A gene for identifying Ralstonia solanacearum causing casuarina wilt and a specific detection method
By comparing the whole genome data of Casuarine C. aphrodisiacs, screening specific gene fragments and designing specific primers, establishing PCR detection methods, solving the problem of lack of fast, accurate and simple detection methods in the existing technology, achieving high accuracy and sensitivity detection, which is suitable for early monitoring and prevention.
Patent Information
- Application Number
- CN202211490312.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-25
- Publication Date
- 2025-06-17
- Estimated Expiration
- 2042-11-25
AI Technical Summary
The existing technology lacks fast, accurate and simple detection methods for casuarina vermicelli, which makes it difficult to early monitoring and control.
By comparing and analyzing the whole genome data of the Casuaria Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia Chrysanthesia
The specific detection of Casuarina vermis is achieved, with high accuracy, repeatability and sensitivity, and can complete the detection within 6 hours. It is suitable for early monitoring and prevention.
Smart Images

Figure CN116004868B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology. More specifically, it relates to a gene for identifying Ralstonia solanacearum causing casuarina wilt and a specific detection method therefor. Background Art
[0002] Casuarina equisetifolia is an excellent pioneer tree species for windbreak and sand fixation in the coastal areas of Guangdong, China. It has special functions such as drought tolerance, humidity tolerance, wind resistance, sand fixation, salt tolerance and biological nitrogen fixation (with endophytic and ectomycorrhizal fungi), and fast growth, thus becoming an important ecological protection forest and plantation tree species.
[0003] Casuarina wilt is the most serious bacterial disease that harms Casuarina equisetifolia. It destroys the conductive tissue of the host tree, causing the whole plant to wither. Ralstonia solanacearum causing casuarina wilt is known as the "plant cancer", and there is no good control method so far. And "early detection" is crucial for the prevention and control of casuarina wilt.
[0004] Therefore, establishing a rapid, accurate and simple detection technology for casuarina wilt is an urgent problem to be solved for preventing the spread of Ralstonia solanacearum causing casuarina wilt. Summary of the Invention
[0005] The object of the present invention is to provide a gene for identifying Ralstonia solanacearum causing casuarina wilt and its application.
[0006] Another object of the present invention is to provide a specific detection kit for Ralstonia solanacearum causing casuarina wilt.
[0007] Another object of the present invention is to provide a specific detection method for Ralstonia solanacearum causing casuarina wilt.
[0008] The above objects of the present invention are achieved by the following technical solutions:
[0009] Through whole-genome data comparison analysis, screening and research on the existing Ralstonia solanacearum causing casuarina wilt, the present invention obtains specific gene fragments of Ralstonia solanacearum causing casuarina wilt, and uniquely designs specific primers based on these fragments and establishes a specific PCR detection method for Ralstonia solanacearum causing casuarina wilt, which can specifically and sensitively distinguish Ralstonia solanacearum causing casuarina wilt from other Ralstonia solanacearum strains of phylotype I, so as to be used for early monitoring of casuarina wilt. Therefore, the present invention provides the following solutions:
[0010] A gene for identifying Ralstonia solanacearum causing casuarina wilt, the sequence of which is shown in SEQ ID NO.1:
[0011] GAGCGTTGAAGTGCCTGGTCTCTTGAAGACAACAGGACACATTGCTCTTGCAGGTCGTTCGCCCGCTGCCCTGGCCGAACTCATCACCAAGAAGCTACGAAAAGCCGGTGTACGCCTGAAGCAGGCCTTTTCGTACTCGGATGAGGCCAAGGCAGATGTGGACTTCCCGCTAAAGAACGGAAACAAAATCGCCGGTCTCATTAAGGCGATGAAGACCTACAACTGGTATCAGCAGAATCCGGCCGTCGTGGCCGTACTGGAACTCGATTGGGGCAAGGTCAGTGCTGACGAAGCCTTTGTGCTGGGTCGCAATCTATATCAATGCGCATGTGGAAACGAGAATCGGGCGGTCGCGTTCTTGGACAAGCTGCGTCAGGAGTTGGCTTCCATTCCAATCGAGCGGGCGCTCGATATGTTGAACGGAATGTTCTTCGAGGTCTACTTCAATGCTGCTGGCGAGTTCCGCTCCGGCAAGATCAAGGGACGGTGTTTGGAGAAGTTGCTGGCTATTCAAACGGTGAAGAAGTACGAGCCCGCAATGCTATTCATCCAACGGACGCTTGAACCGTATCGTGACGAGCTTCCTTTTGTTCCTTCCACCGCACCTCAGGAAGTGGTCGTGGAGTTGAGCGTTAAGCGGAGTGCGCCACCTCTCGTTAAGGCGCTGACGATTGGGGAACGCAGTCTGCTGAGTGAAGACAAGGACAACGATAGCCCAGACG
[0012] Use of the said gene in detecting and identifying Ralstonia solanacearum of Casuarina equisetifolia or monitoring bacterial wilt of Casuarina equisetifolia.
