A linear displacement isothermal amplification method and its application

Abstract

The present invention discloses a linear displacement isothermal amplification method and its application. The linear displacement isothermal amplification (LDIA) method of the present invention specifically initiates the initial reaction of LDIA with four commonly used primers for the template, including a pair of outer primers (LOF and LOR) and inner primers (LIF and LIR), and an accelerating primer (LAR) can also be added to the reaction to form a short sequence product. The method of the present application can significantly reduce the difficulty of primer design while maintaining a sensitivity and specificity similar to other isothermal amplification reactions such as loop-mediated isothermal amplification methods. It has a good application prospect in on-site detection, especially when dealing with complex nucleic acid sequences.

Description

Technical Field

[0001] The invention belongs to the technical field of isothermal amplification, and in particular relates to a linear displacement isothermal amplification method and application thereof. Background Art

[0002] In the field of life sciences, nucleic acid amplification technology is currently a widely used technology for clinical disease diagnosis. Polymerase chain reaction (PCR) is the most common method of nucleic acid amplification. Its primer design is relatively simple and easy to apply to different pathogen detection. However, due to its requirements for reaction temperature and reaction instruments, it is difficult to apply to on-site detection. Compared with PCR, isothermal amplification methods such as loop-mediated isothermal amplification (LAMP), cross primer amplification (CPA), recombinase polymerase amplification (RPA), etc., have great advantages in on-site detection applications because they do not require complex temperature control instruments. However, strict target requirements and complex primer design processes limit their amplification range. Taking LAMP as an example, when faced with fragments less than 200bp in length or fragments with too high or too low GC content, its amplification efficiency will be greatly limited. In addition, multiple pairs of primers and complex stem-loop structures may lead to the formation of primer dimers, resulting in nonspecific amplification and false positives.

[0003] Therefore, establishing an isothermal amplification method suitable for detecting nucleic acid fragments of different lengths and different GC contents and simplifying the primer process has important application value and research significance. Summary of the invention

[0004] The present invention aims at an isothermal amplification method which is suitable for detecting nucleic acid fragments of different lengths and different GC contents and has simpler primer design.

[0005] The technical solution adopted by the present invention is:

[0006] A first aspect of the present invention provides a linear displacement isothermal amplification method, which specifically comprises the following steps:

[0007] (1) Hybridizing the outer primers LOF, LOR, inner primers LIF, and LIR with the target sequence, forming single-stranded DNA under the catalysis of the outer primers and polymerase, and forming short double-stranded DNA under the action of the inner primers;

[0008] (2) The short double-stranded DNA undergoes dynamic dissociation and is amplified under the catalysis of the inner primer and polymerase to form new amplification products;

[0009] (3) Steps (1) and (2) are repeated to obtain a large amount of amplified products.

[0010] Preferably, an accelerating primer LAR is added in step (1); the LAR is located between LIF and LIR, and the region where LAR binds to the target does not overlap with the region where LIF and LIR bind to the target, wherein the accelerating primer LAR is further amplified with the inner primer LIF or the inner primer LIR to form an amplification product with a shorter sequence.

[0011] Preferably, the molar ratio of the outer primer LOF, the outer primer LOR, the inner primer LIF, and the inner primer LIR is (1-2):(1-2):(4-10):(4-10):(3-4).

[0012] Preferably, the amplification condition is: 60-66°C.

[0013] Preferably, the Tm value of the outer primer and the inner primer is 50-70°C.

[0014] Preferably, the length from the 5' end of LIF to the 5' end of LIR is 60-160 bp.

[0015] Preferably, the length from the 3' end of LOF to the 5' end of LIF is 0-60 bp.

[0016] Preferably, the target sequence is 100 to 200 bp in length.

[0017] Preferably, the GC content of the target sequence is 35-70%.

[0018] Between 60℃-70℃, double-stranded DNA is in the process of dissociation and semi-dissociation. Therefore, under the action of BST enzyme, the primers can bind without the double strands being completely unwound (denaturation at 95℃), thus eliminating the need for denaturation and annealing processes of traditional PCR.

[0019] It is also because there is no temperature change process that 1: the reaction saves the time required for heating and cooling; 2: isothermal amplification is in a state of continuous reaction, while PCR will only start extension when the system is around 72°C, so the isothermal amplification reaction efficiency in the present invention is higher.

