dCas9 integrated plasmid, which can be used for transformation and integration.
[0063] 6. Prepare competent cells: Streak and pick a single colony of Candida versatilis strain, culture it with shaking in YPD medium at 30 °C for 24 hours, dilute it at a ratio of 1:200 and culture overnight for 16 hours.
[0064] 7. Use a spectrophotometer to measure the OD value of the bacterial solution. When the OD value reaches about 2, prepare electrocompetent cells. Transfer 80 μL of competent cells to an electroporation cuvette with a 2 mm gap, add the pCas9 CRISPR editing plasmid and the linearized dCas9 integrated plasmid; perform electroporation at a voltage of 2.4 kV, and spread the bacteria after electroporation incubation evenly on a YPD plate containing 100 μg / mL nourseothricin and culture at 30 °C for 3 - 6 days.
[0065] 8. Pick a single colony on the plate into a YPD plate containing 100 μg / mL nourseothricin. If no bacteria grow, it indicates that the pCas9 CRISPR plasmid has been completely lost. After verification, a strain with integrated and expressed dCas9 is obtained.
[0066] Step 2: Construct scRNA + activator plasmid
[0067] 1. Identify and locate the target gene to be activated in the genomic sequence of Candida viswanathii, and search for the NGG PAM recognition sequence within the range of 50 - 300 bp upstream of the target gene promoter sequence. Take 20 bp upstream of the found PAM sequence as the recognition sequence of scRNA.
[0068] 2. Amplify the scRNA fragment containing the recognition sequence and the general structure, as well as the promoter 3.0 fragment shown in SEQ ID NO:7 or the promoter 3.1 fragment shown in SEQ ID NO:8 by PCR respectively;
[0069] Amplify the MCP - VP64 fragment shown in SEQ ID NO:3, as well as the promoter 2.0 fragment shown in SEQ ID NO:4 or the promoter 2.1 fragment shown in SEQ ID NO:5 by PCR respectively.
[0070] 3. Using the Gibson recombination method, mix and assemble the scRNA fragment with the promoter 3.0 fragment or the promoter 3.1 fragment, the plasmid vector pCIB2, the MCP - VP64 fragment with the promoter 2.0 fragment or the promoter 2.1 fragment, and the Gibson recombinase premix respectively at a volume ratio of 0.75:1:0.75:2.5, and incubate at 50 °C for 15 - 30 min to obtain the scRNA + activator plasmid corresponding to different promoter fragments.
[0071] 4. Transform the scRNA + activator plasmid obtained in step 3 into Escherichia coli by chemical transformation method, spread the transformed bacteria on the LB plate containing 40 μg / mL ampicillin antibiotic, and culture overnight.
[0072] 5. Pick the monoclonal on the plate into 5 mL LB + 40 μg / mL ampicillin liquid medium, culture it overnight with shaking, and then extract the plasmid using a plasmid extraction kit to harvest the purified scRNA + activator plasmid.
[0073] Step 3: Transform the scRNA + activator plasmid
[0074] 1. Streak and pick the dCas9 integrated expression strain obtained in the first step on the YPD plate, pick the monoclonal into a seed flask containing YPD, and culture it with shaking at 30 °C for 24 hours.
[0075] 2. Dilute the bacteria from the seed flask at a ratio of 1:200 and transfer them to a flask containing YPD, and culture overnight for 16 hours.
[0076] 3. For other steps, refer to item 7 of the first step. Harvest the bacterial liquid and prepare competent cells. Transform the scRNA + activator plasmid into the competent cells by electroporation, and culture on a YPD plate at 30 °C to obtain monoclonal colonies.
[0077] 4. Pick monoclonal colonies from the plate for the next screening and verification.
[0078] Example 2 Verification of the Effect of the CRISPRa Gene Activation System
[0079] According to Example 1, the expression cassette of dCas9 was inserted into the Candida viswanathii strain to construct a dCas9-integrated expression strain. Two genes, PXA1 and AAT2, were selected as target genes, and two scRNAs were designed for each gene by standard methods. The 20bp recognition sequences of the scRNAs were as follows:
[0080] PXA1-1: actacaaagaagaagatgca (SEQ ID NO:9);
[0081] PXA1-2: aaagtcgatctggcatgaaa (SEQ ID NO:10);
[0082] AAT2-1: tcttattactgcgaaactgt (SEQ ID NO:11);
[0083] AAT2-2: aagaaaacgggtaaactgta (SEQ ID NO:12).