[0013] Use of a reagent for detecting the said gene in detecting and identifying Ralstonia solanacearum of Casuarina equisetifolia or preparing a detection product.
[0014] Use of a reagent for detecting the said gene in monitoring bacterial wilt of Casuarina equisetifolia or preparing a monitoring product.
[0015] A specific detection primer set for Ralstonia solanacearum causing casuarina wilt, which is a specific primer that can distinguish the genome of Ralstonia solanacearum causing casuarina wilt from other Ralstonia solanacearum genomes. This primer set is the specific primer set IW-F4 and IW-R4, and the size of the amplified fragment corresponding to this primer set is 722 bp. The primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3 respectively.
[0016] Forward primer IW-F4 (SEQ ID NO.2): 5’-GAGCGTTGAAGTGCCTGGTCT-3’
[0017] Reverse primer IW-R4 (SEQ ID NO.3): 5’-AGGACAACGATAGCCCAGACG-3’.
[0018] A specific detection kit for Ralstonia solanacearum causing casuarina wilt, which contains reagents for specifically detecting the said gene.
[0019] Preferably, the said reagent is a PCR primer.
[0020] Preferably, the said PCR primer is the primer set shown in SEQ ID NO.2 and SEQ ID NO.3 above.
[0021] More preferably, the said kit further includes reagents required for PCR amplification.
[0022] A specific detection method for Ralstonia solanacearum causing casuarina wilt, which includes the following steps:
[0023] (1) Extract the DNA of the sample to be detected;
[0024] (2) Using the DNA as a template, perform PCR amplification with the kit according to any one of claims 6-9;
[0025] (3) If a specific product can be amplified, it is positive for Ralstonia solanacearum causing casuarina wilt.
[0026] Preferably, in step (2), the reaction system for PCR amplification includes: 1 μL of the sample DNA to be detected, 12.5 μL of 2×T5SuperPCR Mix, 1 μL of the upstream primer shown by IW-F4, 1 μL of the downstream primer shown by IW-R4, and 9.5 μL of double-distilled water.
[0027] Preferably, in step (2), the program for PCR amplification is: pre-denaturation at 98 °C for 3 minutes, denaturation at 98 °C for 15 seconds, annealing at 63.8 °C for 15 seconds, extension at 72 °C for 20 seconds, and perform 35 cycles of denaturation-annealing-extension; finally, extend at 72 °C for 5 minutes.
[0028] Preferably, in step (3), the PCR amplification product is detected by agarose gel electrophoresis. If a 722-bp band appears, it is determined to be positive for *Ralstonia solanacearum* of *Casuarina equisetifolia*.
[0029] The present invention has the following beneficial effects:
[0030] (1) The present invention fills the gap in the prior art that there are no specific detection primers for molecular PCR detection of *Ralstonia solanacearum* of *Casuarina equisetifolia*, achieving a zero breakthrough in the molecular monitoring technology of *Ralstonia solanacearum* of *Casuarina equisetifolia*;
[0031] (2) The present invention has strong specificity and high accuracy: After PCR amplification with the specific detection primers IW-F4 and IW-R4 for *Ralstonia solanacearum* of *Casuarina equisetifolia*, specific detection of *Ralstonia solanacearum* of *Casuarina equisetifolia* can be achieved;
[0032] (3) The present invention has good repeatability and high sensitivity: Repeatability and sensitivity are important indicators for pathogen detection, which is related to whether the PCR rapid detection technology can be directly applied to the inspection and quarantine of entry-exit plants and plant products. A large number of experiments confirm that the present invention has good repeatability. The target DNA only needs to be 200 pg / μL or the target bacterial liquid reaches a bacterial liquid concentration of 4×10 5 CFU / mL to detect and identify *Ralstonia solanacearum* of *Casuarina equisetifolia*;
