Use of Parabacteroides johnsonii DSM18315 in preventing or treating obesity or related diseases
By using Parabacteroides Jorthophilus DSM18315 to regulate the intestinal flora, the problem of major side effects of existing obesity treatment methods has been solved, and the effect of lowering blood lipids and blood sugar without appetite suppression has been achieved, intestinal function has been improved, and new strategies for preventing or treating obesity and its related diseases have been provided.
Patent Information
- Application Number
- CN202310047296.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-31
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2043-01-31
AI Technical Summary
The existing obesity treatment methods have problems such as large side effects and poor patient compliance, and the existing probiotics have limited effects in lowering blood lipids and blood sugar, and cannot effectively prevent or treat obesity and its related diseases.
Using Parabens Yosemite DSM18315 as a live strain, the intestinal flora is regulated by the preparation of drugs, food or health products, reducing body weight, blood sugar and blood lipids, and improving intestinal barrier function.
Parabens Yons can significantly reduce serum triglycerides, total cholesterol and low-density lipoprotein levels, regulate oral glucose tolerance, improve intestinal barrier function, reduce liver lipid accumulation and adipocyte size, reduce body weight, and have no appetite inhibitory effect, and have few side effects.
Smart Images

Figure CN116019837B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the application of Parabacteroides johnsonii DSM18315 in preventing or treating obesity or diseases related thereto. Background Art
[0002] Obesity is one of the major public health issues facing the world today, with the number of obese people exceeding 650 million. The growing number of obese people is even more pronounced in developing countries. The numerous diseases caused by obesity can adversely affect health and increase mortality. Currently, approved long-term obesity treatments include orlistat, phentermine, and topiramate. However, these medications are associated with side effects that limit their effectiveness and patient compliance. Currently, some bariatric surgeries, such as gastric bypass surgery, offer the fastest and most effective weight loss procedures, but they are associated with significant patient pain, complex procedures, and a high incidence of postoperative complications. For these reasons, there is an urgent need to develop effective methods or medications for treating obesity and related diseases with minimal side effects.
[0003] As a bioreactor of food in the human body, the intestinal flora has been found to be associated with obesity. The intestinal flora can regulate host metabolism through itself or its metabolites. Therefore, weight loss strategies by modifying and influencing intestinal microorganisms have been proposed and have become an important method for obesity intervention. Probiotics can regulate the composition of intestinal flora, making beneficial bacteria the dominant flora, inhibiting the growth of harmful bacteria and the production of related metabolites, and participating in the body's immune process, which can effectively alleviate the symptoms of obesity. Among the probiotics currently discovered for the prevention or treatment of obesity and its related diseases, bifidobacteria and lactic acid bacteria are the most widely used traditional probiotics in functional foods and dietary supplements. New generation probiotics such as Akkermansia muciniphila and Faecalibacterium prausnitzii have been found to be beneficial for obesity treatment (Contemporary Chinese Medicine, 2021, 28(26):51-55). Recent studies have shown that Parabacteroides distasonis and Parabacteroides goldsteinii, both members of the Parabacteroides genus, can improve obesity and metabolic dysfunction by affecting host metabolism (Institute of Microbiology, Chinese Academy of Sciences. Application of Parabacteroides in the Treatment and Prevention of Metabolic Diseases: CN107550942A.2018-01-09; Xingjufan Biotechnology Co., Ltd.. Parabacteroides goldsteinii and its use in preparing a composition for preventing or treating obesity: CN110870876B.2021-08-20). Parabacteroides are promising next-generation probiotics, but strains suitable for treating or preventing obesity and improving metabolic disorders remain to be developed. Summary of the Invention
[0004] Based on this, the present invention aims to provide a use of Parabacteroides johnsonii for preventing or treating obesity or its related diseases. The use of drugs, foods, or health products containing this Parabacteroides can reduce body weight, blood sugar, and blood lipids, reduce liver lipid accumulation and epididymal fat mass, and regulate intestinal barrier function.