[0020] Preferably, the primer set sequence includes any one of (A) to (C):

[0021] (A)

[0022] Outer Primers:

[0023] gE-LOF:ACGAGCCCCGCTTCCA;

[0024] gE-LOR: AGATGCAGGGCTCGTACA;

[0025] Internal primers:

[0026] gE-LIF:CGCGCTCGGCTTCCACT;

[0027] The sequence of gE-LIR is:

[0028] AGACCACGCGCGGCATCAG; or

[0029] GCGCGAGTCGCCCATGTC; or

[0030] AGCGTGGCGGTAAAGTTCT; or

[0031] CGTAGTACAGCAGGCACCG;

[0032] Acceleration Primer:

[0033] LAR:TGTCCCCGGGCGAGAAGA;

[0034] (B)

[0035] Outer Primers:

[0036] LOF:CTGGATGATGATTGGTTCAG;

[0037] LOR:GAAGGGACGCTATGTCGA;

[0038] Internal primers:

[0039] LIF: TTATCAGATACCTATGCATACCCA;

[0040] The sequence of LIR is:

[0041] TGAACATGAGCTTTTCTTTATCGC; or

[0042] AACATCATCTTCCCGATA; or

[0043] TCCGGGTAATTTCTTCAACATC;

[0044] Acceleration Primer:

[0045] LAR: TACAAATAATCGCCCGTAGCTGAT;

[0046] (C)

[0047] Outer Primers:

[0048] LOF: GGCCCTCGCATCCCTGA;

[0049] LOR:ACGCGGTCTCGAAGCA;

[0050] Internal primers:

[0051] LIF:TGGTGAACGTGTCCGAGGGC;

[0052] The sequence of LIR is:

[0053] CGGGCAGGAACGTCCAGATC.

[0054] Preferably, the target sequence is a DNA or RNA sequence.

[0055] The second aspect of the present invention provides a primer set, comprising the primers described in the first aspect of the present invention.

[0056] The third aspect of the present invention provides a detection product, comprising the primer set described in the second aspect of the present invention.

[0057] Preferably, the detection product comprises a fluorescent probe / fluorescent dye.

[0058] Preferably, the fluorescent probe includes: an OSD probe.

[0059] Preferably, the LAR primer is further extended and labeled with a fluorescent group at the 5' end, and a complementary primer labeled with a quencher group at the 3' end is designed to form an OSD probe.

[0060] Preferably, the sequence of the OSD probe is:

[0061] gE-LAR-probe: ATCAGGTCGAACGTGTCCCCGGGCGAGAAGA;

[0062] gE-LAR-quencher:GGGGACACGTTCGACCTGAT.

[0063] Preferably, the fluorescent dye includes any one of Eva Green, SYBR Green and SYTO9.

[0064] The fourth aspect of the present invention provides the use of the primer set described in the third aspect of the present invention or the product described in the fourth aspect of the present invention in on-site detection.

[0065] Preferably, the applications include: detection of microorganism, virus, bacterial resistance genes, species identification, gene screening, etc.

[0066] The beneficial effects of the present invention are:

[0067] The present invention provides a linear displacement isothermal amplification (LDIA) method. Specifically, the initial reaction of LDIA is initiated by four commonly used primers for the template, including a pair of outer primers (LOF and LOR) and inner primers (LIF and LIR). An accelerating primer (LAR) can also be added to the reaction to form a short sequence product. The method of the present application can significantly reduce the difficulty of primer design while maintaining a sensitivity and specificity similar to other isothermal amplification reactions such as loop-mediated isothermal amplification methods; it can be applied to target sequences with higher GC content and less than 200bp. It has a good application prospect in on-site detection, especially when dealing with complex nucleic acid sequences. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 This is the LDIA reaction principle.

[0069] Figure 2 Note: M: 50bp ladder marker; 1: reaction system with external primers; 2: reaction system without external primers.

[0070] Figure 3 The results of sequencing of the reaction products.

[0071] Figure 4 In the case of the presence of outer primers, different inner primers are used for the reaction. Note: 1: LIR1; 2: LIR2; 3: LIR3; 4: LIR4.

[0072] Figure 5 In the case of no outer primers, different inner primers were used to perform the reaction. Note: 1: LIR1; 2: LIR2; 3: LIR3; 4: LIR4.

[0073] Figure 6 This is the LAR acceleration effect. Note: 1: Acceleration primers were added; 2: Acceleration primers were not added.

[0074] Figure 7 Optimize the results for reaction temperature.

