NADP-Ferredoxin Reductase Mutant and Its Application in Glutamic Acid Production

Abstract

The present invention belongs to the field of molecular biology, and particularly relates to the application of enhanced activity of NADP-ferredoxin reductase in improving the yield and conversion rate of L-glutamic acid. The enhanced activity is achieved by enhancing the transcriptional expression of NADP-ferredoxin reductase, or by mutating the NADP-ferredoxin reductase of the sequence shown in SEQ ID NO: 3, or by mutating the NADP-ferredoxin reductase of the sequence shown in SEQ ID NO: 3 and enhancing the transcriptional expression. The enhanced activity of the NADP-ferredoxin reductase of the present invention can reduce the production cost of glutamic acid, provide a new strategy for large-scale production, and has great application value.

Description

Technical Field

[0001] The present invention relates to the fields of microorganisms and biotechnology, and particularly relates to an NADP-ferredoxin reductase mutant, and a method for constructing an L-glutamic acid-producing strain with the mutant to produce L-glutamic acid. Background Art

[0002] As an essential amino acid, L-glutamic acid is a basic substance that constitutes the proteins required for animal nutrition. It plays an important role in the protein metabolism process in living organisms, participates in many important chemical reactions in animals, plants, and microorganisms, and is mainly used for producing seasonings such as monosodium glutamate and chicken essence, as well as various foods, and is widely used in the fields of medicine, chemical industry, animal husbandry, etc.

[0003] Currently, L-glutamic acid is mainly produced by microbial fermentation, and the most important production strain is Corynebacterium glutamicum. In Corynebacterium glutamicum, L-glutamic acid is mainly produced from the intermediate product α-ketoglutaric acid of the TCA cycle under the action of glutamate dehydrogenase. The synthesis pathway is relatively short, and there are relatively few targets that can be used to transform the strain to improve the yield of L-glutamic acid. Therefore, the improvement of the performance of L-glutamic acid-producing strains is greatly limited.

[0004] NADP-ferredoxin reductase, abbreviated as FprA, has been reported less currently. Existing studies have shown that this enzyme is an electron transport chain protein of Mycobacterium tuberculosis and plays a major role in electron transport (Sabri, M, etal., Characterization of coenzyme binding and selectivity determinants in Mycobacterium tuberculosis flavoprotein reductase A: analysis of Arg(199) and Arg(200) Mutants at the NADP(H)2’ -phosphate binding site. Biochemical Journal, 2009. 417: 103-112.); Studies in Pseudomonas aeruginosa have shown that this gene can be regulated by LysR family transcriptional regulators (Boonma, S, etal., The FinR-regulated essential gene fprA , encoding ferredoxin NADP (+) reductase: Roles in superoxide-mediated stress protection and virulence of Pseudomonas aeruginosa.PlosOne, 2017. 12(2):21.). In Corynebacterium glutamicum, only gene annotation has been carried out so far, and it is annotated as a putative protein or the β chain of NADPH-dependent glutamate synthase and related oxidoreductases. There have been no other research reports, and it is also unknown how it affects the production of L-glutamate. SUMMARY OF THE INVENTION

[0005] Previous studies have reported that NADP-ferredoxin reductase is an electron transport chain protein in Mycobacterium tuberculosis, and electron transport is crucial for cell growth and product synthesis. Therefore, we speculate that this enzyme may affect the production of L-glutamate by the strain. In the present invention, overexpression of this enzyme, or point mutation, or point mutation and enhanced transcriptional expression can increase the glutamate yield of the strain. Furthermore, it is found that enhancing the activity of this enzyme can improve the production efficiency of glutamate and reduce production costs. Based on this, the present invention is completed.

[0006] In a first aspect, the present invention provides a production strain of L-glutamate, in which the activity of NADP-ferredoxin reductase is enhanced to increase the yield and conversion rate of L-glutamate of the strain.

[0007] Optionally, the enhanced activity is enhanced transcriptional expression of NADP-ferredoxin reductase, or mutation of NADP-ferredoxin reductase with the sequence shown in SEQ ID NO: 3, or mutation of NADP-ferredoxin reductase with the sequence shown in SEQ ID NO: 3 and enhanced transcriptional expression.

[0008] Preferably, the NADP-ferredoxin reductase mutant has the alanine at position 200 of the NADP-ferredoxin reductase corresponding to the sequence shown in SEQ ID NO: 3 replaced by threonine.

