CRISPRi gene inhibition system, genetically engineered bacteria containing the same, and applications thereof
By applying the CRISPRi gene inhibition system in Candida Visces, the CRISPR complex of dCas9 protein and sgRNA blocked RNA polymerase transcription, solving the irreversible changes caused by gene knockdown in the prior art, and achieving the effect of flexible control of gene expression.
Patent Information
- Application Number
- CN202111223619.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-10-20
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2041-10-20
AI Technical Summary
The lack of methods in the prior art that can flexibly inhibit the gene expression of Candida Visce without destroying the gene sequence of interest, resulting in the gene knockout tool irreversible changes in strain growth and metabolism, and the inability to study key genes.
The CRISPRi gene inhibition system is adopted to block the transcription process of RNA polymerase at specific locations in the genome by the CRISPR complex composed of dCas9 protein and sgRNA, and select appropriate promoters and PAM sequences for precise inhibition to avoid gene sequence destruction.
It realizes flexible control of gene expression in Candida Visces, avoids the damage caused by gene knockout, provides a flexible, efficient and controllable gene expression regulation tool, and solves the problem of long gene knockout cycle.
Smart Images

Figure BDA0003313489870000091 
Figure BDA0003313489870000101 
Figure BDA0003313489870000102
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of bioengineering, and specifically relates to a CRISPRi gene inhibition system, a genetically engineered bacterium containing the same, and applications thereof. Background Art
[0002] Candida viswanathii is a fungus native to oil fields that has the ability to degrade crude oil. It has extremely high utilization value in the field of industrial biology. By modifying the metabolic pathway of Candida viswanathii, it can be used to synthesize long-chain dibasic acids using alkanes as substrates. For example, Pictaggio et al. (Mol. Cell. Biol., 11(9), 4333-4339, 1991) reported that knocking out two alleles of POX4 and POX5 can effectively block the β-oxidation pathway, thereby achieving a 100% conversion rate of the substrate. Therefore, Candida viswanathii is considered a microorganism with important industrial value.
[0003] We need to modify the genome and gene expression process of Candida visweiss to achieve the goal of controlling the product metabolic pathway. In many cases, we need to knock out or inhibit genes that affect the expression of the final product. For example: in the metabolic pathway of long-chain dicarboxylic acids, β-oxidation decomposes the intermediate products of alkane synthesis into carbon dioxide, so it is necessary to block the genes involved in the β-oxidation process. In model organisms commonly used in the laboratory, there are many methods to block gene expression, but because the applicability of general tools in model organisms varies greatly in other microorganisms, gene regulation tools need to be developed for different chassis microorganisms. At present, in Candida, the tools for blocking gene expression are limited to gene knockout. The method of homologous recombination of linear DNA fragments has been mentioned in many literatures. Lombardi et al. (mSphere. 2019 Mar 13; 4 (2): e00125-19) also reported a gene editing method using CRISPR-Cas9 (Clustered Regularly-Interspaced Short Palindromic Repeats-Cas9). However, gene knockout tools completely destroy the sequence of the target gene, causing irreversible changes in the microbial genome and metabolism. This problem can prevent us from studying some key essential genes, as knocking out essential genes can render the strain incapable of growth, leading to editing failure. This also provides research value for developing controllable gene suppression systems.
[0004] In addition to gene knockout, many controllable gene suppression systems have been reported in model microorganisms, such as RNAi, TAL-effector systems, etc. However, compared with the above systems, CRISPR interference (CRISPRi) technology has obvious advantages. CRISPRi gene suppression technology is derived from CRISPR-Cas gene editing technology, and its main components, Cas9 protein, are basically the same as sgRNA. Cas9 protein is a protein with DNA binding ability and DNA endonuclease activity. sgRNA (small guide RNA) is a small RNA with a fixed secondary structure region and a variable 20-base recognition sequence. Its secondary structure domain can bind to the Cas9 protein to form a CRISPR complex. The 20-base recognition sequence can recognize and bind to the complementary sequence in the genome and accurately locate the Cas9 protein in a specific area of the genome. Unlike the CRISPR-Cas editing system, Qi et al. (Cell. 2013 Feb 28; 152(5): 1173-83.) mentioned that Jinek et al. found two point mutations, D10A and H840A, in the active site of the Cas9 protein in S. pyogenes, and created a mutant dCas9 (dead Cas9) protein. dCas9 no longer has DNA endonuclease activity but still retains the ability to bind to DNA, allowing it to bind to specific locations in the genome through the guidance of sgRNA. When the CRISPRi complex binds to the open reading frame of an endogenous gene, the CRISPRi complex can physically block the transcription process of RNA polymerase, thereby inhibiting gene transcription and ultimately inhibiting gene expression.
[0005] Compared to gene knockout, CRISPRi can flexibly inhibit the expression of the target gene without destroying its sequence. And according to the adjustment of the binding site, it can partially or completely inhibit the expression of the target gene, which makes it easier for us to study essential genes. Compared with RNAi, CRISPRi has lower off-target effects and can more accurately guide and control the target gene. Compared with DNA-binding proteins (such as TAL-effector), CRISPRi is more efficient due to the inhibitory effect of RNA-DNA complementary sequences. In summary, CRISPRi technology is a gene inhibition method with advantages in many aspects. The development of the CRISPRi system in Candida visweiss is of great significance for gene regulation in this strain. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to overcome the deficiency of the prior art in the lack of Candida vesiculosus that can flexibly inhibit the expression of the target gene without destroying its sequence, and to provide a CRISPRi gene inhibition system, a genetically engineered bacterium containing the same, and its application. The CRISPRi gene inhibition system of the present invention can flexibly inhibit the expression of the target gene without destroying its sequence through the selection of promoters, and can flexibly control the inhibition effect.