[0075] Figure 8 This is a LDIA reaction sensitivity test. Note: 1-7:10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 1 copy plasmid template; 8: negative control; Figure 8 A: LDIA sensitivity test; Figure 8 B: LAMP sensitivity test.

[0076] Fig. 9 This is a test for the specificity of LDIA reaction. Note: 1:10 6 Amplification curve of the copy plasmid template LAMP method; 2: negative control group of the LAMP method; 3: 10 6 Amplification curve of the copy plasmid template LDIA method; 4: Negative control group of the LDIA method.

[0077] Fig.10 To use different inner primers for the reaction. Note: 1: LIR1; 2: LIR2; 3: LIR3.

[0078] Fig.11 This is the LAR acceleration effect. Note: 1: Acceleration primers were added; 2: Acceleration primers were not added.

[0079] Fig.12 This is a LDIA reaction sensitivity test. Note: 1-7:10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 1 copy plasmid template; Fig.12 A: LDIA sensitivity test; Fig.12 B: LAMP sensitivity test.

[0080] Fig.13 This is a test for the specificity of LDIA reaction. Note: 1:10 6 Amplification curve of the copy plasmid template LAMP method; 2: negative control group of the LAMP method; 3: 10 6 Amplification curve of the copy plasmid template LDIA method; 4: Negative control group of the LDIA method.

[0081] Fig.14 This is the application of OSD probe in LDIA method.

[0082] Fig.15 Comparison between OSD probe primer and original NAR primer; Note: 1: LAR; 2: OSD probe primer.

[0083] Fig.16 This is the OSD probe method LDIA sensitivity test. Note: 1-7: 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 1 copy plasmid template; 8: negative control.

[0084] Fig.17 The results of 200bp gE gene LAMP primer design.

[0085] Fig.18 Primer design results for LDIA.

[0086] Fig.19 The results of LAMP primer design for rabies virus gE gene sequence.

[0087] Fig. 20 The results of PCR primer design for rabies virus gE gene sequence.

[0088] Fig.21 Results of LAMP primer design for the Salmonella fimW gene sequence.

[0089] Fig. 22 The results of PCR primer design for the Salmonella fimW gene sequence. DETAILED DESCRIPTION

[0090] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0091] Example 1

[0092] The present invention constructs an isothermal amplification method suitable for detecting nucleic acid fragments of different lengths and different GC contents and simplifies the primer process - linear displacement isothermal amplification (LDIA) method; in this method, four common primers for the template initiate the initial reaction of LDIA, including a pair of outer primers (LOF and LOR) and inner primers (LIF and LIR). Since the concentration of the inner primer in the mixture is higher than that of the outer primer, it is easy to be bound to the template and amplified with the template. Single-stranded DNA (ssDNA) is formed with the help of the extended outer primer and the strand displacement activity of BST DNA polymerase. Short double-stranded DNA (dsDNA) is formed by the inner primer. At a temperature of 60°C, these short DNA chains (40-120bp) will undergo a double-stranded DNA breathing process, that is, they are in a dissociated and semi-dissociated state. Subsequently, LIF and LIR are annealed to dsDNA respectively and new amplicons are generated. These dsDNAs will continuously become new templates and initiate a cyclic reaction. According to this principle, an accelerating primer (LAR) is added to the reaction to form a shorter product (40-60bp) with LIF or LIR. Subsequently, more amplicons will be generated ( Figure 1The innovation of the present invention is to simplify the primers for isothermal amplification. In the prior art, all the isothermal amplification primers required special structures, but the applicant unexpectedly found that linear primers that do not require special structures can also achieve isothermal amplification under certain combinations.

[0093] LDIA method primer design principles:

[0094] 1. Tm value: effective starting temperature, generally 5-10°C higher than Tm value. If the Tm value of the primer is estimated according to the formula Tm=4(G+C)+2(A+T), the Tm value of the effective primer is 55-70°C, and the best condition is when the Tm value is close to 60°C.

[0095] 2. Primer end stability: The 3' end Gibbs free energy ΔG of all primers is ≤ -4 kcal / mol.

[0096] 3. GC content of the target: Too high or too low GC content is not conducive to initiating the reaction. The GC content of LOF / LOR / LIF / LIR primers should not differ too much and should be between 35-70%.