[0009] The term "activity enhancement" of the present invention refers to enhancing the intracellular activity of a protein in a microorganism by modifying the protein, resulting in an increase in intracellular activity compared to the protein activity in its natural state. This not only includes a higher effect than the original function due to an increase in the protein's own activity, but it can be achieved by at least one method selected from the following: increasing the copy number of the polynucleotide encoding the protein, cloning the polynucleotide into a vector and introducing it into the microorganism, modifying the regulatory sequence of the gene encoding the protein, replacing the regulatory sequence of the gene encoding the protein on the chromosome with a sequence having strong activity, replacing the gene encoding the protein with a mutant gene to increase the protein's activity, introducing modifications into the gene encoding the protein on the chromosome to enhance the protein's activity, and can also non - restrictively include any known method as long as it can enhance the protein's activity compared to the wild - type or enhance the activity of the introduced protein. Regulatory sequences include promoters capable of initiating transcription, any operator gene sequences for transcriptional regulation, sequences encoding suitable mRNA ribosome - binding domains, and sequences regulating transcription and translation termination. Modifications to the regulatory sequence include, but are not limited to, introducing deletions, insertions, conservative mutations or non - conservative mutations, or combinations thereof in the polynucleotide sequence, and can also be achieved by replacing the original polynucleotide sequence with a polynucleotide sequence having enhanced activity. A vector is a DNA construct comprising a polynucleotide sequence encoding the nucleic acid of the target protein, which is operably linked to a suitable regulatory sequence to enable the expression of the target protein in a host cell. The vector can replicate or function independently of the host cell genome after being transferred into a suitable host cell, or can be integrated into the host genome. These vectors are not particularly limited as long as the vector is replicable in the host cell and can be constructed using any vector known in the art. Examples of vectors include natural or recombinant plasmids, cosmids, viruses, and phages. For example, pXMJ19, pWE15, pET, pUC vectors, etc. Additionally, by inserting the vector into the chromosome of the host cell, the polynucleotide encoding the endogenous target protein on the chromosome can be replaced with a modified polynucleotide.

[0010] Among them, the "NADP-ferrodoxin reductase" described in this article and its abbreviated name "FprA" refer to a protein derived from Corynebacterium glutamicum, and its coding gene in Corynebacterium glutamicum ATCC13869 is the protein with Gene ID of BBD29_13460. As used herein, FprA is not specifically limited as long as it has the corresponding activity, and it can be derived from Corynebacterium glutamicum, but is not limited thereto. For example, FprA can be a wild-type sequence of the amino acid sequence of SEQ ID NO:3 or an amino acid sequence having at least 75%, specifically at least 80%, more specifically 85%, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher homology with the amino acid sequence of SEQ ID NO:3. Additionally, it is obvious that an amino acid sequence with deletions, modifications, substitutions, or additions should also fall within the scope of the present disclosure if the amino acid sequence has homology with the above sequence and has substantially the same or corresponding biological activity as the protein of SEQ ID NO:3. In the present invention, any polynucleotide sequence encoding FprA can fall within the scope of the present disclosure. For example, the polynucleotide sequence can be a polynucleotide sequence having at least 75%, specifically at least 80%, more specifically 85%, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher homology with the polynucleotide sequence of SEQ ID NO:4. Additionally, based on codon degeneracy or considering the preferred codons for protein expression in organisms, the polynucleotide sequence encoding the protein can have various variants in the coding region within the range of not changing the amino acid sequence of the protein expressed from the coding region.

[0011] The terms "polypeptide", "peptide", and "protein" are used interchangeably herein and refer to amino acid polymers of any length. The polymer can be linear or branched, it can contain modified amino acids, and it can be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other operation, such as conjugation with a labeled component).

[0012] The term "fragment" means a polypeptide or a catalytic or carbohydrate-binding module in which one or more (e.g., several) amino acids are deleted from the amino and / or carboxyl terminus of a mature polypeptide or domain. In a specific embodiment, the fragment has citrate synthase activity.

[0013] The term "wild-type" refers to an entity that can be found in nature. For example, a polypeptide or polynucleotide sequence that exists in an organism, can be isolated from a natural source, and has not been deliberately modified by humans in the laboratory is naturally occurring. As used in this disclosure, "naturally occurring" and "wild-type" are synonyms. In some embodiments, the wild-type NADP-ferredoxin reductase in this disclosure refers to the wild-type FprA protein, that is, a polypeptide having the amino acid sequence shown in SEQ ID NO: 3.