[0005] Parabacteroides johnsonii DSM18315 is used in the preparation of drugs for preventing or treating obesity or diseases related thereto.
[0006] A pharmaceutical composition is used in the preparation of a drug for preventing or treating obesity or obesity-related diseases, characterized in that the pharmaceutical composition comprises Parabacteroides johnsonii DSM18315 and a pharmaceutically acceptable carrier.
[0007] The application is characterized in that the obesity and related diseases include hyperlipidemia, diabetes, and atherosclerosis.
[0008] The application is characterized in that the diabetes includes type 1 diabetes and type 2 diabetes.
[0009] The application is characterized in that the Parabacteroides johnsonii is a living strain.
[0010] The application is characterized in that the pharmaceutical composition contains the metabolites of Parabacteroides johnsonii.
[0011] The application is characterized in that the pharmaceutical composition may further contain other bacterial species besides the Parabacteroides johnsonii.
[0012] The application is characterized in that it contains 1×10 5 —1×10 14 CFUs / mL or 1×10 5 —1×10 14 CFUs / g of Parabacteroides johnsonii.
[0013] More specifically:
[0014] Use of the Parabacteroides johnsonii in preparing food, health products or pharmaceutical compositions for preventing or treating obesity or diseases related thereto.
[0015] In one embodiment of the present invention, the dosage form of the pharmaceutical composition is a solution, a solid, a semi-solid, a gelatin capsule, a soft capsule, a tablet, a nebulizer, a lozenge or a freeze-dried powder preparation.
[0016] The pharmaceutical composition, food or health product of the present invention contains 1×10 5 -1×10 14 CFUs / mL or 1×10 5 -1×10 14 CFUs / g of Parabacteroides johnsonii.
[0017] The food is fermented milk, yogurt, frozen yogurt, milk powder, condensed milk, pudding or beverage.
[0018] The health care product is an emulsion product, a solution product, a powder product or a solid product.
[0019] Beneficial effects
[0020] 1. The present invention provides a new use of Parabacteroides johnsonii DSM18315. The Parabacteroides johnsonii of the present invention has no effect on the food intake, body weight, epididymal fat, brown fat and liver weight of mice on a normal diet, but can reduce the serum triglyceride, total cholesterol and low-density lipoprotein levels of mice on a normal diet, and regulate the oral glucose tolerance of mice on a normal diet. Specifically, the Parabacteroides johnsonii DSM18315 of the present invention must be a living strain, and inactivated strains do not have the corresponding function. Oral administration of live Parabacteroides johnsonii DSM18315 has no effect on the body weight of mice on a normal diet ( Figure 1 A) and did not affect the food intake of mice ( Figure 1 B). It can significantly reduce the blood sugar level of mice fed a normal diet 30 minutes after oral administration of glucose ( Figure 2 A) and area under the curve ( Figure 2 B), indicating that Parabacteroides johnsonii can regulate oral glucose tolerance. Parabacteroides johnsonii can significantly reduce serum triglycerides in mice fed a normal diet ( Figure 3 A) Total cholesterol ( Figure 3 B) and low-density lipoprotein ( Figure 3 C) level. Parabacteroides johnsonii affects the liver weight of mice on a normal diet ( Figure 4 A and D), epididymal fat weight ( Figure 4 B and E) and brown fat size ( Figure 4 C and F) have no effect.
[0021] The above description shows that for people who eat a healthy diet, high blood lipids and blood sugar bring about a series of adverse reactions. However, Parabacteroides johnsonii DSM18315 does not reduce weight, but only reduces blood lipids and blood sugar without affecting food intake. One of the side effects of most weight loss drugs is appetite suppression. Therefore, as a weight loss product, the present invention will be welcomed by most healthy people.