[0033] 3. The operation of the present invention is simple and fast, and can be applied to the rapid detection of *Ralstonia solanacearum* of *Casuarina equisetifolia*; After extracting, PCR amplifying and performing conventional agarose electrophoresis on the genomic DNA of the sample to be tested by using the method of the present invention, the result can be determined. The whole detection process adopts a rapid DNA extraction method, with simple operation, without the need to isolate and culture the pathogen, greatly shortening the detection time. Generally, the whole detection process can be completed within 6 hours; Moreover, with the upgrade of the PCR detection technology, it is expected to be further simplified and the time can be shortened;
[0034] 4. The present invention has good applicability: The present invention detects samples artificially inoculated with different *Ralstonia solanacearum* strains and finds that after inoculation and onset, whether the plant is infected with *Ralstonia solanacearum* of *Casuarina equisetifolia* can be detected by using the plant leachate; At the same time, the present invention can specifically detect the *Ralstonia solanacearum* strains isolated from the western region of Guangdong. The present invention can be referred to for the prediction and forecast of the disease situation of *Ralstonia solanacearum* of *Casuarina equisetifolia* and in the identification of resistant varieties of *Ralstonia solanacearum* of *Casuarina equisetifolia*, which is of great significance for the prevention and control of *Ralstonia solanacearum* of *Casuarina equisetifolia*. At the same time, the establishment of the present invention system also provides technical guidance and theoretical basis for the detection of other pathogens. Description of the Drawings
[0035] Figure 1Using Primer Premier 6.0 and NCBI Primer-Blast, 4 pairs of primers: IW1, IW2, IW3, and IW4 were designed based on the screened specific gene temp_001930, and the annealing temperature conditions for the amplification effect of each pair of primers were optimized. In the figure, lane M is the 2000bp Marker, the annealing temperature of lane 1 is 53°C, the annealing temperature of lane 2 is 53.6°C, the annealing temperature of lane 3 is 54.2°C, the annealing temperature of lane 4 is 55.4°C, the annealing temperature of lane 5 is 56.8°C, the annealing temperature of lane 6 is 58.2°C, the annealing temperature of lane 7 is 59.7°C, the annealing temperature of lane 8 is 61.1°C, the annealing temperature of lane 9 is 62.6°C, the annealing temperature of lane 10 is 63.8°C, the annealing temperature of lane 11 is 64.4°C, and the annealing temperature of lane 12 is 65°C.
[0036] Figure 2 Screening and verification of specific primers for Ralstonia solanacearum of Casuarina equisetifolia. Using the DNA of the tested strains as templates, and using IW1, IW2, IW3, and IW4 as primers respectively, the specificity of the specific primers for Ralstonia solanacearum of Casuarina equisetifolia was verified by the established PCR detection amplification system and amplification program for Ralstonia solanacearum of Casuarina equisetifolia. In the figure, lane M is the 2000bp Marker, lane 1 is DHD47, lane 2 is NS25, lane 3 is WC5-2, lane 4 is ZC-Z-2, lane 5 is BH1, lane 6 is LZ-3, lane 7 is EP1, lane 8 is GMI1000, lane 9 is GS-1, lane 10 is GS-5, lane 11 is GS-6, lane 12 is SG-1-1, and lane 13 is Escherichia coli.
[0037] Figure 3 This is the amplification electrophoresis diagram for the sensitivity detection of the specific primers of the present invention. Figure 3 -a is the PCR sensitivity detection result of the specific primer pair for the genomic DNA of Ralstonia solanacearum NS25 of Casuarina equisetifolia. In the figure, lane M is the 2000bp Marker, lane 1 is 50 ng / μL, lane 2 is 25 ng / μL, lane 3 is 10 ng / μL, lane 4 is 5 ng / μL, lane 5 is 2 ng / μL, lane 6 is 1 ng / μL, lane 7 is 800 pg / μL, lane 8 is 500 pg / μL, and lane 9 is 200 pg / μL; Figure 3 -b is the sensitivity detection result of the specific primer pair for the bacterial solution PCR of Ralstonia solanacearum NS25 of Casuarina equisetifolia. In the figure, lane M is the 2000bp Marker, lane 1 is 4×10 7 CFU / mL, lane 2 is 1×10 7 CFU / mL, lane 3 is 4×10 6 CFU / mL, lane 4 is 2×10 6CFU / mL, lane 5 is 1×10 6 CFU / mL, lane 6 is 4×10 5 CFU / mL, lane 7 is 2×10 5 CFU / mL, lane 8 is 1×10 5 CFU / mL, lane 9 is 4×10 4 CFU / mL.