[0014] The term "mutant" refers to a polynucleotide or polypeptide that contains a change (i.e., substitution, insertion, and / or deletion) at one or more (e.g., several) positions relative to the "wild-type" or the "compared" polynucleotide or polypeptide. Among them, substitution means replacing the nucleotide occupying a position with a different nucleotide. Deletion means removing the nucleotide occupying a certain position. Insertion means adding a nucleotide adjacent to and immediately following the nucleotide occupying the position. In a specific embodiment, the "mutation" is a "substitution", which is a mutation caused by the replacement of a base in one or more nucleotides with another different base, also known as a base substitution mutation or a point mutation.

[0015] The term "amino acid mutation" or "nucleotide mutation" includes "substituting, repeating, deleting, or adding one or more amino acids or nucleotides". In the present invention, the term "mutation" refers to a change in a nucleotide sequence or an amino acid sequence. In a specific embodiment, the term "mutation" refers to "substitution".

[0016] In some embodiments, the "mutation" includes the substitution of alanine at position 200 in the sequence shown in SEQ ID NO: 3 with threonine. Compared with the NADP-ferredoxin reductase of the sequence shown in SEQ ID NO: 3, the strain containing this mutant has a more than 5% increase in L-glutamic acid production. The term "polynucleotide" refers to a polymer composed of nucleotides. A polynucleotide can be in the form of a separate fragment or a component of a larger nucleotide sequence structure, which is derived from a nucleotide sequence that has been separated at least once in terms of quantity or concentration, and can be recognized, manipulated, and restored, along with its component nucleotide sequences, by standard molecular biology methods (e.g., using a cloning vector). When a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C), where "U" replaces "T". In other words, a "polynucleotide" refers to a polymer of nucleotides removed from other nucleotides (separate fragments or entire fragments), or can be a component or ingredient of a larger nucleotide structure, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences.

[0017] Specifically, the polynucleotide encoding NADP-ferredoxin reductase of the present invention includes the polynucleotide shown in SEQ ID NO:2 and the polynucleotide mutated at its 598th position. In addition, the polynucleotide of the present invention also includes any polynucleotide having 75% or higher, specifically 80% or higher, more specifically 85% or higher, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% or higher homology with the polynucleotide shown in SEQ ID NO:2.

[0018] The term "homology" in the present invention refers to the percentage of identity between two polynucleotide or polypeptide moieties. The homology between the sequences of one moiety and another can be determined by techniques known in the art. For example, homology can be determined by directly aligning the sequence information of two polynucleotide molecules or two polypeptide molecules using readily available computer programs. Examples of computer programs can include BLAST (NCBI), CLC Main Workbench (CLCbio), MegAlignTM (DNASTAR Inc.), etc. In addition, the homology between polynucleotides can be determined by the following steps: hybridizing the polynucleotides under conditions that form stable double strands between homologous regions, digesting with a single-strand specific nuclease, and then sizing the digested fragments.

[0019] The construction of the L-glutamic acid-producing strain of the present invention is achieved by transforming NADP-ferredoxin reductase or its encoding gene into a host cell. Here, "transformation" has the meaning generally understood by those skilled in the art, that is, the process of introducing exogenous DNA into a host. The methods of said transformation include any method of introducing nucleic acids into cells, and these methods include but are not limited to electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0020] As used herein, the "host cell" has the meaning commonly understood by those of ordinary skill in the art, that is, a cell capable of introducing the nucleic acid with promoter activity of the present invention, which is called a recombinant host cell after introduction. In other words, any host cell can be used in the present invention as long as its cell contains the nucleic acid with promoter activity of the present invention and is operably linked to a certain gene to mediate the transcription of the gene. The host cells of the present invention can be prokaryotic cells or eukaryotic cells, preferably Enterobacter or Corynebacterium, more preferably Corynebacterium glutamicum, including but not limited to Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and mutants or strains producing L-amino acids prepared from the above strains.