[0084] According to the above recognition sequences, scRNA + activator recombinant plasmids with different promoters were constructed as shown in Table 1 and transformed into the dCas9-integrated expression strain respectively to obtain the following strains:
[0085] Table 1 Configuration of CRISPRa Gene Activation System Elements
[0086] Strain number Activator promoter scRNA promoter Recognition sequence Strain 1 Promoter 2.0 Promoter 3.0 PXA1-1 Strain 2 Promoter 2.0 Promoter 3.0 PXA1-2 Strain 3 Promoter 2.0 Promoter 3.0 AAT2-1 Strain 4 Promoter 2.0 Promoter 3.0 AAT2-2 Strain 5 Promoter 2.1 Promoter 3.1 PXA1-1 Strain 6 Promoter 2.1 Promoter 3.1 PXA1-2 Strain 7 Promoter 2.1 Promoter 3.1 AAT2-1 Strain 8 Promoter 2.1 Promoter 3.1 AAT2-2
[0087] Each strain was in triplicate. After culturing 24 strains and the control strain for 24 hours, the expression levels of PXA1 and AAT2 genes were measured by RT-qPCR. The control strain contained GFP, dCas9, and an scRNA + activator plasmid with a non-target sequence. The results obtained are shown in Tables 2 and 3.
[0088] Table 2 Detection Results of PXA1 Gene Expression Level
[0089]
[0090]
[0091] Table 3 Detection Results of AAT2 Gene Expression Levels
[0092] Recognition sequence Expression level Standard error Control strain Unrelated sequence 222.86 24.73 Strain 3 AAT2-1 411.01 8.87 Strain 4 AAT2-2 410.24 10.00 Strain 7 AAT2-1 390.72 16.25 Strain 8 AAT2-2 369.65 10.25
[0093] From the results, it can be seen that regardless of which promoter combination, CRISPRa acting on the two genes PXA1 and AAT2 showed a significant increase in expression levels. Moreover, the expression levels obtained with the combination of promoter 2.0 and promoter 3.0 were higher than those of the combination of promoter 2.1 and promoter 3.1. SEQUENCE LISTING <110> Shanghai Kaisai Biotechnology Co., Ltd. CIBT USA Inc. <120> CRISPRa Gene Activation System, Genetically Engineered Bacteria Containing the Same, and Their Applications <130> P21015931C <160> 13 <170> PatentIn version 3.5 <210> 1 <211> 4119 <212> DNA <213> Artificial Sequence <220> <223> dCas9 <400> 1 atggacaaga agtactccat cggtttggcc atcggtacta actcagttgg ttgggccgtt 60 atcaccgacg aatacaaggt cccatccaag aagttcaagg tcttgggtaa caccgaccgt 120 cactccatca agaagaactt gatcggtgcc ttgttgttcg actcaggtga aaccgccgaa 180 gctaccagat tgaagagaac cgccagaaga cgttacaccc gtcgtaagaa ccgtatctgt 240 tacttgcaag aaatcttctc caacgaaatg gctaaggttg acgactcctt cttccacaga 300 ttggaagaat ccttcttggt cgaagaagac aagaagcacg aacgtcaccc aatcttcggt 360 aacatcgttg atgaagtcgc ttaccacgaa aagtacccaa ccatctacca cttgcgtaag 420 aagttggtcg attccaccga taaggccgat ttgcgtttga tctacttggc cttggcccac 480 atgatcaagt tcagaggtca cttcttgatc gaaggtgact tgaacccaga caactccgac 540 gttgataagt tgttcatcca attggtccaa acctacaacc aattgttcga agaaaaccca 600 atcaacgctt caggtgttga tgctaaggct attttgtccg ctcgtttgtc caagtcccgt 660 agattggaaa acttgatcgc ccaattgcca ggtgaaaaga agaacggttt gttcggtaac 720 ttgatcgcct tgtccttggg tttgacccca aacttcaagt ccaacttcga cttggccgaa 780 gacgccaaat tgcaattgtc caaggacacc tacgacgacg acttggacaa cttgttggcc 840 caaatcggtg accaatacgc cgacttgttc ttggccgcta aaaacttgtc cgacgctatc 900 ttgttgtccg acatcttgag agtcaacacc gaaatcacta aggctccatt gtccgcttcc 960 atgatcaagc gttacgacga acaccaccaa gacttgacct tgttgaaggc cttggtccgt 1020 caacaattgc cagaaaagta caaggaaatc ttcttcgacc aatccaagaa cggttacgcc 1080 ggttacattg acggtggtgc ttcccaagaa gaattctaca agttcatcaa gccaatcttg 1140 gaaaagatgg acggtactga agaattgttg gtcaagttga acagagaaga cttgttgcgt 1200 aagcaacgta ccttcgacaa cggttccatc ccacaccaaa tccacttggg tgaattgcac 1260 gccatcttgc gtcgtcaaga agacttctac ccattcttga aggacaaccg tgaaaagatc 1320 gaaaagatct tgaccttccg tatcccatac tacgtcggtc cattggctag aggtaactcc 1380 agattcgctt ggatgacccg taagtccgaa gaaaccatca ccccatggaa cttcgaagaa 1440 gttgttgata agggtgcttc cgctcaatcc