[0007] The present invention solves the above technical problems through the following technical solutions:
[0008] The first aspect of the present invention provides an application of a CRISPRi gene inhibition system in Candida viswanathii; in particular, an application in inhibiting the expression of a target gene in Candida viswanathii;
[0009] The CRISPRi gene inhibition system comprises: a dCas9 expression cassette and an sgRNA expression cassette; wherein: the dCas9 expression cassette includes the dCas9 gene and a first upstream promoter thereof, and the nucleotide sequence of the first promoter is shown in SEQ ID NO: 3; the sgRNA expression cassette includes a nucleotide sequence encoding the sgRNA and a second upstream promoter thereof, and the nucleotide sequence of the second promoter is shown in SEQ ID NO: 4 or SEQ ID NO: 5; the dCas9 gene encodes the amino acid sequence shown in SEQ ID NO: 1.
[0010] In some embodiments of the present invention, the nucleotide sequence of the dCas9 gene is shown in SEQ ID NO: 2.
[0011] In some embodiments of the present invention, the nucleotide sequence encoding the sgRNA comprises a recognition sequence and a structural sequence; the recognition sequence is a sequence complementary to a PAM sequence within 250 bases of the transcription start of the target gene, for example, 20 bases upstream of the NGG sequence; the structural sequence is shown in SEQ ID NO: 9.
[0012] It should be understood by those skilled in the art that, in the present invention, the target gene is the gene whose expression is to be inhibited by the CRISPRi gene inhibition system.
[0013] In some specific embodiments of the present invention, the recognition sequence is shown as SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8.
[0014] In some specific embodiments of the present invention, the Candida visweiss is a strain with the deposit number of CCTCC: M2020048.
[0015] In some embodiments of the present invention, the dCas9 expression cassette is integrated into the chromosome of the Candida visweissii.
[0016] A second aspect of the present invention provides a CRISPRi gene inhibition system, which comprises: a dCas9 expression cassette and an sgRNA expression cassette; wherein: the dCas9 expression cassette includes the dCas9 gene and a first upstream promoter thereof, the nucleotide sequence of the first promoter is shown in SEQ ID NO: 3, the sgRNA expression cassette includes a nucleotide sequence encoding the sgRNA and a second upstream promoter thereof, the nucleotide sequence of the second promoter is shown in SEQ ID NO: 4 or SEQ ID NO: 5; the dCas9 gene encodes the amino acid sequence shown in SEQ ID NO: 1.
[0017] In some embodiments of the present invention, the nucleotide sequence encoding the dCas9 is shown in SEQ ID NO: 2.
[0018] In some embodiments of the present invention, the nucleotide sequence encoding the sgRNA comprises a recognition sequence and a structural sequence; the recognition sequence is a sequence complementary to the 20 bases upstream of the NGG sequence within 250 bases of the transcription start of the target gene; the structural sequence is shown in SEQ ID NO:9.
[0019] In some specific embodiments of the present invention, the recognition sequence is shown as SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8.
[0020] The third aspect of the present invention provides a genetically engineered bacterium, wherein the genetically engineered bacterium expresses the CRISPRi gene inhibition system as described in the second aspect, and the starting strain of the genetically engineered bacterium is Candida viswanathii.
[0021] In some embodiments of the present invention, the Candida visweiss is a strain with the deposit number of CCTCC: M2020048.
[0022] A fourth aspect of the present invention provides a method for inhibiting gene expression in Candida visweiss, the method comprising:
[0023] (1) allowing the Candida visweissii to contain the dCas9 expression cassette in the CRISPRi gene inhibition system described in the second aspect;
[0024] (2) According to the target gene to be inhibited, the sgRNA expression cassette in the CRISPRi gene inhibition system described in the second aspect is designed and introduced into the Candida visweiss.
[0025] The fifth aspect of the present invention provides a promoter combination, comprising a first promoter having a nucleotide sequence as shown in SEQ ID NO: 3, and a second promoter having a nucleotide sequence as shown in SEQ ID NO: 4 or SEQ ID NO: 5.
[0026] In some specific embodiments of the present invention, the first promoter with the nucleotide sequence shown in SEQ ID NO: 3 is promoter 1.0, and the second promoter with the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5 is promoter 2.0 and promoter 2.1, respectively.
[0027] A sixth aspect of the present invention provides a recombinant vector combination, comprising a dCas9 recombinant vector encoding a dCas9 nucleic acid and an sgRNA recombinant vector encoding an sgRNA nucleic acid;
[0028] The amino acid sequence of the dCas9 is shown in SEQ ID NO: 1; the sgRNA is the sgRNA described in the second aspect.
[0029] In some embodiments of the present invention, the backbone plasmid of the dCas9 recombinant vector or sgRNA recombinant vector is selected from pUC18, pUC19, pBR322, pACYC, pET, pSC101 and their derivative plasmids.
[0030] In some specific embodiments of the present invention, the backbone plasmid of the sgRNA recombinant vector is pCIB2, and its nucleotide sequence is shown in SEQ ID NO:10.
[0031] In the present invention, the CRISPRi gene inhibition system includes two parts, dCas9 protein and sgRNA, which need to be expressed simultaneously in the chassis bacteria (i.e., Candida visweissii). When the CRISPRi gene inhibition system is correctly expressed in Candida visweissii, the dCas9 protein will be guided into the cell nucleus by a PAM (Protospace adjacent motif) sequence that allows it to recognize the 5' end upstream of the 20bp target site in the genome. The sgRNA binds to dCas9 through the binding domain of dCas9 to form a CRISPR complex. The CRISPR complex will find its complementary sequence in the genome through the 20bp recognition sequence of the sgRNA and anchor the CRISPR complex in the expression frame of the target gene.
[0032] In the present invention, the PAM sequence is conventional in the art, i.e., NGG.
[0033] After anchoring, the CRISPR complex will tightly bind to the DNA double strands of the target gene. When the target gene is transcribed, the first anchored CRISPR complex will block the binding of RNA polymerase to DNA, reduce the transcription level, and thus inhibit the expression of the target gene.
[0034] In this study, the dCas9 protein, a mutant of the S. pyogenes Cas9 protein with two point mutations, D10A and H840A, was expressed under the primary promoter of Candida visenbergii. The expression cassette was flanked by homology arms to the Candida visenbergii γ integration site and constructed into an ampicillin-labeled cloning vector. This integration plasmid was linearized by enzyme digestion and inserted into the Candida visenbergii γ integration site using CRISPR-Cas9 editing to generate a dCas9-expressing strain.