[0021] In some embodiments, for the glutamate-producing strains, they can be strains obtained by modifying on the basis of Corynebacterium glutamicum ATCC 13032 and Corynebacterium glutamicum ATCC 13869, and these modifications include but are not limited to one or more of the following genes being enhanced or overexpressed:

[0022] a. The yggB gene encoding a mechanosensitive channel protein (CN108250278A);

[0023] b. The fxpk gene encoding phosphoketolase (WO2006016705A1);

[0024] c. The pyc gene encoding pyruvate carboxylase (WO2004069996A2);

[0025] d. The gdh gene encoding glutamate dehydrogenase (CN103205390A);

[0026] e. The gene encoding carbonic anhydrase (WO2011024583A1).

[0027] In some embodiments, the glutamate-producing strains may also include but are not limited to one or more of the following genes being attenuated or having reduced expression:

[0028] a. The odhA gene encoding α-ketoglutarate dehydrogenase (WO2006028298A2);

[0029] b. The amtR gene encoding a transcriptional regulatory gene (EP2276845A1);

[0030] c. The acnR gene encoding a transcriptional repressor (CN111334535A).

[0031] In a specific embodiment of the present invention, the host cell is Corynebacterium glutamicum, which is further improved. Specifically, an A111V mutation is introduced into the NCgl1221 homologous gene (BBD29_06760 or yggB ) to obtain the L-glutamic acid-producing strain SCgGC5.

[0032] In the present invention, the cultivation of the host cell can be carried out according to the conventional methods in the art, including but not limited to well plate cultivation, shake flask cultivation, batch cultivation, continuous cultivation, fed-batch cultivation, etc., and various cultivation conditions such as temperature, time, and pH value of the culture medium can be appropriately adjusted according to the actual situation.

[0033] In a second aspect, the present invention provides a method for producing L-glutamic acid, which includes culturing the host cell of the first aspect to produce L-glutamic acid, and further includes the step of separating, extracting or recovering L-glutamic acid from the culture medium.

[0034] In a third aspect, the present invention provides the application of the enhanced activity of the NADP-ferrodoxin reductase in improving the yield and conversion rate of L-glutamic acid.

[0035] Optionally, the enhanced activity is the enhanced transcriptional expression of the NADP-ferrodoxin reductase, or the NADP-ferrodoxin reductase with the sequence shown in SEQ ID NO: 3 undergoes a mutation, or the NADP-ferrodoxin reductase with the sequence shown in SEQ ID NO: 3 undergoes a mutation and its transcriptional expression is enhanced.

[0036] Preferably, the NADP-ferrodoxin reductase mutant has the alanine at the 200th position of the NADP-ferrodoxin reductase corresponding to the sequence shown in SEQ ID NO: 3 replaced by threonine.

[0037] Advantages of the present invention: By enhancing the activity of NADP-ferrodoxin reductase in Corynebacterium glutamicum, the present invention can improve the yield and conversion rate of L-glutamic acid in the strain, reduce the production cost of glutamic acid, and provide a new strategy for large-scale production. Specific Embodiments

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention belongs. Although any methods and materials similar or equivalent to those described herein can be used to implement or test the present invention, the methods and materials provided herein are preferred.

[0039] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental techniques and methods used in the embodiments are all conventional technical methods unless otherwise specified. For example, the experimental methods without specific conditions noted in the following embodiments are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the embodiments can be obtained through regular commercial channels unless otherwise specified.

[0040] The culture media used in the embodiments are as follows:

[0041] The components of the TSB plate culture medium are (g / L): glucose, 5 g / L; yeast extract, 5 g / L; soy peptone, 9 g / L; urea, 3 g / L; succinic acid, 0.5 g / L; K2HPO4·3H2O, 1 g / L; MgSO4·7H2O, 0.1 g / L; biotin, 0.01 mg / L; vitamin B1, 0.1 mg / L; MOPS, 20 g / L; agar powder, 15 g / L.

[0042] The components of the TSB liquid culture medium are (g / L): glucose, 5 g / L; yeast extract, 5 g / L; soy peptone, 9 g / L; urea, 3 g / L; succinic acid, 0.5 g / L; K2HPO4·3H2O, 1 g / L; MgSO4·7H2O, 0.1 g / L; biotin, 0.01 mg / L; vitamin B1, 0.1 mg / L; MOPS, 20 g / L.