[0097] 4. Secondary structure: It should be noted that the primer itself cannot form a secondary structure, especially for the inner primer. It is particularly important to design the primer so that it does not form a secondary structure. Because the secondary structure will not only affect the reaction efficiency but also cause some non-specific amplification. In order to prevent the formation of primer dimers, it is also important to ensure that the 3' end is not complementary. If manual judgment is used, the continuous complementary bases of the primer itself or between primers cannot be greater than 3bp. Avoid having 3 G or 3 C arranged in a string at the 3' end of the primer. The last base at the 3' end should preferably be T, C, G, rather than A. If primer dimers and hairpin structures are unavoidable, the △G value should be kept as low as possible (should be less than 4.5kcl / mol).

[0098] 5. Primer distance: The length from the 5' end of LIF to the 5' end of LIR is 60-160bp; the length from the 3' end of LOF to the 5' end of LIF is 0-60bp. The position of LAR is between LIF and LIR, and the region where LAR binds to the target does not overlap with the region where LIF and LIR bind to the target.

[0099] The primers of the LDIA method can be designed using the design software Primer Premier 5 of common PCR. When the primers meet the Tm value close to 60°C and do not generate primer dimers and secondary structures, the target with a length of 100-200bp and a GC content of 35%-70% can be amplified. In contrast, the primers of the LAMP method need to screen 6 regions of the target, and the length of the primers themselves and the distance requirements between the primers make the primer design more complicated, so it is difficult to design a primer set for a target sequence below 200bp for amplification. In addition, the LAMP method is also difficult to design primers when facing target sequences with high GC content (greater than 60%) and low GC content (less than 40%). Therefore, relative to LAMP, the primer design method in the present invention is simpler and can be used to detect shorter target sequences.

[0100] Example 2

[0101] 1. The applicant designed a primer set for the LDIA method using the gE gene of pseudorabies virus (PRV) (GenBank: KT936468.1) as the target gene (Table 1).

[0102] LDIA and LAMP system: The concentrations of the components in each 25 μl system are as follows: 1×Thermopol Isothermalbuffer, 1×Eva Green, 1.6 mM dNTPs, 8 U Bst WarmStart DNA polymerase. The concentrations of LDIA primers are as follows: 1.6 μM LIF / LIR, 0.8 μM LAR, and 0.2 μM LOF / LOR. The concentrations of LAMP primers are as follows: 1.6 μM FIP / BIP, 0.8 μM LF, and 0.2 μM F3 / B3. Both LDIA and LAMP reactions were performed at 63°C for 60 minutes.

[0103] Table 1 Primer sets for LDIA and LAMP methods targeting PRV gE gene

[0104]

[0105] First, the necessity of the external primers for the LDIA method was evaluated. The applicant used Eva Green dye to monitor the reaction in real time. In the presence of external primers, the reaction proceeded normally, but in the absence of external primers, the reaction failed to produce an amplification signal. The reaction products were analyzed by PAGE gel electrophoresis, and a band of the expected size (80 bp) and a subsequent ladder-like band ( Figure 2 ). Subsequently, the 80 bp reaction product was sequenced and its sequence was consistent with the expectation ( Figure 3), further verifying the reaction principle. This shows that the outer primer is essential for the normal progress of the reaction.

[0106] Secondly, the applicant analyzed the applicability of LDIA to target genes of different lengths. The length of the product generated by LIF and LIR1, LIR2, LIR3, and LIR4 gradually increased, and the product lengths were 67 (751 minus 684, i.e., the 5' end of LIF to the 5' end of LIR1), 87, 107, and 155 bp, respectively. It can be seen that when the reaction product length is 155 bp, the reaction can still proceed smoothly ( Figure 4 However, when the reaction is not carried out with the participation of external primers, once the reaction product exceeds 100 bp, the reaction is difficult to start ( Figure 5 ).

[0107] In order to speed up the reaction efficiency of LDIA, the applicant tried to promote it by adding additional accelerating primers. According to the LDIA principle, it is speculated that the enhanced generation of short products or the formation of dsDNA denaturation bubbles may accelerate the reaction. By adding the short chain products formed by the accelerating primers LAR and LIF, denaturation bubbles are easily formed, and the cycle number (CT) for the LDIA reaction signal to reach the threshold is significantly reduced ( Figure 6 ). This proves that further adding accelerating primers can effectively accelerate LDIA, which is consistent with the applicant's speculation that shorter products are beneficial to improving LDIA reaction efficiency.