[0022] 2. For obese patients caused by a high-fat diet, the present invention can help them lose weight, and its blood sugar lowering effect is comparable to that of metformin. It is slightly less effective than metformin in reducing low-density lipoprotein in the blood, but is better than metformin in reducing triglycerides and cholesterol in the blood and liver. Parabacteroides johnsonii can significantly inhibit lipid accumulation in the liver, and Parabacteroides johnsonii also improves the size of fat cells. At the same time, the present invention can improve the intestinal wall thickness and crypt height ( Figure 11 A), promotes intestinal tight junction protein ZO-1 ( Figure 11 C) and Occludin( Figure 11 D) expression, improving intestinal barrier function.
[0023] Specifically, the Parabacteroides johnsonii provided by the present invention can reduce the body weight, epididymal fat and liver weight of obese mice induced by a high-fat diet, reduce serum triglyceride, total cholesterol and low-density lipoprotein levels, reduce liver lipid accumulation and adipocyte size, regulate oral glucose tolerance, and increase intestinal mucus protein secretion and tight junction protein expression levels. Specifically, treatment with live Parabacteroides johnsonii can control weight gain. When the weight of mice on day 56 was compared, the weight of mice in the HFD+Pj group was reduced by 12.1% compared with the HFD group, and the weight of mice in the metformin group was reduced by 9.5% ( Figure 5 B); Parabacteroides johnsonii does not exert this effect by suppressing the appetite of mice, such as Figure 5 As shown in C, Parabacteroides johnsonii did not affect the food intake of mice. The results showed that Parabacteroides johnsonii could significantly improve oral glucose intolerance induced by high-fat diet and lower blood glucose levels, with an effect similar to that of metformin ( Figure 6 A and B). Live Parabacteroides johnsonii treatment can significantly reduce serum triglycerides ( Figure 7 A) Total cholesterol ( Figure 7 B) and low-density lipoprotein ( Figure 7 C) levels, compared with the model group, Parabacteroides johnsonii can reduce serum triglycerides by 36.6%, cholesterol by 28.6%, and low-density lipoprotein by 24.6%. Metformin can reduce serum triglycerides by 21.1%, cholesterol by 13%, and low-density lipoprotein by 26.2%. The results showed that compared with the HFD and HFD+kP.j groups, oral administration of live Parabacteroides johnsonii can significantly reduce liver weight ( Figure 8 A and C) and epididymal fat weight ( Figure 8 B and D), compared with the model group, Parabacteroides johnsonii reduced liver weight by 13.7% and epididymal fat weight by 45.5%, while metformin reduced liver weight by 11.5% and epididymal fat weight by 31.8%. Oral administration of live Parabacteroides johnsonii can significantly reduce liver triglycerides ( Figure 9 A) and total cholesterol ( Figure 9 B) levels, compared with the model group, Parabacteroides johnsonii can reduce liver triglycerides by 63.6% and liver total cholesterol by 38%, metformin can reduce liver triglycerides by 39.6% and liver total cholesterol by 24.3%, the results show that Parabacteroides johnsonii can improve liver lipid accumulation. Parabacteroides johnsonii can significantly inhibit liver lipid accumulation ( Figure 10 A and B), while Parabacteroides johnsonii also improved the size of adipocytes ( Figure 10 C). HE staining showed that Parabacteroides johnsonii could improve intestinal wall thickness and crypt height ( Figure 11 A), AB-PAS staining showed that Parabacteroides johnsonii improved mucin secretion ( Figure 11B), immunofluorescence showed that Parabacteroides johnsonii can promote the intestinal tight junction protein ZO-1 ( Figure 11 C) and Occludin( Figure 11 These results suggest that Parabacteroides johnsonii can improve intestinal barrier function.