[0043] The components of the seed culture medium used in the glutamic acid fermentation experiment are: glucose, 25 g / L; KH2PO4·3H2O, 2.2 g / L; urea, 3 g / L; corn steep liquor, 33 mL; MgSO4·7H2O, 0.9 g / L; hydrolyzed soybean cake solution, 22 mL; MOPS, 20 g / L; initial pH 7.2.

[0044] The components of the fermentation culture medium used in the glutamic acid fermentation experiment are: glucose, 80 g / L; KH2PO4, 1 g / L; urea, 10 g / L; corn steep liquor dry powder, 5 g / L; MgSO4·7H2O, 0.4 g / L; FeSO4·7H2O, 10 mg / L; MnSO4·4H2O, 10 mg / L; VB1, 200 μg / L; MOPS, 40 g / L; initial pH 7.5.

[0045] Example 1. Construction of FprA overexpression vector

[0046] Previous studies have reported that NADP - ferredoxin reductase mainly functions as an electron transfer chain protein in Mycobacterium tuberculosis (Sabri, M, et al., Characterization of coenzyme binding and selectivity determinants in Mycobacterium tuberculosis flavoprotein reductase A: analysis of Arg(199) and Arg(200) Mutants at the NADP(H)2’ -phosphate binding site. Biochemical Journal, 2009. 417: 103 - 112.). Since electron transfer is crucial for cell growth and product synthesis, we hypothesized that overexpression of NADP - ferredoxin reductase in Corynebacterium glutamicum might be beneficial for L - glutamate production by the strain.

[0047] Based on the published genome sequence of Corynebacterium glutamicum ATCC 13869 (GenBank: CP016335.1), primers FprA - F and FprA - R were designed. Using the ATCC13869 genome as a template, the wild - type fprA gene fragment (BBD29_13460, whose nucleotide sequence is shown in SEQ ID NO: 4 and amino acid sequence is shown in SEQ ID NO: 3) was obtained by PCR amplification. According to the sequence information of plasmid pXMJ19, primers pXMJ19 - rev - F and pXMJ19 - rev - R were designed. Using plasmid pXMJ19 as a template, a linearized vector fragment was obtained by reverse PCR amplification. After recovering the above two fragments, they were recombinantly ligated to obtain the wild - type FprA overexpression vector pXMJ19 - FprA WT . The primers used in this example are shown in Table 1.

[0048] Table 1 Primers used in this example

[0049] Primer Nucleotide sequence FprA-F gaaggagatatacatATGTCTCGCCCTTTGCGTGT FprA-R gggatcctctagagtTTAGATGTCGTATTCTGGACGAGCA pXMJ19-rev-F ACTCTAGAGGATCCCCGGGTAC pXMJ19-rev-R ATGTATATCTCCTTCCTGCAGGCATGCAAGCTT

[0050] Example 2. Construction of FprA overexpression strain and its L - glutamate synthesis

[0051] In this example, a strain capable of producing L - glutamate was first constructed, and the construction process is as follows:

[0052] Previous literature has reported on the genome of Corynebacterium glutamicum ATCC 13869 NCgl1221The introduction of the A111V mutation into the homologous gene (BBD29_06760 or yggB ) can endow the strain with the ability to constitutively synthesize and secrete L-glutamic acid. According to the publicly available genome sequence of Corynebacterium glutamicum ATCC 13869, primers A111V-UH-F / R and A111V-DH-F / R were designed. Using the ATCC13869 genome as a template, DNA fragments with the YggB A111V mutation were obtained by PCR amplification using the above primers respectively; according to the sequence information of plasmid pK18mob sacB , primers pK-F / R were designed. Using plasmid pK18mob sacB as a template, a linearized vector fragment was obtained by reverse PCR amplification; after the above three fragments were recovered, they were recombined and ligated. The clones obtained after transformation were collected and plasmids were extracted to obtain the editing vector pK18-YggB A111V with the YggB A111V mutation.