[0108] 2. Effect of reaction temperature on LDIA method

[0109] The applicant analyzed the effect of high temperature on LDIA, and it was reported that LDIA played an active role in the formation of dsDNA denaturation bubbles. Considering that the inactivation temperature of Bst DNA polymerase is about 80°C, in order to balance high temperature and enzyme activity, the applicant set the test temperature range to 60-75°C. The reaction results showed that 63°C was the optimal temperature for the reaction ( Figure 7 ).

[0110] Example 3 Sensitivity and specificity test of LDIA method

[0111] (1) Sensitivity

[0112] The applicant used 10-fold gradient dilution of dsDNA as a template to evaluate the sensitivity of LDIA. The primer information is shown in Table 1. The inner primer used was LIR4. At the same time, a LAMP method targeting the same region of the gene was designed for comparison. Because the LAMP method is not suitable for amplifying too short target genes, the target gene length of the LAMP method (Table 1) is 200 bp. The results showed that the minimum detection limit of LDIA was 100 copies / μL, which is comparable to the sensitivity of LAMP ( Figure 8 ).

[0113] (2) Specificity

[0114] The applicant conducted a specificity test on LDIA and compared it with the LAMP method. The results showed that when the amplification reaction of the positive group was normal, the negative group would not produce nonspecific signals after a long incubation period, showing good specificity ( Fig. 9 ). Therefore, the sensitivity and specificity of the LDIA method are comparable to those of the LAMP method. In addition, the negative group of the LDIA method showed a lower background signal than the negative group of the LAMP method, which may be related to its simple primer composition, because LAMP requires circular primers (FIP\BIP), and the LDIA uses linear primers, and the design conditions are easier to meet than circular primers.

[0115] (3) Primer design

[0116] The applicant found that it was difficult to design LAMP primers for the gE gene using the online PrimerExplorer software. Because the GC content of the gene is high, only two sets of suitable PRV LAMP primers can be generated using the software. Therefore, compared with LAMP, another advantage of LDIA is that the primer design process is simple.

[0117] (4) Generality test

[0118] Subsequently, the LDIA method was used to detect the fimW gene of Salmonella (GenBank: 1252072) to verify the universality of the LDIA method. Primers for the LDIA method were designed for the fimW gene (Table 2).

[0119] Table 2 Primer sets for LDIA and LAMP methods targeting the fimW gene of Salmonella

[0120]

[0121] It was demonstrated that the LDIA method can amplify sequences with a length of 80bp-140bp ( Fig.10 ). Similarly, the accelerating primer LAR can also significantly promote the reaction ( Fig.11 ). The sensitivity of the LDIA method is consistent with that of the LAMP method ( Fig.12 ), good specificity ( Fig.13 ).

[0122] Example 3 LDIA method combined with fluorescent probe

[0123] Considering that all primers in the LDIA method are common linear structures, the applicant believes that oligonucleotide strand exchange (OSD) probes may be well combined with them. Fig.15 As shown, increasing the length of the LAR primer to 30 bp did not inhibit the reaction. This 31 bp LAR primer was named gE-LAR-probe (ATCAGGTCGAACGTGTCCCCGGGCGAGAAGA (SEQ ID NO.9)) and labeled with a FAM fluorescent group at the 5' end, and a 20 bp complementary primer (gE-LAR-quencher) (GGGGACACGTTCGACCTGAT (SEQ ID NO.10)) was labeled with a BHQ1 quencher group at the 3' end to form a pair of OSD probes (Table 1). Due to the strong complementarity between the two probes, only stable amplification can exchange the quencher probe and generate signal output ( Fig.14 In the LDIA method, when the OSD probe is added to the reaction system, a typical amplification curve can be detected. Its sensitivity is the same as that of the Eva Green dye method ( Fig.16 ).

[0124] Example 4 Design of LDIA Primers for 200 bp Target Sequence of gE Gene

[0125] (1) LDIA primer design for short sequence targets

[0126] A 200 bp sequence in the gE gene was used for LAMP primer design and LDIA primer design. The LAMP primer design software could not design suitable primers ( Fig.17 ), and 11 pairs of upstream and downstream primers can be obtained using PCR primer design software ( Fig.18 ), among which a set of LDIA primers can be easily screened out according to the LDIA primer design principles (as shown in Table 3).