ttcatcgaac gtatgaccaa cttcgacaag 1500 aacttgccaa acgaaaaggt cttgccaaag cactccttgt tgtacgaata cttcaccgtc 1560 tacaacgaat tgaccaaggt caagtacgtc accgaaggta tgcgtaagcc agctttcttg 1620 tccggtgaac aaaagaaggc catcgttgat ttgttgttca agaccaaccg taaggtcacc 1680 gtcaagcaat tgaaggaaga ctacttcaag aagatcgaat gtttcgactc cgtcgaaatc 1740 gtcaagcaat tgaaggaaga ctacttcaag aagatcgaat gtttcgactc cgtcgaaatc 1740 tcaggtgtcg aagacagatt caacgcttcc ttgggtactt accacgactt gttgaagatc 1800 tcaggtgtcg aagacagatt caacgcttcc ttgggtactt accacgactt gttgaagatc 1800 atcaaggaca aggacttctt ggacaacgaa gaaaacgaag acatcttgga agacatcgtc 1860 atcaaggaca aggacttctt ggacaacgaa gaaaacgaag acatcttgga agacatcgtc 1860 ttgaccttga ccttgttcga agacagagaa atgatcgaag aacgtttgaa gacctacgcc 1920 ttgaccttga ccttgttcga agacagagaa atgatcgaag aacgtttgaa gacctacgcc 1920 cacttgttcg acgacaaggt catgaagcaa ttgaagcgtc gtagatacac cggttggggt 1980 cacttgttcg acgacaaggt catgaagcaa ttgaagcgtc gtagatacac cggttggggt 1980 agattgtccc gtaagttgat caacggtatc agagacaagc aatccggtaa gaccatcttg 2040 agattgtccc gtaagttgat caacggtatc agagacaagc aatccggtaa gaccatcttg 2040 gacttcttga agtcagacgg tttcgccaac cgtaacttca tgcaattgat ccacgacgac 2100 gacttcttga agtcagacgg tttcgccaac cgtaacttca tgcaattgat ccacgacgac 2100 tccttgacct tcaaggaaga catccaaaag gcccaagttt ccggtcaagg tgattccttg 2160 tccttgacct tcaaggaaga catccaaaag gcccaagttt ccggtcaagg tgattccttg 2160 cacgaacaca tcgctaattt ggccggttct ccagccatca agaagggtat cttgcaaacc 2220 cacgaacaca tcgctaattt ggccggttct ccagccatca agaagggtat cttgcaaacc 2220 gtcaaggtcg ttgatgaatt ggttaaggtc atgggtcgtc acaagccaga aaacatcgtc 2280 gtcaaggtcg ttgatgaatt ggttaaggtc atgggtcgtc acaagccaga aaacatcgtc 2280 atcgaaatgg ccagagaaaa ccaaaccacc caaaagggtc aaaagaactc cagagaacgt 2340 atcgaaatgg ccagagaaaa ccaaaccacc caaaagggtc aaaagaactc cagagaacgt 2340 atgaagcgta tcgaagaagg tatcaaggaa ttgggttccc aaatcttgaa ggaacaccca 2400 atgaagcgta tcgaagaagg tatcaaggaa ttgggttccc aaatcttgaa ggaacaccca 2400 gtcgaaaaca cccaattgca aaacgaaaag ttgtacttgt actacttgca aaacggtaga 2460 gacatgtacg ttgatcaaga attggacatc aaccgtttgt ccgactacga cgttgacgcc 2520 atcgtcccac aatccttctt gaaggacgac tccatcgaca acaaggtctt gaccagatcc 2580 gacaagaaca gaggtaagtc cgacaacgtc ccatccgaag aagtcgtcaa gaagatgaag 2640 aactactggc gtcaattgtt gaacgccaag ttgatcaccc aacgtaagtt cgacaacttg 2700 accaaggccg aaagaggtgg tttgtcagaa ttggacaagg ccggtttcat caagcgtcaa 2760 ttggtcgaaa cccgtcaaat caccaagcac gtcgctcaaa tcttggactc ccgtatgaac 2820 accaagtacg acgaaaacga caagttgatc agagaagtca aggtcatcac cttgaagtcc 2880 aagttggtct ccgacttccg taaggacttc caattctaca aggtccgtga aatcaacaac 2940 taccaccacg ctcacgacgc ttatttgaac gccgttgttg gtactgcttt gatcaagaag 3000 tacccaaagt tggaatccga attcgtctac ggtgactaca aggtctacga cgtcagaaag 3060 atgatcgcca agtccgaaca agaaatcggt aaggctaccg ccaagtactt cttctactcc 3120 aacatcatga acttcttcaa gaccgaaatc accttggcca acggtgaaat ccgtaagcgt 3180 ccattgatcg aaaccaacgg tgaaaccggt gaaatcgttt gggacaaggg tagagacttc 3240 gctaccgtta gaaaggtctt gtccatgcca caagtcaaca tcgtcaagaa gaccgaagtc 3300 caaaccggtg gtttctccaa ggaatccatc ttgccaaagc gtaactccga caagttgatc 3360 gcccgtaaga aggattggga cccaaagaag tacggtggtt tcgattcccc aaccgttgct 3420 tactccgtct tggttgtcgc caaagtcgaa aagggtaagt ccaagaagtt gaagtccgtc 3480 aaggaattgt tgggtatcac catcatggaa cgttcctcct tcgaaaagaa cccaatcgac 3540 ttcttggaag ccaagggtta caaggaagtc aagaaggact tgatcatcaa gttgccaaag 3600 tactccttgt tcgaattgga aaacggtcgt aagagaatgt tggcttccgc cggtgaattg 3660 caaaagggta acgaattggc cttgccatcc aagtacgtca acttcttgta cttggcctcc 3720 cactacgaaa agttgaaggg ttccccagaa gacaacgaac aaaagcaatt gttcgtcgaa 3780 caacacaagc actacttgga cgaaatcatc gaacaaatct ccgaattctc caagagagtc 3840 atcttggccg acgctaactt ggataaggtc ttgtccgcct acaacaagca cagagacaag 3900 ccaatcagag aacaagccga aaacatcatc cacttgttca ccttgaccaa cttgggtgct 3960 ccagccgctt ttaagtactt cgataccacc atcgaccgta