[0038] Figure 4 is the electrophoresis map of primer comparison PCR amplification; Figure 4 -a is the reported specific primer for Ralstonia solanacearum, Figure 4 -b is the PCR amplification electrophoresis map of the specific primer IW4 of Ralstonia solanacearum of the present invention. In the figure, lane M is 2000bp Marker, lane 1 is EP1, lane 2 is LZ-3, lane 3 is GMI1000, lane 4 is DHD47, lane 5 is NS25, lane 6 is A2, lane 7 is WC5-2, and lane 8 is the negative control.
[0039] Figure 5 is the PCR amplification electrophoresis map of the specific primer of Casuarina equisetifolia of the present invention after inoculating Casuarina equisetifolia with Ralstonia solanacearum. In the figure, lane M is 2000bp Marker, lane 1 is DHD47, lane 2 is NS25, lane 3 is A2, lane 4 is WC5-2, and lane 8 is the negative control.
[0040] Figure 6 is the applicability PCR detection of Ralstonia solanacearum of Casuarina equisetifolia collected in western Guangdong. Using the IW4 of the present invention as the specific primer for Ralstonia solanacearum of Casuarina equisetifolia, and the DNA of Ralstonia solanacearum of Casuarina equisetifolia collected and isolated in western Guangdong as the template, the established PCR detection amplification system and amplification program for Ralstonia solanacearum of Casuarina equisetifolia are used to verify the application of the specific primer for Ralstonia solanacearum of Casuarina equisetifolia. In the figure, the lanes from left to right are: lane M is 5000bp Marker, lane 1 is the positive control Ralstonia solanacearum of Casuarina equisetifolia NS25, lanes 2 - 6 are Ralstonia solanacearum of Casuarina equisetifolia WC4, WC5, WC6, WC7, WC8 isolated from Wuchuan, Zhanjiang, Guangdong, lanes 7 - 8 are Ralstonia solanacearum of Casuarina equisetifolia HTW2, HTW4 isolated from Haitouwan, Yangjiang, Guangdong, lane 9 is Ralstonia solanacearum of Casuarina equisetifolia XW3 isolated from Xuwen, Zhanjiang, Guangdong, lane 10 is Ralstonia solanacearum of Casuarina equisetifolia DHD47 isolated from Donghai Island, Zhanjiang, Guangdong, and lane 11 is the negative control. Detailed implementation manners
[0041] The present invention will be further described below in conjunction with the accompanying drawings of the specification and specific embodiments, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field.
[0042] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.
[0043] The microbial strains used in this article include:
[0044] Ralstonia solanacearum DHD47: isolated from Donghai Island, Zhanjiang, Guangdong
[0045] Ralstonia solanacearum NS25: isolated from Nansandao Forest Farm, Zhanjiang, Guangdong
[0046] Ralstonia solanacearum WC5-2: isolated from Wuchuan City, Zhanjiang, Guangdong
[0047] Ralstonia solanacearum A2: isolated from Hailing Island, Yangjiang, Guangdong
[0048] Ralstonia solanacearum WC4: isolated from Wuchuan City, Zhanjiang, Guangdong
[0049] Ralstonia solanacearum WC5: isolated from Wuchuan City, Zhanjiang, Guangdong
[0050] Ralstonia solanacearum WC6: isolated from Wuchuan City, Zhanjiang, Guangdong
[0051] Ralstonia solanacearum WC7: isolated from Wuchuan City, Zhanjiang, Guangdong
[0052] Ralstonia solanacearum WC8: isolated from Wuchuan City, Zhanjiang, Guangdong
[0053] Ralstonia solanacearum HTW2: isolated from Haitouwan, Yangdong District, Yangjiang, Guangdong
[0054] Ralstonia solanacearum HTW4: isolated from Haitouwan, Yangdong District, Yangjiang, Guangdong
[0055] Ralstonia solanacearum XW3: isolated from Xuwen County, Zhanjiang, Guangdong
[0056] Ralstonia solanacearum ZC-Z-2: isolated from Zengcheng, Guangdong
[0057] Ralstonia solanacearum BH1: isolated from Hainan Province
[0058] Ralstonia solanacearum LZ-3: isolated from Lianzhou, Qingyuan, Guangdong
[0059] Ralstonia solanacearum EP1: isolated from Guangzhou, Guangdong
[0060] Ralstonia solanacearum GMI1000: the type strain of Ralstonia solanacearum
[0061] Ralstonia solanacearum SG-1-1: isolated from Shaoguan, Guangdong
[0062] Pantoea GS-1: isolated from Wuchuan City, Zhanjiang, Guangdong
[0063] Pseudomonas GS-5: isolated from Xuwen County, Zhanjiang, Guangdong
[0064] Burkholderia sp. GS-6: Isolated from Haitou Bay, Yangdong District, Yangjiang, Guangdong
[0065] Escherichia coli: Purchased from TransGen Biotech Co., Ltd., Beijing
[0066] Example 1 Obtaining specific genes of Ralstonia solanacearum by means of bioinformatics research
[0067] In the present invention, for 116 groups of Ralstonia solanacearum genome data, the pan-genome analysis tool panaroo was used to construct orthologous gene clusters. Through comparison, screening, research and analysis, genes that are commonly owned by Ralstonia solanacearum and are specific to other strains of phylotype I were obtained.