[0035] In the present invention, the sgRNA contains the full domain of the 20bp recognition sequence in the plasmid vector. Due to its variability, the 20bp sequence is represented by 20 "N" bases. The subsequent sequence is the unique structural sequence of the sgRNA.
[0036] On the basis of conforming to the common sense in this field, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.
[0037] The reagents and raw materials used in the present invention are commercially available.
[0038] The positive progress effect of the present invention is:
[0039] The CRISPRi gene inhibition system of the present invention can flexibly inhibit the expression of the target gene in Candida visweiss through the selection of promoters without destroying the target gene sequence, and can flexibly control the inhibition effect, enriching the means of regulating gene expression; it can circumvent the drawbacks of traditional gene modification methods and avoid the complete destruction of the target gene and the cell physiological function network caused by gene knockout. At the same time, the CRISPRi gene inhibition system of the present invention is a flexible, efficient and controllable tool for gene expression regulation, which can quickly introduce regulatory elements to inhibit multiple different target genes, solve the problem of long gene knockout cycle, and solve the problem of inhibiting essential genes that cannot be achieved by gene knockout. DETAILED DESCRIPTION
[0040] The present invention is further illustrated by way of examples below, but the present invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.
[0041] The Candida visweiss strain used in the examples has a deposit number of CCTCC: M2020048, and the culture method is described in CN111748480A.
[0042] The gene synthesis method and PCR amplification method used in the examples are conventional in the art.
[0043] Gibson recombinant (Thermo-Invitrogen GeneArt TM Gibson Assembly HiFi reagent master mix A46629) method and transformation method (see Molecular Cloning: A Laboratory Manual) are routine in the art.
[0044] The plasmid recovery kit used in the embodiment is AxyPrep Plasmid Miniprep KitAP-MN-P-250.
[0045] The ScaI restriction endonuclease used in the examples was Thermo FastDigest ScaI FD0434.
[0046] The Escherichia coli used in the examples was Top10.
[0047] Example 1 Construction of CRISPRi gene inhibition system expression strain
[0048] Step 1: Construction of dCas9 integration expression strain
[0049] 1. Amplify the dCas9 gene fragment shown in SEQ ID NO: 2 and the promoter 1.0 fragment shown in SEQ ID NO: 3 by PCR.
[0050] 2. Using the Gibson recombination method, the plasmid vector pUC19, dCas9 gene fragment, promoter 1.0 fragment and Gibson recombinase premix were mixed and assembled in a volume ratio of 1:0.75:0.75:2.5, and incubated at 50°C for 15-30 minutes to obtain dCas9 recombinant plasmid.
[0051] 3. The obtained dCas9 recombinant plasmid was chemically transformed into E. coli. The transformed bacteria were spread on LB plates containing 40 μg / mL ampicillin and cultured at 37°C overnight.
[0052] 4. Pick a single colony from the plate and transfer it to 5 mL LB + 40 μg / mL ampicillin liquid medium. After overnight shaking culture, use a plasmid recovery kit to extract the plasmid and harvest the purified dCas9 integrated plasmid.
[0053] 5. Use ScaI restriction endonuclease to digest the dCas9 integration plasmid to obtain a linearized dCas9 integration plasmid, which can be used for transformation and integration.
[0054] 6. Prepare competent cells: streak and pick a single clone of Candida visweiss strain, culture in YPD medium at 30℃ with shaking for 24 hours, dilute it at a ratio of 1:200 and culture overnight for 16 hours.
[0055] 7. Use a spectrophotometer to measure the OD value of the bacterial solution. When the OD value reaches approximately 2, prepare the competent cells for electroporation. Transfer 80 μL of the competent cells to a 2 mm gap electroporation cuvette and add the dCas9 integration plasmid linearized with the pCas9 CRISPR editing plasmid. Perform electroporation at 2.4 kV. After electroporation, evenly spread the cells on a YPD plate containing 100 μg / mL nourseothricin resistance and incubate at 30°C for 3-6 days.
[0056] 8. Pick a single colony from the plate and transfer it to a YPD plate containing 100 μg / mL nourseothricin resistance. If no bacteria grow, it indicates that the pCas9 CRISPR plasmid has been completely lost. After verification, the dCas9 integrated expression strain is obtained.
[0057] Step 2: Construction of sgRNA plasmid
[0058] 1. Identify and locate the target gene to be activated in the Candida visenbergii genomic sequence and search for the NGG PAM sequence within 250 bp from the initiation codon ATG within the target gene's expression frame. Select 20 bp upstream of the found PAM sequence as the sgRNA recognition sequence.
[0059] 2. Amplify by PCR the sgRNA fragments containing the recognition sequences and universal structures shown in SEQ ID NOs: 6, 7, and 8, the promoter 2.0 fragment shown in SEQ ID NO: 4, and the promoter 2.1 fragment shown in SEQ ID NO: 5.
[0060] 3. Using the Gibson recombination method, the sgRNA fragment was mixed with the promoter 2.0 fragment or promoter 2.1 fragment, the plasmid vector pCIB2, and the Gibson recombinase premix at a volume ratio of 1:1.5:2.5, and assembled. The mixture was incubated at 50°C for 15-30 minutes to obtain two sgRNA recombinant plasmids corresponding to the promoter 2.0 fragment and the promoter 2.1 fragment.
[0061] 4. The sgRNA recombinant plasmid obtained in step 3 was transformed into Escherichia coli by chemical transformation. The transformed bacteria were spread on LB plates containing 40 μg / mL ampicillin antibiotics and cultured overnight.
[0062] 5. Pick a single colony from the plate and transfer it to 5 mL LB + 40 μg / mL ampicillin liquid medium. After overnight shaking culture, use a plasmid recovery kit to extract the plasmid and harvest the purified sgRNA plasmid.