agcgttacac ttccaccaag 4020 gaagtcttgg acgctacctt gatccaccaa tccatcaccg gtttgtacga aacccgtatc 4080 gacttgtccc aattgggtgg tgacgaaggt gccgattaa 4119 <210> 2 <211> 1455 <212> DNA <213> Artificial Sequence <220> <223> Promoter 1.0 <400> 2 aagaaacgta ttgcaactgg agatagcgat cgttcaattt attccgattt tgtgggggaa 60 gtcgcccgct agtgggcgtg cgcgagtggc aaaagaaact gggccatgct tcttatcatc 120 ccttagaaga gcaatcataa gaaacgttca gtgagaaaaa cgttggcttc ggttaatgat 180 caccttaaag gcaaaatacc tccatgtatg aacatgtagg ttattccttt ttcttttttt 240 gcaacaccct cggcgggttg ttcatattcc cggaaaacac ctccactcgg ggctaagtgg 300 atcttctata aacccgggga aataaggagc cccggtgagc gcgcacacac accaccttca 360 ttttgtccga gggaaacagc acgtgaatcc ggaacacgag aggaatattt cttctatttt 420 tttttcttct ctactgtgag cgcgtgatta tataatcaca agcgatcaac ttatggtagg 480 gtcgtgcacg gcgcaccggg ttccaaaatg atctgcgagg gacaaaattc ttttttttct 540 tccagcatgc cgctggtggc aaataccgtc gtggcatgat gctccctatg catttgattc 600 acaccaccac caccattaat caccaattaa gaggggacaa aagtgaacaa ttggtggccg 660 tcaggttaca ctcatctgct tcggagtttt acgtcccttt ctcttttcaa tttgtgaaat 720 gtcaccctgg cggcgttcga gagagatcag tccgaagcgc gtggtaggag aaacggagca 780 ccgcagcaac aaaaaaaaaa aaaaaaaatt ccaaacccaa gggggtaggg agaagaacag 840 ccagggaagt tgtttaccga cctgaccgta aatttgctgc tgaaagaaac gtgtcaaaca 900 agaccaattg gctcaattga ccctgtggaa atgctttgtt gaccaccaat gcttccacca 960 aacgttactt tttttttgca atcggatggt atgggtctgg ggttcacctg ttttgtaaag 1020 ctacagaagg tggcatattt ctctgatcag gtgttttttt tttcggctgc tgctgctcgt 1080 ggtggtgtag tggtagtggt gtgtgtgtgt gtgtgtgcgt gcgtgtggaa ggacgctttt 1140 tgctctctga ctcctcccaa tcagaagttg ctatagtggt gaaacaacaa tggatgataa 1200 tgccccgggc ggtgcgtgtc cgacacaaac cactacattt tttagctggg agcctactgc 1260 cactacgacc cacccaccca tggtcaacaa aaaaattctg acaaattata aaataaccct 1320 tgaattcccc cttggaaaaa tttttggtat ttctctctct cttttccttt ccctcttctt 1380 tttctctcca tcaatcaatt gacgttcagt aactcaatta attacatcac atccctcaat 1440 taaagaattt aaaca 1455 <210> 3 <211> 525 <212> DNA <213> Artificial Sequence <220> <223> MCP-VP64 <400> 3 atggcttcta actttactca gttcgttctc gtcgacaatg gcggaactgg cgacgtgact 60 gtcgccccaa gcaacttcgc taacgggatc gctgaatgga tcagctctaa ctcgcgttca 120 caggcttaca aagtaacctg tagcgttcgt cagagctctg cgcagaatcg caaatacacc 180 atcaaagtcg aggtgcctaa aggcgcctgg cgttcgtact taaatatgga actaaccatt 240 ccaattttcg ccacgaattc cgactgcgag cttattgtta aggcaatgca aggtctccta 300 aaagatggaa acccgattcc ctcagcaatc gcagcaaact ccggcatcta cggctccgga 360 cgagccgatg ctctcgacga ttttgacctc gatatgctgg gatccgacgc tctcgatgac 420 ttcgaccttg acatgctggg gagtgacgct ctggacgact tcgatctcga catgctgggc 480 tccgacgccc tggatgactt cgatctggac atgctcatca actga 525 <210> 4 <211> 967 <212> DNA <213> Artificial Sequence <220> <223> Promoter 2.0 <400> 4 gactaaaagg tatgtgttgg tgtgaagaag aaagtggaag ggaagctggt gatggtgggt 60 tcgtctatcc cttttttata gttgcttgtt agtagggtac tctctaggga ctcgatgggg 120 gaaggttctt gatatttgct tagttcgaga aggttccaga tgagcgagac atttttggta 180 gcgacattgg gcttgatcga tgatgatctg cacgacattt tgtgttcttg cgacacgctg 240 cactaccaag tgtaatctgg ctgaacggat cacaagataa acctctgaaa aattatctca 300 gggcatgcaa caacaattat acatagaaga gggagtcacg atatacacct gtgaaggaat 360 catgtggtcg gctctccttg aactttgaat tcatgcaatt attaagaaga agcacaggtg 420 agcaacccac catacgttca tttgcaccac ctgatgatta aaagccaaag aaagaaaaaa 480 aaaaagaaac aggcggtggg aattgttaca acccacgcga acccgaaaat ggagcaatct 540 tccccggggc ctccaaatac caactcaccc gagagagaga aagagacacc acccaccacg 600 agacggagta tatccaccaa ggtaagtaac tcagggttaa tgatacaggt gtacacagct 660 ccttccctag ccattgagtg ggtatcacat gacactggca ggttacaacc acgtttagta 720 gttattttgt gcattccatg gggatcagga agtttggttt ggtgggtgcg tctactgatt 780 cccctttgtc tctgaaaatc ttttccctag tggaacactt tggctgaatg atataaattc 840 accttgattc ccaccctccc ttctttctct ctctctctgt tacacccaat tgaattttct 900 tttttttttt tactttccct ccttctttat catcaagata agtaagttta