[0068] Through comparative genomic analysis, most of the genes specific to the above-mentioned Ralstonia solanacearum are derived from horizontal gene transfer or exogenous DNA fragments absorbed through natural competence or phages. Most of these genes are not essential for the survival of Ralstonia solanacearum and are therefore easily lost. Genes encoding pathogenicity-related factors play an important role in the pathogenic process of Ralstonia solanacearum infecting hosts, are beneficial to the survival of Ralstonia solanacearum, and are more likely to stably exist in the genome. Therefore, primers were preferentially designed for the gene sequences encoding pathogenicity factors specific to Ralstonia solanacearum. By comparing with three mainstream pathogenicity factor databases, namely T3SE, VFDB, and PHI, the gene temp_001930 encoding a pathogenicity factor specific to Ralstonia solanacearum was finally screened, and a specific gene fragment for specifically detecting and identifying Ralstonia solanacearum was obtained, and the sequence is shown in SEQ ID NO.1.
[0069] Example 2 Design of specific primers for PCR detection of Ralstonia solanacearum and verification of primer specificity
[0070] 1. Primer design
[0071] In the present invention, for the gene temp_001930 encoding a pathogenicity factor specific to Ralstonia solanacearum obtained in Example 1, 4 pairs of specific primers were designed using Primer Premier 6.0 and NCBI Primer-Blast (as shown in Table 1), and were synthesized and reserved by Guangzhou Tsingke Biotechnology Co., Ltd.
[0072] If a primer can specifically amplify a DNA product with the target sequence size only in a sample with Ralstonia solanacearum as the template, it is a specific primer for Ralstonia solanacearum.
[0073] Table 1 4 pairs of specific primers designed for specific gene loci of Ralstonia solanacearum
[0074]
[0075]
[0076] 2. Genomic DNA Extraction of Test Bacteria
[0077] The bacterial genomic DNA purification kit (TransGen Biotech Co., Ltd., Beijing) was used for the extraction of genomic DNA of Ralstonia solanacearum DHD47, NS25, WC5-2, WC4, WC5, WC6, WC7, WC8, HTW2, HTW4, XW3, ZC-Z-2, BH1, LZ-3, EP1, GMI1000, SG-1-1; Pantoea sp. GS-1, Pseudomonas sp. GS-5, Burkholderia sp. GS-6, and Escherichia coli. The main methods are as follows (specifically refer to the kit instruction manual):
[0078] (1) Take 1 ml of overnight-cultured Ralstonia solanacearum and other pathogenic bacteria respectively, centrifuge at 12,000 xg for 1 minute, and discard the supernatant as much as possible.
[0079] (2) Add 100 μl of LB11 and 20 μl of Proteinase K, and oscillate until the bacteria are completely suspended.
[0080] (3) Incubate at 55 °C for 15 minutes.
[0081] (4) Add 20 μl of RNase A, mix well and let stand for 2 minutes.
[0082] (5) Add 400 μl of BB11 (add anhydrous ethanol), vortex for 30 seconds.
[0083] (6) Add all the solution into the centrifugal column, centrifuge at 12,000 xg for 30 seconds, and discard the effluent.
[0084] (7) Add 500 μl of CB11, centrifuge at 12,000 xg for 30 seconds, and discard the effluent.
[0085] (8) Repeat step (7) once.
[0086] (9) Add 500 μl of WB11 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 xg for 30 seconds, and discard the effluent.
[0087] (10) Repeat step (9) once.
[0088] (11) Centrifuge at 12,000 xg for 2 minutes to completely remove the residual WB11.
[0089] (12) Place the centrifugal column in a clean centrifuge tube. Add 50 μl of preheated EB (60 - 70 °C) or deionized water (pH > 7.0) to the center of the column, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 x g for 1 minute to elute the DNA. After measuring the DNA concentration using NanoDrop2000c, store the DNA product at -20 °C for later use.