[0024] Therefore, for obese patients, most of them have high blood sugar and blood lipids, so some patients control their condition by taking hypoglycemic drugs such as metformin, but chemical drugs have certain side effects. For example, the side effects of metformin mainly include diarrhea, stomach discomfort or cramps, and even increase the burden on the liver and kidneys, which brings great trouble to patients. The present invention is an intestinal flora (probiotics), which does not have the above-mentioned side effects. At the same time, the present invention has unique characteristics: for healthy people, it does not reduce weight, but can lower blood sugar and blood lipids; and for obese patients, it can reduce weight, lower blood sugar, lower blood lipids, reduce liver lipid accumulation, and improve the size of fat cells. More importantly, its blood sugar-lowering effect is comparable to that of metformin, so Parabacteroides johnsonii can become a new strategy for preventing or treating obesity or its related diseases and improving glucose and lipid metabolism.
[0025] 3. The present invention is superior to other Parabacteroides strains reported in the literature in lowering blood lipids or blood sugar, proving that this Parabacteroides johnsonii is a unique strain and that not all Parabacteroides strains have the same effects as the present invention. This has an unexpected technical effect. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 Effects of Parabacteroides johnsonii (P. johnsonii) on body weight and food intake in mice fed a normal diet; Figure A: Body weight change; Figure B: Food intake of mice; Chow: normal diet group, Chow+Pj: normal diet + live bacteria group; Data are expressed as mean ± SD; n = 6 independent experiments; ns indicates no significant difference.
[0027] Figure 2 Effect of Parabacteroides johnsonii (P. johnsonii) on oral glucose tolerance in mice fed a normal diet; Figure A: changes in blood glucose; Figure B: area under the curve; Chow: normal diet group, Chow+Pj: normal diet + live bacteria group; data are expressed as mean ± SD; n = 6 independent experiments; * indicates p < 0.05.
[0028] Figure 3Effects of Parabacteroides johnsonii (P. johnsonii) on serum triglycerides, total cholesterol, and low-density lipoprotein in mice fed a normal diet; Figure A: serum triglyceride (TG) level; Figure B: serum total cholesterol (TC) level; Figure C: serum low-density lipoprotein (LDL-C) level; Chow: normal diet group, Chow+Pj: normal diet + live bacteria group; data are expressed as mean ± standard deviation; n = 6 independent experiments; * indicates p < 0.05, ** indicates p < 0.01.
[0029] Figure 4 Effects of Parabacteroides johnsonii (P. johnsonii) on the liver, epididymal fat, and brown fat of mice fed a normal diet; Figure A: liver weight; Figure B: epididymal fat weight; Figure C: brown fat weight; Figure D: representative image of the liver; Figure E: representative image of epididymal fat; Figure F: representative image of brown fat; Chow: normal diet group, Chow+Pj: normal diet + live bacteria group; data are expressed as mean ± SD; n = 6 independent experiments; ns indicates no significant difference.
[0030] Figure 5 Parabacteroides johnsonii (P. johnsonii) reduces the effects of high-fat-induced obesity; Figure A: body weight change; Figure B: body weight on the fifty-sixth day; Figure C: average weekly food intake per mouse; Chow: normal diet group, HFD: high-fat diet group, HFD+Pj: high-fat diet + live bacteria group, HFD+kP.j: high-fat diet + heat-killed bacteria group, HFD+Metformin: high-fat diet + metformin group; data are expressed as mean ± standard deviation; n = 6 independent experiments; * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001, ns indicates no significant difference.
[0031] Figure 6 The regulatory ability of Parabacteroides johnsonii (P. johnsonii) on oral glucose; Figure A: blood glucose changes; Figure B: area under the curve; Chow: normal diet group, HFD: high-fat diet group, HFD+Pj: high-fat diet + live bacteria group, HFD+kP.j: high-fat diet + heat-killed bacteria group, HFD+Metformin: high-fat diet + metformin group; data are expressed as mean ± standard deviation; n = 6 independent experiments; * indicates p < 0.05, *** indicates p < 0.001, and ns indicates no significant difference.