tcaattgcct 960 attcaga 967 <210> 5 <211> 967 <212> DNA <213> Artificial Sequence <220> <223> Promoter 2.1 <400> 5 gactaaaagc tatctgttgg tgtgaagaag aaagtggaag ggttgctggt gatggtgggt 60 tcgtctatcc cttttttata gttgcttgtt agtagggtac tctctaggga ctcgatgggc 120 cttggttctt gatatttgct tagttcgaga aggttccaga tgagcgagac atttttggta 180 gcgacaaagg gcttgatcga tgagtctctg cacgtgcttt tgtgttcttg cgacacgctg 240 ccctaccaac tgtaatcagg ttgaacggat cacaagataa acctctgaaa aattatctca 300 gggcatgcaa caacaattat acatataaca gggagtcaag atatacacct gtgaatgaat 360 catgtggtcg cctctccttg aactatgaat tcatgcaatt attatgaaga agcacaggtg 420 agcaacccac catacgttca tttgcaccac ctgatgatta aaagccaaag aaagaaaaaa 480 aaaaagaaac aggcggtttt aattcttaca acccacgcga acccgaaaat ggagcaatct 540 tcccggggcc ctccaaatac ttactcaccc gagagagaga aagagacacc acccaccacg 600 agacggagta tatccacgaa ggtaagtaac tcagggttaa tgatacaggt gtacacagct 660 ccttccctag ccattgagtg ggtatcacat gacactggca ggttacaacc acgtttagta 720 gttattttgt gcattccatg gggatgacga agtttggttt ggtgggtgcg tctactgatt 780 cccctttgtc tctgaaaatc ttttccctag tggaacactt tggctgaatg atataaatac 840 accttgattc ccaccctccc ttctttctct ctctctctgt tacacccaat tgaattttct 900 tttttttttt tactttccct ccttctttat catcaagata agtaagttta tcaattgcct 960 attcaga 967 <210> 6 <211> 132 <212> DNA <213> Artificial Sequence <220> <223> scRNA structural sequence <400> 6 gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60 ggcaccgagt cggtgcggga gcacatgagg atcacccatg tgcgactccc acagtcactg 120 gggagtcttc cc 132 <210> 7 <211> 239 <212> DNA <213> Artificial Sequence <220> <223> Promoter 3.0 <400> 7 ccctcgtttt gcccttctct ttttttttct tttctgctct gctggtctgt ttcctttgct 60 cttcgctgtt atcaaccggg caaacgtagt catttttttt tcgctcgtct ctcccttaga 120 gtttaccttc tcgttgatta aaagaaaaat tttcttccac tttttttttc tgattctgct 180 tttttccttt ccctttcttt tctttccttt gctctacaca tctaaagaaa taatcaatc 239 <210> 8 <211> 239 <212> DNA <213> Artificial Sequence <220> <223> Promoter 3.1 <400> 8 cactcgtatt gcccttctct tttattctct tctctgctgt gctggtctgt atcctttgct 60 ctacgctgat atcaaccggg caaacgtagt catttttttt tcgctcgtct ctcccttaga 120 gtttaccttc tcgttgatta aaagaaaaat tttcttggac tttttttttc tcattctgct 180 tttttccttt ccctttcttt tatatctttt gctctacaca tctaaagaaa taatcattc 239 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PXA1-1 <400> 9 actacaaaga agaagatgca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PXA1-2 <400> 10 aaagtcgatc tggcatgaaa 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AAT2-1 <400> 11 tcttattact gcgaaactgt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AAT2-2 <400> 12 aagaaaacgg gtaaactgta 20 <210> 13 <211> 5873 <212> DNA <213> Artificial Sequence <220> <223> pCIB2 <400> 13 gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 60 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct 120 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct 120 cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 180 cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 180 tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg aattcggtct 240 tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg aattcggtct 240 agtatgattg tcaataatga tgggtcatcg tttcctgatt cgacgttccc tgtggtgtcg 300 agtatgattg tcaataatga tgggtcatcg tttcctgatt cgacgttccc tgtggtgtcg 300 ttaaatagcc tgtctgaaat ctcctccatg attgtgttgg tgtgtgttgt ttgactttcc 360 ttaaatagcc tgtctgaaat ctcctccatg attgtgttgg tgtgtgttgt ttgactttcc 360 caattgctta catttttttc ttcaaggatt cgctccaaaa tagacagaaa ttatcgcgac 420 caattgctta catttttttc ttcaaggatt cgctccaaaa tagacagaaa ttatcgcgac 420 aagtcagacg aacgtcgcac gaggcgaacc aaattcttta gaagcatacg aaaactcact 480 aagtcagacg aacgtcgcac gaggcgaacc aaattcttta gaagcatacg aaaactcact 480 ttatttccat tagaagtatt aaattaacaa atatataata tacaggatac aaagtaaaag 540 ttatttccat tagaagtatt aaattaacaa atatataata tacaggatac aaagtaaaag 540 cacgcttaag caaccaaagc ggaagcggta