[0063] Step 3: Transformation of sgRNA plasmid
[0064] 1. Streak the dCas9 integration expression strain obtained in the first step on a YPD plate, pick a single clone, and culture it in a seed shake flask containing YPD at 30°C with shaking for 24 hours.
[0065] 2. Dilute the bacteria from the seed shake flask at a ratio of 1:200 and transfer to a shake flask containing YPD and culture overnight for 16 hours.
[0066] 3. For other steps, refer to step 7 of step 1. Harvest the bacterial culture and prepare competent cells. Use electroporation to transform the sgRNA recombinant plasmid into competent cells and culture on YPD plates at 30°C to obtain single colonies.
[0067] 4. Pick out the single clones from the plate and proceed to the next step of screening and verification.
[0068] Example 2 Verification of the effectiveness of the CRISPRi gene inhibition system
[0069] According to Example 1, the dCas9 expression cassette was inserted into the Candida visenbergii strain expressing the RFP fluorescent protein to construct a dCas9 integrated expression strain. The sgRNA site was found within the RFP expression cassette according to the aforementioned site selection principles. The 20 bp recognition sequence of the sgRNA site was:
[0070] Recognition sequence 1: agataacatggctattatta (SEQ ID NO: 6);
[0071] Recognition sequence 2: gaagatttgaacaatgttag (SEQ ID NO: 7);
[0072] Recognition sequence 3: tggagttgattttatatcaa (SEQ ID NO: 8).
[0073] Based on the recognition sequences described above, sgRNA recombinant plasmids were constructed as shown in Table 1 and transformed into the dCas9 integration expression strains described above. Three RFP-suppressing strains (strains A–I) containing the CRISPRi gene inhibition system were obtained for each sgRNA recombinant plasmid. Fluorescence values were measured using a microplate reader to evaluate the expression of the RFP gene after CRISPRi regulation. A control strain containing RFP, dCas9, and an sgRNA with a non-recognition sequence was used. The results are shown in Table 2.
[0074] Table 1 Configuration of CRISPRi gene inhibition system components
[0075]
[0076]
[0077] Table 2 Expression levels of strains
[0078]
[0079] The results show that regardless of whether sgRNA is expressed by promoter 2.0 or promoter 2.1, the three RFP recognition sequences all inhibit gene expression through CRISPRi, and the effect of promoter 2.0 is better. SEQUENCE LISTING <110> Shanghai Cathay Biotechnology Co., Ltd. CIBT USA <120> CRISPRi gene inhibition system, genetically engineered bacteria containing the same, and applications thereof <130> P21015930C <160> 10 <170> PatentIn version 3.5 <210> 1 <211> 1417 <212> PRT <213> Artificial Sequence <220> <223> dCas9 <400> 1 Met Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 1 5 10 15 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 20 25 30 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Asn Leu Ile 35 40 45 Gly Ala Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 50 55 60 Lys Arg Thr Ala Arg Arg Tyr Thr Arg Arg Lys Asn Arg With Cys 65 70 75 80 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Ser 85 90 95 Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 100 105 110 His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr 115 120 125 His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Leu Val Asp 130 135 140 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 145 150 155 160 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 165 170 175 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 180 185 190 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 195 200 205 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 210 215 220 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 225 230 235 240 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 245 250 255 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 260 265 270 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 275 280 285 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 290 295 300 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 305 310 315 320 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 325 330 335 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 340 345 350 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 355 360 365 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 370 375 380 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg 385 390 395 400 Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu 405 410 415 Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe 420 425 430 Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 435 440 445 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 450 455 460 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 465 470 475 480 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 485,490,495 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 500 505 510 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Thr Lys Val Lys 515,520,525 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 530 535 540 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 545 550 555 560 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Ile Glu Cys Phe Asp 565,570,575 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 580,585,590 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 595,600,605 Asn Glu Glu Asn Glu Asp With Glu Asp With Val With Thr With Thr 610 615 620 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 625 630 635 640 His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 645 650 655 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 660 665 670 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 