[0090] 3. Optimize the annealing temperature conditions that affect the specific amplification effect of the PCR reaction
[0091] Using the genomic DNA of *Ralstonia solanacearum* NS25 of *Casuarina equisetifolia* as a template, the PCR reaction system is 12.5 μL of 2×T5Super PCRMix, 1 μL each of the forward primer and the reverse primer, 1 μL of the DNA template, and 9.5 μL of double-distilled water.
[0092] The PCR reaction program is: pre-denaturation at 98 °C for 3 minutes, denaturation at 98 °C for 15 seconds, annealing at 53 °C - 65 °C for 15 seconds (including 12 temperature gradients of 53 °C, 53.6 °C, 54.2 °C, 55.4 °C, 56.8 °C, 58.2 °C, 59.7 °C, 61.1 °C, 62.6 °C, 63.8 °C, 64.4 °C, 65 °C), extension at 72 °C for 20 seconds, and denaturation-annealing-extension for 35 cycles; finally, extension at 72 °C for 5 minutes.
[0093] Screen the optimal annealing temperature for each pair of primers ( Figure 1 ). The optimal annealing temperature for the PCR reaction system of IW-F1 / IW-R1 primers and IW-F3 / IW-R3 is 58.2 °C, the optimal annealing temperature for the PCR reaction system of IW-F2 / IW-R2 is 62.6 °C, and the optimal annealing temperature for the PCR reaction system of IW-F4 / IW-R4 is 63.8 °C.
[0094] 4. Establishment of a PCR detection method for *Ralstonia solanacearum* of *Casuarina equisetifolia* and verification of primer-specific PCR
[0095] Based on the designed specific primers, by optimizing the PCR reaction system and amplification parameters, a PCR detection method for *Ralstonia solanacearum* of *Casuarina equisetifolia* was established:
[0096] The PCR reaction system is 25 μL, including 12.5 μL of 2×T5 Super PCR Mix, 1 μL each of the forward primer and the reverse primer, 1 μL of the DNA template, and 9.5 μL of double-distilled water.
[0097] The PCR reaction procedures are as follows: The optimal conventional PCR reaction procedures for IW-F1 / IW-R1 and IW-F3 / IW-R3 are: 98°C for 3 min, 98°C for 15 s, 58.2°C for 15 s, 72°C for 20 s, 35 cycles, and extension at 72°C for 5 min; the optimal conventional PCR reaction procedure for IW-F2 / IW-R2 is: 98°C for 3 min, 98°C for 15 s, 62.6°C for 15 s, 72°C for 20 s, 35 cycles, and extension at 72°C for 5 min; for IW-F4 / IW-R4, the optimal conventional PCR reaction procedure is: 98°C for 3 min, 98°C for 15 s, 63.8°C for 15 s, 72°C for 20 s, 35 cycles, and extension at 72°C for 5 min.
[0098] Using the DNA of the tested DHD47, NS25, WC5-2, ZC-Z-2, BH1, LZ-3, EP1, GMI1000, GS-1, GS-5, GS-6, SG-1-1, and Escherichia coli as templates, the specificity of the specific primers of Ralstonia solanacearum was verified by using the established PCR detection amplification system and amplification procedure for Ralstonia solanacearum. Take 5.0 μL of the PCR product for 1% agarose gel electrophoresis detection, and verify the specificity of the specific primers of Ralstonia solanacearum according to the presence, absence, and size of the DNA bands ( Figure 2 ), among which, in the PCR reactions of IW-F4 primer and IW-R4 primer, only the DNA templates of Ralstonia solanacearum DHD47, NS25, and WC5-2 can amplify target bands with the same size as the expected fragment, while the PCR reactions with other pathogen DNAs as templates did not amplify single bands with the correct size, indicating that the IW-F4 / IW-R4 primers have high specificity.
[0099] 5. Verification results of primer specificity
[0100] The PCR amplification results showed that the primers IW-F4 / IW-R4 could only specifically amplify a band of 722 bp from the genomic DNA of the tested Ralstonia solanacearum ( Figure 2 ), and there were no single bands with correct sizes in other strains and the negative control. This indicates that this pair of primers can distinguish Ralstonia solanacearum from other strains, has species specificity, and can be used for the rapid and reliable detection and identification of Ralstonia solanacearum.