[0127] Table 3

[0128] Primer name Primer sequence (5'-3') LIF TGGTGAACGTGTCCGAGGGC(SEQ ID NO.22) LIR CGGGCAGGAACGTCCAGATC(SEQ ID NO.23) LOF GGCCCTCGCATCCCTGA(SEQ ID NO.24) LOR ACGCGGTCTCGAAGCA(SEQ ID NO.25)

[0129] (2) LDIA primer design for high GC and low GC content targets (targeting GC content)

[0130] The sequence of pseudorabies virus gE gene (GC content 74%) was used for LAMP primer design and LDIA primer design. Only two sets of primers were designed using LAMP online software ( Fig.19 ), and more than 100 pairs of primers can be designed using PCR primer design software ( Fig. 20), according to the principle of LDIA primer design, 8 suitable LDIA primer sets (LIF and LIR combinations) can be preliminarily screened out (as shown in Table 4). A 253 bp (139-391) sequence of the Salmonella fimW gene (GC content 42%) was used for LAMP primer design and LDIA primer design. Only 3 sets of usable LAMP primers were designed using the LAMP online software ( Fig.21 ), but 51 pairs of PCR primers can be designed using PCR primer design software ( Fig. 22 ), 9 sets of LDIA primer sets can also be obtained through simple screening (as shown in Table 5).

[0131] Table 4 LDIA primer sets for pseudorabies virus gE gene

[0132]

[0133]

[0134] Table 5 LDIA primer sets for Salmonella fimW gene

[0135]

[0136] In summary, compared with LAMP, the primer design method in LDIA of the present invention is simpler, more specific, and can be applied to target sequences with higher GC content and less than 200 bp.

[0137] The above specific implementations have been described in detail for the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A primer set, characterized in that: The primer set comprises an outer primer, an inner primer, and an accelerating primer; the primer set is selected from any one of (A) to (B): (A) Outer Primers: gE-LOF:ACGAGCCCCGCTTCCA; gE-LOR: AGATGCAGGGCTCGTACA; Internal primers: gE-LIF:CGCGCTCGGCTTCCACT; The sequence of gE-LIR is: AGACCACGCGCGGCATCAG; or GCGCGAGTCGCCCATGTC; or AGCGTGGCGGTAAAGTTCT; or CGTAGTACAGCAGGCACCG; Acceleration Primer: LAR:TGTCCCCGGGCGAGAAGA; (B) Outer Primers: LOF:CTGGATGATGATTGGTTCAG; LOR:GAAGGGACGCTATGTCGA; Internal primers: LIF: TTATCAGATACCTATGCATACCCA; The sequence of LIR is: TGAACATGAGCTTTTCTTTATCGC; or AACATCATCTTCCCGATA; or TCCGGGTAATTTCTTCAACATC; Acceleration Primer: LAR: TACAAATAATCGCCCGTAGCTGAT.

2. The primer set according to claim 1, characterized in that: The (A) further comprises a probe; The probe is: gE-LAR-probe: ATCAGGTCGAACGTGTCCCCGGGCGAGAAGA; gE-LAR-quencher:GGGGACACGTTCGACCTGAT.

3. A linear displacement isothermal amplification method, characterized in that: The specific steps include: (1) Hybridizing the outer primers LOF, LOR, inner primers LIF, and LIR with the target sequence, forming single-stranded DNA under the catalysis of the outer primers and polymerase, and forming short double-stranded DNA under the action of the inner primers; (2) The short double-stranded DNA undergoes dynamic dissociation and is amplified under the catalysis of the inner primer and polymerase to form new amplification products; (3) Steps (1) and (2) are repeated to obtain a large amount of amplification products; wherein, in step (1), an accelerating primer LAR is added; the LAR is located between LIF and LIR, and the region where LAR binds to the target does not overlap with the region where LIF and LIR bind to the target; The molar ratio of the outer primer LOF, the outer primer LOR, the inner primer LIF, the inner primer LIR, and the acceleration primer LAR is (1-2):(1-2):(4-10):(4-10):(3-4); the amplification temperature is 60-66°C; the length from the 5' end of LIF to the 5' end of LIR is 60-160 bp; the length from the 3' end of LOF to the 5' end of LIF is 0-60 bp; The length of the target sequence is 100-200 bp; the GC content of the target sequence is 35-70%; The sequences of the outer primer LOF, the outer primer LOR, the inner primer LIF, and the inner primer LIR are as shown in the primer set of claim 1; The method is not for the purpose of disease diagnosis or treatment; The polymerase is BST DNA polymerase.

4. A detection product, characterized in that: Comprising the primer set according to claim 1 or 2.

5. Use of the primer set according to claim 1 or 2, or the detection product according to claim 4, in the preparation of products for pathogenic microorganism detection and gene detection.

Images