675 680 685 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 690 695 700 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 705 710 715 720 His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly 725 730 735 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 740 745 750 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 755 760 765 Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile 770 775 780 Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro 785 790 795 800 Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 805 810 815 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 820 825 830 Leu Ser Asp Tyr Asp Val Asp Ala Ile Val Pro Gln Ser Phe Leu Lys 835 840 845 Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg 850 855 860 Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys 865 870 875 880 Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys 885 890 895 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 900 905 910 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 915 920 925 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 930 935 940 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 945 950 955 960 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 965 970 975 Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 980 985 990 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe 995 1000 1005 Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala 1010 1015 1020 Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe 1025 1030 1035 Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1040 1045 1050 Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu 1055 1060 1065 Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val 1070 1075 1080 Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr 1085 1090 1095 Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys 1100 1105 1110 Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro 1115 1120 1125 Light Light Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val 1130 1135 1140 Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys 1145 1150 1155 Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser 1160 1165 1170 Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys 1175 1180 1185 Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu 1190 1195 1200 Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly 1205 1210 1215 Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1220 1225 1230 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser 1235 1240 1245 Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys 1250 1255 1260 His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys 1265 1270 1275 Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1280 1285 1290 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn 1295 1300 1305 Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala 1310 1315 1320 Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser 1325 1330 1335 Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr 1340 1345 1350 Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp 1355 1360 1365 Glu Gly Ala Asp Pro Lys Lys Lys Arg Lys Val Asp Pro Lys Lys 1370 1375 1380 Lys Arg Lys Val Asp Pro Lys Lys Lys Arg Lys Val Asp Tyr Lys 1385 1390 1395 Asp His Asp Gly Asp Tyr Lys Asp His Asp Ile Asp Tyr Lys Asp 1400 1405 1410 Asp Asp Asp Lys 1415 <210> 2 <211> 4119 <212> DNA <213> Artificial Sequence <220> <223> dCas9 <400> 2 atggacaaga agtactccat cggtttggcc atcggtacta actcagttgg ttgggccgtt 60 atcaccgacg aatacaaggt cccatccaag aagttcaagg tcttgggtaa caccgaccgt 120 cactccatca agaagaactt gatcggtgcc ttgttgttcg actcaggtga aaccgccgaa 180 gctaccagat tgaagagaac cgccagaaga cgttacaccc gtcgtaagaa ccgtatctgt 240 tacttgcaag aaatcttctc caacgaaatg gctaaggttg acgactcctt cttccacaga 300 ttggaagaat ccttcttggt cgaagaagac aagaagcacg aacgtcaccc aatcttcggt 360 aacatcgttg atgaagtcgc ttaccacgaa aagtacccaa ccatctacca cttgcgtaag 420 aagttggtcg attccaccga taaggccgat ttgcgtttga tctacttggc cttggcccac 480 atgatcaagt tcagaggtca cttcttgatc gaaggtgact tgaacccaga caactccgac 540 gttgataagt tgttcatcca attggtccaa acctacaacc aattgttcga agaaaaccca 600 atcaacgctt caggtgttga tgctaaggct attttgtccg ctcgtttgtc caagtcccgt 660 agattggaaa acttgatcgc ccaattgcca ggtgaaaaga agaacggttt gttcggtaac 720 ttgatcgcct tgtccttggg tttgacccca aacttcaagt ccaacttcga cttggccgaa 780 gacgccaaat tgcaattgtc caaggacacc tacgacgacg acttggacaa cttgttggcc 840 caaatcggtg accaatacgc cgacttgttc ttggccgcta aaaacttgtc cgacgctatc 900 ttgttgtccg acatcttgag agtcaacacc gaaatcacta aggctccatt gtccgcttcc 960 atgatcaagc gttacgacga acaccaccaa gacttgacct tgttgaaggc cttggtccgt 1020 caacaattgc cagaaaagta caaggaaatc ttcttcgacc aatccaagaa cggttacgcc 1080 ggttacattg acggtggtgc ttcccaagaa gaattctaca agttcatcaa gccaatcttg 1140 1200 aagcaacgta ccttgcaa cggttccatc ccacaccaaa tccacttggg tgaattgcac 1260 gccatcttgc gtcgtcaaga agacttctac ccattcttga aggacaaccg tgaaaagatc 1320 gaaaagatct tgaccttccg tatcccatac tacgtcggtc cattggctag aggtaactcc 1380 agattcgctt ggatgacccg taagtccgaa gaaaccatca ccccatggaa cttcgaagaa 1440 gttgttgata agggtgcttc cgctcaatcc ttcatcgaac gtatgaccaa cttcgacaag 1500 aacttgccaa acgaaaaggt cttgccaaag cactccttgt tgtacgaata cttcaccgtc 1560 tacaacgaat tgaccaaggt caagtacgtc accgaaggta tgcgtaagcc agctttcttg 1620 tccggtgaac aaaagaaggc catcgttgat ttgttgttca agaccaaccg taaggtcacc 1680 gtcaagcaat tgaaggaaga ctacttcaag aagatcgaat gtttcgactc cgtcgaaatc 1740 tcaggtgtcg aagacagatt caacgcttcc ttgggtactt accacgactt gttgaagatc 1800 atcaaggaca aggacttctt ggacaacgaa gaaaacgaag acatcttgga agacatcgtc 1860 ttgaccttga ccttgttcga agacagagaa atgatcgaag aacgtttgaa gacctacgcc 1920 cacttgttcg acgacaaggt catgaagcaa ttgaagcgtc