gcggattcgt atttccagtt aggtggcaag 600 cacgcttaag caaccaaagc ggaagcggta gcggattcgt atttccagtt aggtggcaag 600 acagcgacgg ttctgtagta tctggccaat ctgtggattc tagattcaat caaaatcaat 660 acagcgacgg ttctgtagta tctggccaat ctgtggattc tagattcaat caaaatcaat 660 ctgaacttgg agtccttgtc ctttctgttt ctttccaagt gctttctgac agagacagcc 720 ctgaacttgg agtccttgtc ctttctgttt ctttccaagt gctttctgac agagacagcc 720 ttcttgatca agtagtacaa gtcttctggg atttctggag ccaaaccgtt ggatttcaag 780 ttcttgatca agtagtacaa gtcttctggg atttctggag ccaaaccgtt ggatttcaag 780 attctcaaga tcttgttacc agtgacaacc ttggcttggg aaacaccgtg agcatctctc 840 aagataacac caatttgaga tggagtcaaa ccctttctgg cgtacttgat gacttgttca 900 acaacttcgt cagaagacaa cttgaaccaa gatggagcgt ttcttgagta tggaagagcg 960 gaggaggaaa tacctttacc ctaaaataac aagagctaat gttagtaatt tgaaaaaaaa 1020 gacgttgagc acgcacaccc catccacccc acaggtgaaa cacatcaaac gtagcaagaa 1080 caatagttgg ccctcccgtc aagggggcag gtaattgtcc aagtacttta gaaaagtatg 1140 tttttaccca taagatgaac acacacaaac cagcaaaagt atcaccttct gcttttcttg 1200 gttgaggttc aaattatgtt tggcaataat gcagcgacaa tttcaagtac ctaaagcgta 1260 tatagtaaca attctaggtc tgtatagtcg accgtaggtg aatcgtttac tttaggcaag 1320 accttgtccc tgataaagcc aggttgtact ttctattcat tgagtgtcgt ggtggtggta 1380 gtggtggttg attgggctgt tgtggtagta gtagtggttg tgatttggaa catacagatg 1440 aatgcatacg acccatgatg actgatttgt ttctttattg agttgatggt aagaaagaga 1500 agaagaggag gtaaaaaggt ggtagagtga aaaatttttt tctcttaaaa gtgagagaga 1560 gaaagagaaa aatttcactg cgaaacaaat ggttggggac acgacttttt tcaggaattt 1620 ttactcgaag cgtatatgca ggaaagttgt tgttagggaa tatggagcca caagagagct 1680 gcgaattcga gctcggtacc cggggatcct ctagagtcga cctgcaggca tgcgaacccg 1740 aaaatggagc aatcttcccc ggggcctcca aataccaact cacccgagag agagaaagag 1800 acaccaccca ccacgagacg gagtatatcc accaaggtaa gtaactcagg gttaatgata 1860 caggtgtaca cagctccttc cctagccatt gagtgggtat cacatgacac tggtaggtta 1920 caaccacgtt tagtagttat tttgtgcaat tccatgggga tcaggaagtt tggtttggtg 1980 ggtgcgtcta ctgattcccc tttgtctctg aaaatctttt ccctagtgga acactttggc 2040 tgaatgatat aaattcacct tgattcccac cctcccttct ttctctctct ctctgttaca 2100 cccaattgaa ttttcttttt ttttttactt tccctccttc tttatcatca aagataagta 2160 agtttatcaa ttgcctattc agaatgaaaa agcctgaact caccgcgacg tctgtcgaga 2220 agtttctcat cgaaaagttc gacagcgtct ccgacctcat gcagctctcg gagggcgaag 2280 aatctcgtgc tttcagcttc gatgtaggag ggcgtggata tgtcctccgg gtaaatagct 2340 gcgccgatgg tttctacaaa gatcgttatg tttatcggca ctttgcatcg gccgcgctcc 2400 cgattccgga agtgcttgac attggggaat tcagcgagag cctcacctat tgcatctccc 2460 gccgtgcaca gggtgtcacg ttgcaagacc tccctgaaac cgaactcccc gctgttctcc 2520 agccggtcgc ggaggccatg gatgcgatcg ctgcggccga tcttagccag acgagcgggt 2580 tcggcccatt cggaccgcaa ggaatcggtc aatacactac atggcgtgat ttcatatgcg 2640 cgattgctga tccccatgtg tatcactggc aaactgtgat ggacgacacc gtcagtgcgt 2700 ccgtcgcgca ggctctcgat gagctcatgc tttgggccga ggactgcccc gaagtccggc 2760 acctcgtgca cgcggatttc ggctccaaca atgtcctcac ggacaatggc cgcataacag 2820 cggtcattga ctggagcgag gcgatgttcg gggattccca atacgaggtc gccaacatct 2880 tcttctggag gccgtggttg gcttgtatgg agcagcagac gcgctacttc gagcggaggc 2940 atccggagct tgcaggatcg ccgcggctcc gggcgtatat gctccgcatt ggtcttgacc 3000 aactctatca gagcttggtt gacggcaatt tcgatgatgc agcttgggcg cagggtcgat 3060 gcgacgcaat cgtccgatcc ggagccggga ctgtcgggcg tacacaaatc gcccgcagaa 3120 gcgcggccgt ctggaccgat ggctgtgtag aagtactcgc cgatagtgga aaccgacgcc 3180 ccagcactcg tccgagggca aaggaatagt gtgctaccca cgcttactcc accagagcta 3240 ttaacatcag aaatatttat tctaataaat aggatgcaaa aaaaaaaccc cccttaataa 3300 aaaaaaaaga aacgattttt tatctaatga agtctatgta tctaacaaat gtatgtatca 3360 atgtttattc cgttaaacaa aaatcagtct gtaaaaaagg ttctaaataa atattctgtc 3420 tagtgtacac attctcccaa aatagtgaaa tccagctgct agcgtgtaag cttggcactg 3480 gccgtcgttt tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt 3540 gcagcacatc cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct 3600 tcccaacagt tgcgcagcct gaatggcgaa tggcgcctga tgcggtattt tctccttacg 3660 catctgtgcg gtatttcaca ccgcatatgg tgcactctca gtacaatctg ctctgatgcc 3720 gcatagttaa gccagccccg acacccgcca acacccgctg acgcgccctg acgggcttgt 3780 ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg catgtgtcag 3840 aggttttcac cgtcatcacc gaaacgcgcg agacgaaagg gcctcgtgat acgcctattt 3900 ttataggtta atgtcatgat aataatggtt tcttagacgt caggtggcac ttttcgggga 3960 aatgtgcgcg gaacccctat ttgtttattt ttctaaatac attcaaatat gtatccgctc 4020 atgagacaat aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt 4080 caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct 4140 cacccagaaa cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt 4200 tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt 4260 tttccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtattgac 4320 gccgggcaag agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac 4380 tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct 4440 gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg 4500 aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg 4560 gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat gcctgtagca 4620 atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa 4680 caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt 4740 ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc 4800 attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg 4860 agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt 4920 aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga tttaaaactt 4980 catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc 5040 ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct 5100 tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta 5160 ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc 5220 ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac 5280 ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct 5340 gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat 5400 aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg 5460 acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac gcttcccgaa 5520 gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg 5580 gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga 5640 cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc 5700 aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat gttctttcct 5760 gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc tgataccgct 5820 cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga aga 5873
Claims
1. Application of a CRISPRa gene activation system in Candida viswanathii ( Candida viswanathii ); The CRISPRa gene activation system includes: a dCas9 expression cassette, a scRNA expression cassette, and an activator expression cassette; wherein: The dCas9 expression cassette consists of the dCas9 gene and a first promoter upstream thereof. The nucleotide sequence of the dCas9 gene is as shown in SEQ ID NO: 1, and the nucleotide sequence of the first promoter is as shown in SEQ ID NO: 2; The scRNA expression cassette consists of the nucleotide sequence encoding the scRNA and a third promoter upstream thereof. The nucleotide sequence of the third promoter is as shown in SEQ ID NO: 7; The activator expression cassette consists of the activator gene and a second promoter upstream thereof. The nucleotide sequence of the second promoter is as shown in SEQ ID NO: 4; The nucleotide sequence of the activator gene is as shown in SEQ ID NO: 3; The nucleotide sequence encoding the scRNA includes a recognition sequence and a structural sequence; the recognition sequence is a PAM sequence within 250 bases of the transcription start of the target gene; the structural sequence is as shown in SEQ ID NO: 6; The PAM sequence is a sequence complementary to 20 bases upstream of the NGG sequence.