[0101] Example 3 Determination of the sensitivity of PCR detection of specific primers for Ralstonia solanacearum
[0102] 1. Genomic DNA detection
[0103] Dilute the genomic DNA of *Ralstonia solanacearum* NS25 of Casuarina equisetifolia with sterile ultrapure water to form 8 mass concentration gradients: 50 ng / μL, 25 ng / μL, 10 ng / μL, 5 ng / μL, 2 ng / μL, 1 ng / μL, 800 pg / μL, 500 pg / μL, 200 pg / μL. Use IW-F4 / IW-R4 to perform PCR amplification on the genomic DNA of NS25 with different series of concentrations to evaluate the sensitivity of this primer pair for detecting the genomic DNA of *Ralstonia solanacearum* of Casuarina equisetifolia. The amplification reaction system is: 12.5 μL of 2×T5 Super PCR Mix (Guangzhou Tsingke Biotechnology Co., Ltd.), 1 μL each of the forward primer and the reverse primer, 1 μL of DNA template, and 9.5 μL of double-distilled water. The amplification reaction program is: pre-denaturation at 98 °C for 3 minutes, denaturation at 98 °C for 15 seconds, annealing at 63.8 °C for 15 seconds, extension at 72 °C for 20 seconds, and denaturation-annealing-extension for 35 cycles; finally, extension at 72 °C for 5 minutes. The maximum sensitivity of the specific primer DNA of *Ralstonia solanacearum* of Casuarina equisetifolia of the present invention as the template is 200 pg / μL( Figure 3 in a).
[0104] 2. Detection of the bacterial liquid of *Ralstonia solanacearum* of Casuarina equisetifolia
[0105] Centrifuge the bacterial liquid of *Ralstonia solanacearum* NS25 of Casuarina equisetifolia and dilute it with sterile ultrapure water to form 9 concentration gradients: 4×10 7 CFU / mL, 1×10 7 CFU / mL, 4×10 6 CFU / mL, 2×10 6 CFU / mL, 1×10 6 CFU / mL, 4×10 5 CFU / mL, 2×10 5 CFU / mL, 1×10 5 CFU / mL, 4×10 4 CFU / mL. Use IW-F4 / IW-R4 to perform PCR amplification on the bacterial liquid with different series of concentrations to evaluate the sensitivity of this primer pair for detecting the bacterial liquid of *Ralstonia solanacearum* of Casuarina equisetifolia. The amplification reaction system is: 12.5 μL of 2×T5 Super PCR Mix (Guangzhou Tsingke Biotechnology Co., Ltd.), 1 μL each of the forward primer and the reverse primer, 1 μL of DNA template, and 9.5 μL of double-distilled water. The amplification reaction program is: pre-denaturation at 98 °C for 3 minutes, denaturation at 98 °C for 15 seconds, annealing at 63.8 °C for 15 seconds, extension at 72 °C for 20 seconds, and denaturation-annealing-extension for 35 cycles; finally, extension at 72 °C for 5 minutes. The maximum sensitivity of the specific primer bacterial liquid of *Ralstonia solanacearum* of Casuarina equisetifolia of the present invention as the template is 4×10 5 CFU / mL( Figure 3 in b).
[0106] Example 4 PCR Detection of Inoculating Solanaceous Crops with *Ralstonia solanacearum* from *Casuarina equisetifolia*
[0107] Using eggplant as the host plant, artificially inoculate *Ralstonia solanacearum* strains EP1, LZ-3, GMI1000, DHD47, NS25, A2, WC5-2 with reference to the reported method; after the host plant shows symptoms of the disease, disinfect the surface of the plant and then rinse it 2-3 times with sterile ultrapure water. Cut off the roots, cut the browned stems of the eggplant into small pieces and put them into a 50 mL centrifuge tube, add 10 mL of sterile ultrapure water, and shake and culture at 28 °C for 2 h to prepare an extract. Using the obtained extract as a template, verify with the reported specific primers for *Ralstonia solanacearum* to prove the presence of *Ralstonia solanacearum* in the diseased tissue ( Figure 4 as shown in a)); using the obtained extract as a template, verify with the specific primers for *Ralstonia solanacearum* from *Casuarina equisetifolia* of the present invention. If a product of about 722 bp can be specifically amplified, it can be determined that the diseased tissue carries *Ralstonia solanacearum* from *Casuarina equisetifolia* ( Figure 4 as shown in b)).