[0032] Figure 7Effects of Parabacteroides johnsonii (P. johnsonii) on serum triglycerides, total cholesterol, and low-density lipoprotein in mice fed a high-fat diet; Figure A: serum triglyceride (TG) level; Figure B: serum total cholesterol (TC) level; Figure C: serum low-density lipoprotein (LDL-C) level; Chow: normal diet group; HFD: high-fat diet group, HFD+Pj: high-fat diet + live bacteria group, HFD+kP.j: high-fat diet + heat-killed bacteria group, HFD+Metformin: high-fat diet + metformin group; data are expressed as mean ± standard deviation; n = 6 independent experiments; * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001, ns indicates no significant difference.
[0033] Figure 8 Effects of Parabacteroides johnsonii (P. johnsonii) on liver and epididymal fat in mice fed a high-fat diet; Figure A: liver weight; Figure B: epididymal fat weight; Figure C: representative image of liver; Figure D: representative image of epididymal fat; Chow: normal diet group, HFD: high-fat diet group, HFD+Pj: high-fat diet + live bacteria group, HFD+kP.j: high-fat diet + heat-killed bacteria group, HFD+Metformin: high-fat diet + metformin group; data are expressed as mean ± standard deviation; n = 6 independent experiments; * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001, ns indicates no significant difference.
[0034] Figure 9 Effects of Parabacteroides johnsonii (P. johnsonii) on liver triglycerides and total cholesterol in mice fed a high-fat diet; Figure A: liver triglyceride content; Figure B: liver total cholesterol content; Chow: normal diet group, HFD: high-fat diet group, HFD+Pj: high-fat diet + live bacteria group, HFD+kP.j: high-fat diet + heat-killed bacteria group, HFD+Metformin: high-fat diet + metformin group; data are expressed as mean ± standard deviation; n = 6 independent experiments; * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001, ns indicates no significant difference.
[0035] Figure 10 Hepatic lipid accumulation and adipocyte size; Figure A: liver HE staining; Figure B: liver Oil Red O staining; Figure C: epididymal fat HE staining; Chow: normal diet group, HFD: high-fat diet group, HFD+Pj: high-fat diet + live bacteria group, HFD+kP.j: high-fat diet + heat-killed bacteria group; n=6 independent experiments.
[0036] Figure 11Effects of Parabacteroides johnsonii (P. johnsonii) on colonic tissue in mice fed a high-fat diet. Figure A: Colon HE staining; Figure B: Colon AB-PAS staining; Figure C: Colon ZO-1 immunofluorescence; Figure D: Colon occludin immunofluorescence; Chow: normal diet group; HFD: high-fat diet group; HFD+Pj: high-fat diet plus live bacteria group; HFD+kP.j: high-fat diet plus heat-killed bacteria group; n = 6 independent experiments. DETAILED DESCRIPTION
[0037] The present invention will be further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present invention, not for limiting the scope of the present invention.
[0038] definition
[0039] The effective dose described herein refers to a dose of Parabacterium johnsonii that can reduce body weight, lipid accumulation, adipocyte size, and increase intestinal barrier function. The appropriate effective dose may vary depending on the organism or individual being treated, but can be determined by various experimental techniques, including dose-escalation studies.
[0040] The present invention provides a Parabacteroides johnsonii (P. johnsonii) that can effectively prevent and / or treat obesity or its related diseases. Its preservation number is DSM18315, which is purchased from the German Microbial Culture Collection Center. The following experiments show that the Parabacteroides johnsonii of the present invention has no effect on the food intake, body weight, epididymal fat, brown fat and liver weight of mice on a normal diet, but can reduce the serum triglyceride, total cholesterol and low-density lipoprotein levels of mice on a normal diet, and regulate the oral glucose tolerance of mice on a normal diet. The Parabacteroides johnsonii provided by the present invention can reduce the body weight, epididymal fat and liver weight of obese mice induced by a high-fat diet, reduce serum triglyceride, total cholesterol and low-density lipoprotein levels, reduce liver lipid accumulation and fat cell size, regulate oral glucose tolerance, and increase intestinal mucus protein secretion and tight junction protein expression levels. Generally speaking, 0.001 CFUs / kg to 5×10 18 The dosage range of CFUs / kg can effectively prevent or treat obesity and its related diseases, as detailed below.