2. The application according to claim 1, characterized in that, The recognition sequence is as shown in any one of SEQ ID NOs: 9 to 12.
3. The application according to claim 1, characterized in that The Candida viswanathii is a strain with the preservation number of CCTCC: M2020048.
4. The application according to any one of claims 1 to 3, characterized in that, The dCas9 expression cassette is integrated into the chromosome of the Candida viswanathii.
5. A CRISPRa gene activation system, characterized in that, The CRISPRa gene activation system includes: a dCas9 expression cassette, an scRNA expression cassette, and an activator expression cassette; wherein: The dCas9 expression cassette consists of the dCas9 gene and a first promoter upstream thereof. The nucleotide sequence of the dCas9 gene is as shown in SEQ ID NO: 1, and the nucleotide sequence of the first promoter is as shown in SEQ ID NO: 2; The scRNA expression cassette consists of the nucleotide sequence encoding the scRNA and a third promoter upstream thereof. The nucleotide sequence of the third promoter is as shown in SEQ ID NO: 7; The activator expression cassette consists of the activator gene and a second promoter upstream thereof. The nucleotide sequence of the second promoter is as shown in SEQ ID NO: 4; The nucleotide sequence of the activator gene is as shown in SEQ ID NO: 3; The nucleotide sequence encoding the scRNA includes a recognition sequence and a structural sequence; the recognition sequence is a PAM sequence within 250 bases of the transcription start of the target gene; the structural sequence is as shown in SEQ ID NO: 6; The PAM sequence is a sequence complementary to 20 bases upstream of the NGG sequence.
6. The CRISPRa gene activation system according to claim 5, wherein The recognition sequence is as shown in any one of SEQ ID NOs: 9 to 12.
7. A genetically engineered bacterium, characterized in that, The genetically engineered bacterium expresses the CRISPRa gene activation system as described in claim 5 or 6, and the starting bacterium of the genetically engineered bacterium is Candida viswanathii ( Candida viswanathii ).
8. The genetically engineered bacterium according to claim 7, wherein, The Candida viswanathii is a strain with the preservation number of CCTCC: M2020048.
9. A method for enhancing gene expression in Candida viswanathii, characterized in that, The method includes: (1) Making the Candida viswanathii contain the dCas9 expression cassette in the CRISPRa gene activation system as claimed in claim 5 or 6; (2) Design the scRNA expression cassette and the activator expression cassette in the CRISPRa gene activation system as described in claim 5 or 6 according to the target gene whose expression is to be enhanced, and introduce them into the Candida viswanathii, thus obtaining the product.
10. The method according to claim 9, wherein The Candida viswanathii is the strain with the preservation number of CCTCC: M2020048.
11. A recombinant vector combination, characterized in that, The recombinant vector combination includes a dCas9 recombinant vector encoding the nucleic acid of the dCas9 gene and the first promoter upstream thereof; and a composite recombinant vector encoding the nucleic acid of the scRNA and the nucleic acid of the third promoter upstream thereof, and the nucleic acid of the activator gene and the second promoter upstream thereof; or, The recombinant vector combination includes a dCas9 recombinant vector encoding the nucleic acid of the dCas9 gene and the first promoter upstream thereof, an scRNA recombinant vector encoding the nucleic acid of the scRNA and the nucleic acid of the third promoter upstream thereof, and an activator recombinant vector encoding the nucleic acid of the activator gene and the second promoter upstream thereof; The nucleotide sequence of the dCas9 gene is as shown in SEQ ID NO: 1; the scRNA is the scRNA in the CRISPRa gene activation system as described in claim 5 or 6; The nucleotide sequence of the first promoter is as shown in SEQ ID NO: 2, the nucleotide sequence of the third promoter is as shown in SEQ ID NO: 7, and the nucleotide sequence of the second promoter is as shown in SEQ ID NO: 4; The nucleotide sequence of the activator gene is as shown in SEQ ID NO: 3.
Citation Information
Patent Citations
Candida viswanathii and application thereof
CN111748480A
Efficient transcriptional activation system in reproductive system of drosophila
CN109517840A