[0053] The competent cells of ATCC 13869 were prepared by the method reported in the literature (Ruan, YL, etal., Improving the electro-transformation efficiency of C. glutamicum by weakening its cell wall and increasing the cytoplasmic membranefluidity. Biotechnology Letters, 2015, 37(12): 2445-2452.). 1 μg of the plasmid pK18-YggB Corynebacterium glutamicum was electro-transformed into the above-prepared 13869 competent cells. 1 mL of pre-warmed TSB medium at 46°C was added, and the cells were incubated at 46°C for 6 min and then at 30°C for 3 h. The cells were spread on TSB solid medium containing 25 μg / mL kanamycin and cultured at 30°C for 1 day to obtain the transformants of the first recombination. The correct transformants were transferred to TSB medium containing 5 g / L glucose and cultured overnight, and then transferred to TSB medium containing 100 g / L sucrose and cultured at 30°C for 6 h. Then the cells were spread on TSB medium supplemented with 100 g / L sucrose for screening to obtain the L-glutamic acid-producing strain SCgGC5. The primers used in this example are shown in Table 2. A111V

[0054] Table 2 Primers used in this example

[0055] Primer Nucleotide sequence A111V-UH-F tgacatgattacgaattcATCCACTGGAGTTTTGCCAATTCTC A111V-UH-R gtcttggtGTGcagtcgattgttgcg A111V-DH-F atcgactgCACaccaagaccaatggc A111V-DH-R cgacggccagtgccaagcttTGGAGGAATAGAGCGGGTCATACAC

[0056] The SCgGC5 competent cells were prepared by the method reported in the literature (Biotechnology Letters, 2015, 37: 2445-52.). 1 μg of pXMJ19 and pXMJ19-FprA were respectively electrotransformed into the above-prepared SCgGC5 competent cells WT plasmids, 1 mL of pre-warmed TSB medium at 46 °C was added, incubated at 46 °C for 6 min, incubated at 30 °C for 2 h, spread on TSB solid medium containing 5 μg / mL chloramphenicol, and cultured at 30 °C for 24 h to obtain transformants, that is, the FprA wild-type overexpression strain SCgGC5 / pXMJ19-FprA was obtained WT , and the control strain SCgGC5 / pXMJ19.

[0057] The above-constructed strains were subjected to fermentation tests. First, the strains were inoculated into the seed medium and cultured for 8 h, and the culture was used as a seed to be inoculated into a 24-well plate containing 800 μL of fermentation medium per well. The initial OD 600 was controlled to be about 0.5, the rotation speed of the plate shaker was 800 rpm, there were 3 parallels for each strain, cultured at 30 °C, 5 g / L urea was added at 20 h and 23 h, the fermentation ended at 25 h, the L-glutamic acid production and glucose consumption were detected, and the sugar-acid conversion rate from glucose to L-glutamic acid was calculated, as shown in Table 3. It can be seen from the table that overexpression of the FprA wild-type can significantly increase the L-glutamic acid production and the sugar-acid conversion rate.

[0058] Table 3 L-glutamic acid production and sugar-acid conversion rate of different strains

[0059] Strain L-glutamic acid (g / L) Sugar acid conversion rate (g / g, %) SCgGC5 / pXMJ19 5.53±0.31 7.55±0.41 <![CDATA[SCgGC5 / pXMJ19-FprA WT > 6.40±0.20 8.56±0.14

[0060] Example 3. Construction of point mutant editing plasmids for FprA

[0061] Furthermore, we found that in a high-yield glutamic acid strain SL4 (Liu Jiao, et al., Mutations in Peptidoglycan Synthesis Gene ponA Improve Electrotransformation Efficiency of Corynebacterium glutamicum ATCC 13869. Appl. Environ. Microbiol., 2018, 84, e02225-02218.) screened by mutagenesis by the inventors in the early stage, the 200th alanine of FprA was replaced by threonine. In view of the fact that Example 2 has confirmed that overexpression of FprA can enhance the L-glutamic acid production of the strain, therefore, it is speculated that this mutant may also have an impact on the production of L-glutamic acid.

[0062] According to the publicly available Corynebacterium glutamicum ATCC 13869 genomic sequence and the sequence of wild-type FprA, amplification primers FprA-F1 / R1 and FprA-F2 / R2 were designed. Using the ATCC 13869 genome as a template, the upstream and downstream recombination fragments containing the FprA A200T mutant were amplified. According to the sequence information of plasmid pK18mob sacB primers pK-F / R were designed. Using plasmid pK18mob sacB as a template, a linearized vector fragment was obtained by reverse PCR amplification. The primers used in this example are shown in Table 4. After recovering the above three fragments, they were recombined and ligated to obtain the editing plasmid pK18-FprA A200T carrying the FprA A200T mutant.