gtagatacac cggttggggt 1980 agattgtccc gtaagttgat caacggtatc agagacaagc aatccggtaa gaccatcttg 2040 gacttcttga agtcagacgg tttcgccaac cgtaacttca tgcaattgat ccacgacgac 2100 tccttgacct tcaaggaaga catccaaaag gcccaagttt ccggtcaagg tgattccttg 2160 cacgaacaca tcgctaattt ggccggttct ccagccatca agaagggtat cttgcaaacc 2220 gtcaaggtcg ttgatgaatt ggttaaggtc atgggtcgtc acaagccaga aaacatcgtc 2280 atcgaaatgg ccagagaaaa ccaaaccacc caaaagggtc aaaagaactc cagagaacgt 2340 atgaagcgta tcgaagaagg tatcaaggaa ttgggttccc aaatcttgaa ggaacaccca 2400 gtcgaaaaca cccaattgca aaacgaaaag ttgtacttgt actacttgca aaacggtaga 2460 gacatgtacg ttgatcaaga attggacatc aaccgtttgt ccgactacga cgttgacgcc 2520 atcgtcccac aatccttctt gaaggacgac tccatcgaca acaaggtctt gaccagatcc 2580 gacaagaaca gaggtaagtc cgacaacgtc ccatccgaag aagtcgtcaa gaagatgaag 2640 aactactggc gtcaattgtt gaacgccaag ttgatcaccc aacgtaagtt cgacaacttg 2700 accaaggccg aaagaggtgg tttgtcagaa ttggacaagg ccggtttcat caagcgtcaa 2760 ttggtcgaaa cccgtcaaat caccaagcac gtcgctcaaa tcttggactc ccgtatgaac 2820 accaagtacg acgaaaacga caagttgatc agaaagtca aggtcatcac cttgaagtcc 2880 aagttggtct ccgacttccg taggacttc caattctaca aggtccgtga aatcaacaac 2940 taccaccacg ctcacgacgc ttatttgaac gccgttgttg gtactgcttt gatcaagaag 3000 tacccaaagt tggaatccga attcgtctac ggtgactaca aggtctacga cgtcagaaag 3060 atgatcgcca agtccgaaca agaaatcggt aaggctaccg ccaagtactt cttctactcc 3120 aacatcatga acttcttcaa gaccgaaatc accttggcca acggtgaaat ccgtaagcgt 3180 ccattgatcg aaaccaacgg tgaaaccggt gaaatcgttt gggacaaggg tagagacttc 3240 gctaccgtta gaaaggtctt gtccatgcca caagtcaaca tcgtcaagaa gaccgaagtc 3300 caaaccggtg gtttctccaa ggaatccatc ttgccaaagc gtaactccga caagttgatc 3360 gccccgtaaga aggattggga cccaaagaag tacggtggtt tcgattcccc aaccgttgct 3420 tactccgtct tggttgtcgc caaagtcgaa aagggtaagt ccaagaagtt gaagtccgtc 3480 aaaggaattgt tgggtatcac catcatggaa cgttcctcct tcgaaaagaa cccaatcgac 3540 ttcttggaag ccaagggtta caaggaagtc aagaaggact tgatcatcaa gttgccaaag 3600 tactccttgt tcgaattgga aaacggtcgt aagagaatgt tggcttccgc cggtgaattg 3660 caaaagggta acgaattggc cttgccatcc aagtacgtca acttcttgta cttggcctcc 3720 cactacgaaa agttgaaggg ttccccagaa gaacgaac aaaagcaatt gttcgtcgaa 3780 caacacaagc actacttgga cgaaatcatc gaacaaatct ccgaattctc caagagagtc 3840 atcttggccg acgctaactt ggataaggtc ttgtccgcct acaaagca cagagaaag 3900 ccaatcagag aacaagccga aaacatcatc cacttgttca ccttgaccaa cttgggtgct 3960 ccagccgctt ttaagtactt cgataccacc atcgaccgta agcgttacac ttccaccaag 4020 gaagtcttgg acgctacctt gatccaccaa tccatcaccg gtttgtacga aacccgtatc 4080 gacttgtccc aattgggtgg tgacgaaggt gccgattaa 4119 <210> 3 <211> 1455 <212> DNA <213> Artificial Sequence <220> <223> Promoter 1.0 <400> 3 aagaaacgta ttgcaactgg agatagcgat cgttcaattt attccgattt tgtgggggaa 60 gtcgcccgct agtgggcgtg cgcgagtggc aaaagaaact gggccatgct tcttatcatc 120 ccttagaaga gcaatcataa gaaacgttca gtgagaaaaa cgttggcttc ggttaatgat 180 caccttaaag gcaaaatacc tccatgtatg aacatgtagg ttattccttt ttcttttttt 240 gcaacaccct cggcgggttg ttcatattcc cggaaaacac ctccactcgg ggctaagtgg 300 atcttctata aacccgggga aataaggagc cccggtgagc gcgcacacac accaccttca 360 ttttgtccga gggaaacagc acgtgaatcc ggaacacgag aggaatattt cttctatttt 420 tttttcttct ctactgtgag cgcgtgatta tataatcaca agcgatcaac ttatggtagg 480 gtcgtgcacg gcgcaccggg ttccaaaatg atctgcgagg gacaaaattc ttttttttct 540 tccagcatgc cgctggtggc aaataccgtc gtggcatgat gctccctatg catttgattc 600 acaccaccac caccattaat caccaattaa gaggggacaa aagtgaacaa ttggtggccg 660 tcaggttaca ctcatctgct tcggagtttt acgtcccttt ctcttttcaa tttgtgaaat 720 gtcaccctgg cggcgttcga gagagatcag tccgaagcgc gtggtaggag aaacggagca 780 ccgcagcaac aaaaaaaaa aaaaaaaatt ccaaacccaa gggggtaggg agaagaacag 840 ccagggaagt tgtttaccga cctgaccgta aatttgctgc tgaaagaaac gtgtcaaaca 900 agaccaattg gctcaattga ccctgtggaa atgctttgtt gaccaccaat gcttccacca 960 aacgttactt ttttttgca atcggatggt atgggtctgg ggttcacctg ttttgtaaag 1020 ctacagaagg tggcatattt ctctgatcag gtgttttttt ttcggctgc tgctgctcgt 1080 ggtggtgtag tggtagtggt gtgtgtgtgt gtgtgtgcgt gcgtgtggaa ggacgcttttt 1140 tgctctctga ctcctcccaa tcagaagttg ctatagtggt gaaacaacaa tggatgataa 1200 tgccccgggc ggtgcgtgtc cgacacaaac cactacattt tttagctggg agcctactgc 1260 cactacgacc cacccaccca tggtcaacaa aaaaattg acaaattata aaataaccct 1320 tgaattcccc cttggaaaaa tttttggtat ttctctctct cttttccttt ccctcttctt 1380 tttctctcca tcaatcaatt gacgttcagt aactcaatta attacatcac atccctcaat 1440 taaagaattt aaaca 1455 <210> 4 <211> 239 <212> DNA <213> Artificial Sequence <220> <223> Promoter 2.0 <400> 4 ccctcgtttt gcccttctct ttttttttct tttctgctct gctggtctgt ttcctttgct 60 cttcgctgtt atcaaccggg caaacgtagt catttttttt tcgctcgtct ctcccttaga 120 gtttaccttc tcgttgatta aaagaaaaat tttcttccac tttttttttc tgattctgct 180 tttttccttt ccctttcttt tctttccttt gctctacaca tctaaagaaa taatcaatc 239 <210> 5 <211> 239 <212> DNA <213> Artificial Sequence <220> <223> Promoter 2.1 <400> 5 cactcgtatt gcccttctct tttattctct tctctgctgt gctggtctgt atcctttgct 60 ctacgctgat atcaaccggg caaacgtagt catttttttt tcgctcgtct ctcccttaga 120 gtttaccttc tcgttgatta aaagaaaaat tttcttggac tttttttttc tcattctgct 180 tttttccttt ccctttcttt tatatctttt gctctacaca tctaaagaaa taatcattc 239 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Recognition sequence 1 <400> 6 agataacatg gctattatta 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Recognition sequence 2 <400> 7 gaagatttga acaatgttag 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Recognition sequence 3 <400> 8 tggagttgat tttatatcaa 20 <210> 9 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> sgRNA structure sequence <400> 9 gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60 ggcaccgagt cggtgc 76 <210> 10 <211> 5873 <212> DNA <213> Artificial Sequence <220> <223> pCIB2 <400> 10 gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 60 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct 120 cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 180 tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg aattcggtct 240 agtatgattg tcaataatga tgggtcatcg tttcctgatt cgacgttccc tgtggtgtcg 300 ttaaatagcc tgtctgaaat ctcctccatg attgtgttgg tgtgtgttgt ttgactttcc 360 caattgctta catttttttc ttcaaggatt cgctccaaaa tagacagaaa ttatcgcgac 420 aagtcagacg aacgtcgcac gaggcgaacc aaattcttta gaagcatacg aaaactcact 480 ttatttccat tagaagtatt aaattaacaa atatataata tacaggatac aaagtaaaag 540 cacgcttaag caaccaaagc ggaagcggta gcggattcgt atttccagtt aggtggcaag 600 acagcgacgg ttctgtagta tctggccaat ctgtggattc tagattcaat caaaatcaat 660 ctgaacttgg agtccttgtc ctttctgttt ctttccaagt gctttctgac agagacagcc 720 ttcttgatca agtagtacaa gtcttctggg atttctggag ccaaaccgtt ggatttcaag 780 attctcaaga tcttgttacc agtgacaacc ttggcttggg aaacaccgtg agcatctctc 840 aagataacac caatttgaga tggagtcaaa ccctttctgg cgtacttgat gacttgttca 900 acaacttcgt cagaagacaa cttgaaccaa gatggagcgt ttcttgagta tggaagagcg 960 gaggaggaaa tacctttacc ctaaaataac aagagctaat gttagtaatt tgaaaaaaaa 1020 gacgttgagc acgcacaccc catccacccc acaggtgaaa cacatcaaac gtagcaagaa 1080 caatagttgg ccctcccgtc aagggggcag gtaattgtcc aagtacttta gaaaagtatg 1140 tttttaccca taagatgaac acacacaaac cagcaaaagt atcaccttct gcttttcttg 1200 gttgaggttc aaattatgtt tggcaataat gcagcgacaa tttcaagtac ctaaagcgta 1260 tatagtaaca attctaggtc tgtatagtcg accgtaggtg aatcgtttac tttaggcaag 1320 accttgtccc tgataaagcc aggttgtact ttctattcat tgagtgtcgt ggtggtggta 1380 gtggtggttg attgggctgt tgtggtagta gtagtggttg tgatttggaa catacagatg 1440 aatgcatacg acccatgatg actgatttgt ttctttattg agttgatggt aagaaagaga 1500 agaagaggag gtaaaaaggt ggtagagtga aaaattttt tctcttaaaa gtgagagaga 1560 gaaagagaaa aatttcactg cgaaacaaat ggttggggac acgacttttt tcaggaattt 1620 ttactcgaag cgtatatgca ggaaagttgt tgttagggaa tatggagcca caagagagct 1680 gcgaattcga gctcggtacc cggggatcct ctagagtcga cctgcaggca tgcgaacccg 1740 aaaatggagc aatcttcccc ggggcctcca aataccaact cacccgagag agagaaagag 1800 acaccaccca ccacgagacg gagtatatcc accaaggtaa gtaactcagg gttaatgata 1860 caggtgtaca cagctccttc cctagccatt gagtgggtat cacatgacac tggtaggtta 1920 caaccacgtt tagtagttat tttgtgcaat tccatgggga tcaggaagtt tggtttggtg 1980 ggtgcgtcta ctgattcccc tttgtctctg aaaatctttt ccctagtgga acactttggc 2040 tgaatgatat aaattcacct tgattcccac cctcccttct ttctctctct ctctgttaca 2100 cccaattgaa ttttcttttt ttttttactt tccctccttc tttatcatca aagataagta 2160 agtttatcaa ttgcctattc agaatgaaaa agcctgaact caccgcgacg tctgtcgaga 2220 agtttctcat cgaaaagttc gacagcgtct ccgacctcat gcagctctcg gagggcgaag 2280 aatctcgtgc tttcagcttc gatgtaggag ggcgtggata tgtcctccgg gtaaatagct 2340 gcgccgatgg tttctacaaa gatcgttatg tttatcggca ctttgcatcg gccgcgctcc 2400 cgattccgga agtgcttgac attggggaat tcagcgagag cctcacctat tgcatctccc 2460 gccgtgcaca gggtgtcacg ttgcaagacc tccctgaaac cgaactcccc gctgttctcc 2520 agccggtcgc ggaggccatg gatgcgatcg ctgcggccga tcttagccag acgagcgggt 2580 tcggcccatt cggaccgcaa ggaatcggtc aatacactac atggcgtgat ttcatatgcg 2640 cgattgctga tccccatgtg tatcactggc aaactgtgat ggacgacacc gtcagtgcgt ccgtcgcgca ggctctcgat gagctcatgc tttgggccga ggactgcccc gagtccggc 2760 acctcgtgca cgcggatttc ggctccaaca atgtcctcac ggacaatggc cgcataacag cggtcattga ctggagcgag gcgatgttcg gggattccca atacgaggtc gccaacatct tcttctggag gccgtggttg gcttgtatgg agcagcagac gcgctacttc gagcggaggc 2940 atccggagct tgcaggatcg ccgcggctcc gggcgtatat gctccgcatt ggtcttgacc 3000. aactctatca gagcttggtt gacggcaatt tcgatgatgc agcttgggcg cagggtcgat 3060. gcgacgcaat cgtccgatcc ggagccggga ctgtcggggcg tacacaaatc gcccgcagaa gcgcggccgt ctggaccgat ggctgtgtag aagtactcgc cgatagtgga aaccgacgcc 3180 ccgcactcg tccgagggca aaggaatagt gtgctaccca cgcttactcc accagagcta ttacatcag aaatatttt tctaataaat aggatgcaaa aaaaaaccc cccttaataa aaaaaaaaga aacgattttt tatctatga agtctatgta tctaacaaat gtatgtatca atgtttattc cgttaaacaa aaatcagtct gtaaaaaaagg ttctaaataa atattctgtc 3420 tagtgtacac attctcccaa aatagtgaaa tccagctgct agcgtgtaag cttggcactg 3480 gccgtcgttt tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt 3540 cagcacatc cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct 3600 tcccaacagt tgcgcagcct gaatggcgaa tggcgcctga tgcggtattt tctccttacg 3660 catctgtgcg gtatttcaca ccgcatatgg tgcactctca gtacaatctg ctctgatgcc 3720 catagagttaa gccagccccg acacccgcca acacccgctg acgcgccctg acgggcttgt 3780 ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg catgtgtcag 3840 aggttttcac cgtcatcacc gaaacgcgcg agacgaaagg gcctcgtgat acgcctattt 3900 ttataggtta atgtcatgat aataatggtt tcttagacgt caggtggcac ttttcgggga 3960 aatgtgcgcg gaacccctat ttgtttattt ttctaaatac attcaaatat gtatccgctc 4020 atgagacaat aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt 4080 caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct 4140 cacccagaaa cgctgggtgaa agtaaagat gctgaagaatc agttgggtgc acgagtgggt 4200 tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt 4260 tttccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtattgac 4320 gccgggcaag agcaactcgg tcgccgcat cactattctc agaatgactt ggttgagtac 4380 tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct 4440 gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg 4500 aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg 4560 gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat gcctgtagca 4620 atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa 4680 4740 ccggctggct ggttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc 4800 attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg 4860 agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt 4920 aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga tttaaaactt 4980 catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc 5040 ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct 5100 tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta 5160 ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc 5220 ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac 5280 ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct 5340 gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat 5400 aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg 5460 acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac gcttcccgaa 5520 gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg 5580 gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggttcg cacctctga 5640 cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc 5700 aacgcggcct tttacggtt cctggcctt tgctggcctt ttgctcacat gttctttcct 5760 gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc tgataccgct 5820 cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga aga 5873
Claims
1. A CRISPRi gene inhibition system in Candida visweissii Candida viswanathii ) in the application; The CRISPRi gene inhibition system comprises: a dCas9 expression cassette and an sgRNA expression cassette; wherein: The dCas9 expression cassette includes the dCas9 gene and a first promoter upstream thereof, the nucleotide sequence of the first promoter is shown in SEQ ID NO: 3; the sgRNA expression cassette includes a nucleotide sequence encoding the sgRNA and a second promoter upstream thereof, the nucleotide sequence of the second promoter is shown in SEQ ID NO: 4 or SEQ ID NO: 5; the dCas9 gene encodes the amino acid sequence shown in SEQ ID NO:
1.
2. The use according to claim 1, characterized in that The nucleotide sequence encoding the sgRNA includes a recognition sequence and a structural sequence; the recognition sequence is a sequence complementary to the 20 bases upstream of the PAM sequence within 250 bases of the transcription start of the target gene; the structural sequence is shown in SEQ ID NO:
9.
3. The use according to claim 2, characterized in that The PAM sequence is an NGG sequence.
4. The use according to claim 3, wherein The recognition sequence is shown in SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO:
8.
5. The use according to any one of claims 1 to 4, characterized in that The Candida vesiculosus is a strain with a preservation number of CCTCC: M2020048.
6. The use according to any one of claims 1 to 4, characterized in that The dCas9 expression cassette is integrated into the chromosome of the Candida visweissii.
7. A CRISPRi gene inhibition system, characterized in that: The CRISPRi gene inhibition system comprises: a dCas9 expression cassette and an sgRNA expression cassette; wherein: the dCas9 expression cassette includes the dCas9 gene and a first upstream promoter thereof, the nucleotide sequence of the first promoter is shown in SEQ ID NO: 3, the sgRNA expression cassette includes a nucleotide sequence encoding the sgRNA and a second upstream promoter thereof, the nucleotide sequence of the second promoter is shown in SEQ ID NO: 4 or SEQ ID NO: 5; the dCas9 gene encodes the amino acid sequence shown in SEQ ID NO:
1.
8. The CRISPRi gene inhibition system according to claim 7, wherein The nucleotide sequence encoding the sgRNA includes a recognition sequence and a structural sequence; the recognition sequence is a sequence complementary to the 20 bases upstream of the PAM sequence within 250 bases of the transcription start of the target gene; the structural sequence is shown in SEQ ID NO:
9.
9. The CRISPRi gene inhibition system according to claim 8, wherein The PAM sequence is an NGG sequence.
10. The CRISPRi gene inhibition system according to claim 8, wherein The recognition sequence is shown as SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO:
8.
11. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria express the CRISPRi gene inhibition system according to any one of claims 7 to 10, and the starting bacteria of the genetically engineered bacteria are Candida visweiss ( Candida viswanathii ).
12. The genetically engineered bacterium according to claim 11, wherein The Candida vesiculosus is a strain with a preservation number of CCTCC: M2020048.
13. A method for inhibiting gene expression in Candida visweiss, characterized in that: The method comprises: (1) The Candida visweiss contains the dCas9 expression cassette in the CRISPRi gene inhibition system according to any one of claims 7 to 10; (2) Designing an sgRNA expression cassette in the CRISPRi gene inhibition system according to any one of claims 7 to 10 according to the target gene to be inhibited and introducing it into the Candida visweiss.
14. The method according to claim 13, wherein The Candida vesiculosus is a strain with a preservation number of CCTCC: M2020048.
15. A recombinant vector combination, characterized in that: The recombinant vector combination includes a dCas9 recombinant vector containing a nucleic acid encoding dCas9 and a first promoter upstream thereof, and an sgRNA recombinant vector containing a nucleic acid encoding sgRNA and a second promoter upstream thereof; The amino acid sequence of the dCas9 is shown in SEQ ID NO: 1; the sgRNA is the sgRNA in the CRISPRi gene inhibition system according to any one of claims 7 to 10; The nucleotide sequence of the first promoter is shown in SEQ ID NO: 3, and the nucleotide sequence of the second promoter is shown in SEQ ID NO: 4 or SEQ ID NO: 5.
Citation Information
Patent Citations
Candida viswanathii and application thereof
CN111748480A
Preparing method of L-ribose based on L-arabinose
CN108866120A