[0108] Example 5 PCR Detection of Inoculating *Casuarina equisetifolia* with *Ralstonia solanacearum* from *Casuarina equisetifolia*
[0109] Using *Casuarina equisetifolia* twigs as the host, artificially inoculate *Ralstonia solanacearum* strains DHD47, NS25, A2, WC5-2 from *Casuarina equisetifolia* with reference to the reported method, and culture them at a constant temperature of 28 °C. After the host plant shows symptoms of the disease, disinfect the surface of the *Casuarina equisetifolia* twigs and then rinse them 2-3 times with sterile ultrapure water. Cut off the roots, cut the *Casuarina equisetifolia* twigs into small pieces and put them into a 50 mL centrifuge tube, add 10 mL of TTC medium, and shake and culture at 28 °C for 2 h to prepare an extract. Using the obtained extract as a template, verify with the specific primers for *Ralstonia solanacearum* from *Casuarina equisetifolia* of the present invention. If a product of about 722 bp can be specifically amplified, it can be determined that the diseased tissue carries *Ralstonia solanacearum* from *Casuarina equisetifolia*. The test results ( Figure 5 ) show that this set of techniques can be used for the molecular detection of *Ralstonia solanacearum* from *Casuarina equisetifolia*.
[0110] Example 6 Applicability PCR Detection of *Ralstonia solanacearum* from *Casuarina equisetifolia* Collected in Western Guangdong
[0111] Isolate the *Ralstonia solanacearum* strains collected in Western Guangdong with reference to the reported method. Using NS25 as a positive control, verify with the specific primers for *Ralstonia solanacearum* from *Casuarina equisetifolia* of the present invention. If a product of about 722 bp can be specifically amplified, it can be determined that the diseased tissue carries *Ralstonia solanacearum* from *Casuarina equisetifolia*. The test results ( Figure 6 ) show that this set of techniques can be used for the molecular detection of *Ralstonia solanacearum* from *Casuarina equisetifolia*.
[0112] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. A gene fragment that can be used to identify Ralstonia solanacearum of Casuarina equisetifolia, characterized in that, The sequence is shown as SEQ ID NO.
1.
2. The application of a reagent for detecting the gene fragment according to claim 1 in detecting and identifying Ralstonia solanacearum of Casuarina equisetifolia or in preparing a product for detecting and identifying Ralstonia solanacearum of Casuarina equisetifolia.
3. The application of a reagent for detecting the gene fragment according to claim 1 in monitoring Ralstonia solanacearum wilt of Casuarina equisetifolia or in preparing a product for monitoring Ralstonia solanacearum of Casuarina equisetifolia.
4. A specific detection primer set for Ralstonia solanacearum of Casuarina equisetifolia, characterized in that, They are the specific primer sets IW-F4 and IW-R4, and the sequences are shown as SEQ ID NO.2 and SEQ ID NO.3 respectively.
5. A specific detection kit for Ralstonia solanacearum of Casuarina equisetifolia, characterized in that, A reagent for specifically detecting the gene fragment described in claim 1.
6. The kit according to claim 5, characterized in that, The reagent is a PCR primer.
7. The kit according to claim 6, characterized in that, The PCR primer is the primer set described in claim 4.
8. The kit according to any one of claims 5-7, characterized in that, It also includes the reagents required for PCR amplification.
9. A specific detection method for Ralstonia solanacearum of Casuarina equisetifolia, characterized in that, It includes the following steps: (1) Extract the DNA of the sample to be tested; (2) Using the DNA as a template, perform PCR amplification with any one of the kits described in claims 5-8; (3) If a specific product can be amplified, it is positive for *Ralstonia solanacearum* of *Casuarina equisetifolia*.
10. The method according to claim 9, characterized in that, In step (2), the reaction system for PCR amplification includes: 1 μL of the DNA of the sample to be tested, 12.5 μL of 2×T5 Super PCR Mix, 1 μL of the upstream primer IW-F4, 1 μL of the downstream primer IW-R4, and 9.5 μL of double-distilled water; among them, the sequences of the upstream primer IW-F4 and the downstream primer IW-R4 are shown as SEQ ID NO.2 and SEQ ID NO.3 respectively.
11. The method according to claim 9, characterized in that, In step (2), the procedure for PCR amplification is: pre-denaturation at 98°C for 3 minutes, denaturation at 98°C for 15 seconds, annealing at 63.8°C for 15 seconds, extension at 72°C for 20 seconds, and the denaturation-annealing-extension cycle is carried out for 35 cycles; finally, extension at 72°C for 5 minutes.
12. The method according to claim 9, characterized in that, In step (3), the PCR amplification product is detected by agarose gel electrophoresis. If a 722-bp band appears, it is determined to be positive for *Ralstonia solanacearum* of *Casuarina equisetifolia*.
Citation Information
Patent Citations
Ralstonia solanacearum extraction composition, extract and method for identifying ralstonia solanacearum in casuarina equisetifolia
CN113564222A
Nucleic acid molecules associated with oil in plants
US20070039069A1