[0063] Table 4 Primers for constructing mutant editing plasmids

[0064] Primer Nucleotide sequence pK-F AAGCTTGGCACTGGCCGTCG pK-R GAATTCGTAATCATGTCATAGCTGT FprA-F1 tgacatgattacgaattcGATCTCAATTCCACGCTTTG FprA-R1 gtgaacttcgtctgagcaggtccacgacgac FprA-F2 ctgctcagacgaagttcactccgttggaact FprA-R2 cgacggccagtgccaagcttGACGAGCATTCACCAGATAT

[0065] Example 4. Construction of L-glutamate-producing strains with mutant FprA and production of L-glutamate

[0066] 1 μg of plasmid pK18-FprA A200T was electrotransformed into SCgGC5 competent cells. 1 mL of pre-warmed TSB medium at 46°C was added, and the cells were incubated at 46°C for 6 min and then at 30°C for 3 h. The cells were spread on TSB solid medium containing 25 μg / mL kanamycin and cultured at 30°C for 24 h to obtain the transformants of the first recombination. The correct transformants were transferred to TSB medium containing 5 g / L glucose and cultured overnight, and then transferred to TSB medium containing 100 g / L sucrose and cultured at 30°C for 4 h. Then, the cells were spread on TSB medium supplemented with 100 g / L sucrose for screening to obtain the L-glutamate-producing strain SCgGC5-FprA A200T carrying the mutant FprA. That is, the mutant FprA (its amino acid sequence is shown in SEQ ID NO:1 and its nucleotide sequence is shown in SEQ ID NO:2) was contained in this strain.

[0067] To verify the effect of the FprA mutant on glutamate production, the above-constructed SCgGC5-FprA A200T strain was subjected to fermentation tests, and strains ATCC 13869 and SCgGC5 were used as controls at the same time.

[0068] First, the strains were inoculated into the seed medium and cultured for 8 h. The culture was used as a seed and inoculated into a 24-well plate containing 800 μL of fermentation medium per well. The initial OD 600The control was about 0.5, the shaking speed of the orifice plate shaker was 800 rpm, there were 3 parallels for each strain, and the culture was carried out at 30 °C. 5 g / L urea was added at 17 h, 20 h and 23 h. The fermentation ended at 25 h. The L-glutamic acid yield and glucose consumption were detected, and the sugar-acid conversion rate from glucose to L-glutamic acid was calculated. The results showed that only a small amount of L-glutamic acid was produced by the wild-type ATCC 13869. The L-glutamic acid yield and conversion rate of SCgGC5 were 4.26 g / L and 5.27 g / g respectively, while the mutant of FprA could make the engineering strain SCgGC5-FprA A200T increase the L-glutamic acid yield and conversion rate by 5.8% and 15% respectively compared with SCgGC5, indicating that this mutant has good application prospects in the production of L-glutamic acid and its derivatives.

[0069] Example 5, Construction of a strain overexpressing mutant FprA and its production of L-glutamic acid

[0070] According to the published genome sequence of Corynebacterium glutamicum ATCC 13869 (GenBank: CP016335.1), primers FprA-F and FprA-R were designed. Using the genome of the SCgGC5-FprA A200T strain as a template, a mutant fprA gene fragment was obtained by PCR amplification. After recovering the above fragment, it was recombinantly ligated with linearized pXMJ19 to obtain the overexpression vector pXMJ19-FprA A200T of mutant FprA A200T .

[0071] 1 μg of pXMJ19 and pXMJ19-FprA A200T plasmids were electrotransformed into SCgGC5 competent cells respectively. 1 mL of preheated TSB medium at 46 °C was added, incubated at 46 °C for 6 min, incubated at 30 °C for 2 h, and spread on TSB solid medium containing 5 μg / mL chloramphenicol and cultured at 30 °C for 24 h to obtain transformants, that is, the strain SCgGC5 / pXMJ19-FprA A200T overexpressing mutant FprA was obtained, as well as the control strain SCgGC5 / pXMJ19. The primers used in this example were the same as those in Example 1.

[0072] The above strains were subjected to fermentation tests. First, the strains were inoculated into the seed medium and cultured for 8 h. The culture was used as a seed and inoculated into a 24-well plate containing 800 μL of fermentation medium in each well. The initial OD 600The control was about 0.5, the shaking speed of the orifice plate shaker was 800 rpm, there were 3 replicates for each strain, the culture was carried out at 30 °C, 5 g / L urea was added at 20 h and 23 h, the fermentation ended at 25 h, the L-glutamic acid production and glucose consumption were detected, and the sugar-acid conversion rate from glucose to L-glutamic acid was calculated, as shown in Table 5.

[0073] Table 5 L-glutamic acid production and sugar-acid conversion rate of different strains

[0074] Strain L-glutamic acid (g / L) Sugar acid conversion rate (g / g, %) SCgGC5 / pXMJ19 5.53±0.31 7.55±0.41 <![CDATA[SCgGC5 / pXMJ19-FprA A200T > 6.57±0.12 8.64±0.10

[0075] It can be seen from the table that overexpression of the FprA mutant can significantly improve the L-glutamic acid production and sugar-acid conversion rate, and has good application prospects in the production of L-glutamic acid and its derivatives.

Claims

1. A Corynebacterium glutamicum for producing L-glutamic acid, characterized in that, The activity of NADP-ferredoxin reductase in the strain is enhanced, and the L-glutamic acid production and conversion rate of the strain are increased compared with the starting strain; and the starting strain is a Corynebacterium glutamicum strain that produces L-glutamic acid; The enhancement of the activity is achieved by overexpressing the coding gene of NADP-ferredoxin reductase with the sequence shown in SEQ ID NO: 3 in the strain, or introducing a mutation of NADP-ferredoxin reductase with the sequence shown in SEQ ID NO: 3 in the strain, and the mutation is that alanine at the 200th position of NADP-ferredoxin reductase corresponding to the sequence shown in SEQ ID NO: 3 is replaced by threonine; or causing a mutation in NADP-ferredoxin reductase with the sequence shown in SEQ ID NO: 3 in the strain and enhancing its transcriptional expression, and the mutation is that alanine at the 200th position of NADP-ferredoxin reductase corresponding to the sequence shown in SEQ ID NO: 3 is replaced by threonine.

2. The Corynebacterium glutamicum according to claim 1, characterized in that, The starting strain is selected from Corynebacterium glutamicum ATCC13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, or a strain that produces L-glutamic acid prepared from the above strains.

3. The Corynebacterium glutamicum according to claim 2, characterized in that, The Corynebacterium glutamicum is based on Corynebacterium glutamicum ATCC 13869, and further includes that one or more of the following genes are attenuated or have reduced expression: a. The odhA gene encoding α-ketoglutarate dehydrogenase; b. The sucA gene encoding succinate dehydrogenase.

4. The Corynebacterium glutamicum according to claim 3, characterized in that, The Corynebacterium glutamicum further includes that one or more of the following genes are enhanced or overexpressed: a. The pyc gene encoding pyruvate carboxylase; b. The gdh gene encoding glutamate dehydrogenase; c. The gltA gene encoding citrate synthase; d. The fxpk gene encoding transketolase phosphate; e. The ppc gene encoding phosphoenolpyruvate carboxylase; f. The pitA gene encoding a phosphate transporter; g. The yggB gene encoding a mechanosensitive channel protein.

5. The Corynebacterium glutamicum according to claim 4, characterized in that, The alanine at the 111th position of the NCgl1221 gene or its homologous gene BBD29_06760 or yggB in the Corynebacterium glutamicum is replaced by valine.

6. A method for producing L-glutamic acid, characterized in that, Including culturing the Corynebacterium glutamicum according to any one of claims 1 to 5 to produce L-glutamic acid, and further including the steps of separating, extracting or recovering L-glutamic acid from the culture medium.

7. Application of enhanced activity of NADP-ferrodoxin reductase in increasing L-glutamic acid production and conversion rate of Corynebacterium glutamicum, characterized in that, The enhancement of the activity is achieved by overexpressing the coding gene of NADP-ferredoxin reductase with the sequence shown in SEQ ID NO: 3 in the starting strain, or introducing a mutation in NADP-ferredoxin reductase with the sequence shown in SEQ ID NO: 3 in the starting strain, or causing a mutation in NADP-ferredoxin reductase with the sequence shown in SEQ ID NO: 3 in the starting strain and enhancing its transcriptional expression; The mutation is that alanine at the 200th position of NADP-ferrodoxin reductase whose amino acid sequence corresponds to the sequence shown in SEQ ID NO: 3 is replaced by threonine; and the starting bacterium is a Corynebacterium glutamicum strain that produces L-glutamic acid.