[0041] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0042] Statistical analysis was performed using GraphPad Prism 9. Data are expressed as mean ± standard deviation (SD), and differences between groups were analyzed by one-way ANOVA.
[0043] Example 1 Identification of Parabacteroides johnsonii (P. johnsonii)
[0044] Parabacteroides johnsonii (P. johnsonii) was purchased from the German Collection of Microorganisms under the number DSM18315. Its nucleotide sequence is shown in SEQ NO ID.1. The sequencing results were identified as P. johnsonii DSM18315 after BLAST comparison. The specific nucleotide sequence is:
[0045] gaagcgcggc ttacacatgc aagtcgaggg gcagcatggt aagtagcaat acttattgat 60
[0046] ggcgaccggc gcacgggtga gtaacgcgta tgcaacttac ctatcagagg gggatagccc 120
[0047] ggcgaaagtc ggattaatac tccataaaac aggggttccg catgggacta tttgttaaag 180
[0048] attcatcgct gatagatagg catgcgttcca ttaggcagtt ggcggggtaa cggcccacc 240
[0049] aaaccgacga tggatagggg ttctgagaggaaggtccccc acattggtac tgagacacgg 300
[0050] accaaactcc tacgggaggc agcagtgagg aatattggtc aatggccgag aggctgaacc 360
[0051] agccaagtcg cgtgaaggat gaaggatcta tggtttgtaa acttctttta taggggaata 420
[0052] aagtgtggga cgtgttccat tttgtatgta ccctatgaat aagcatcggc taactccgtg 480
[0053] ccagcagccg cggtaatacg gaggatgcga gcgttatccg gatttattgg gtttaaaggg 540
[0054] tgcgtaggtg gtaatttaag tcagcggtga aagtttgtgg ctcaccata aaattgccgt 600
[0055] tgaaactggg ttacttgagt gtgtttgagg taggcggaat gcgtgtgta gcggtgaat 660
[0056] gcatagatat cacgcagaact ccaattgcga aggcagctta ctaaaccata actgacact 720
[0057] gaagcacgaa agcgtgggta tcaacagga ttagatactc tggtagtcca cgcagtaac 780
[0058] gatgattact aggattttgc gatcacagt aagctctaca gcgaaagcgt taagtaatcc 840
[0059] acctggggag tacgccggca acggtgaac tcaaggaat tgacggggc ccgcacaagc 900
[0060] ggaggaacat gtggtttaat tcgatgatc gcgaggaacc ttacccggt tgacgtagt 960
[0061] cagaccgacc tgaagagt ctttctagca tagctgatac gagtgctgca tggtggtcgt1020
[0062] cagctcgtgc gtgaggtgtc gcctagtgca taacgagcgc aaacctttat tcaccttagt1080
[0063] taacctaaac aagggc 1096
[0064] Example 2 Effects of P. johnsonii on mice fed a normal diet
[0065] Experimental methods:
[0066] (1) The cultured Parabacteroides johnsonii was adjusted to a concentration of 1×10 10 CFUs / mL, and the gavage volume for each mouse was 0.2 mL, once a day for six weeks.
[0067] (2) Male C57BL / 6J mice aged 4-6 weeks were randomly divided into two groups, with 6 mice in each group. The grouping and treatment methods were as follows:
[0068] Normal diet (Chow) group: low-fat diet + oral administration of sterile saline
[0069] Normal diet + live bacteria (Chow + Pj) group: low-fat diet + oral administration of live Parabacteroides johnsonii. The low-fat diet contains 10% fat calories (Research Diets, D12450B).
[0070] (3) The drug was administered continuously for 6 weeks, and the food intake and body weight of the mice were measured every week.
[0071] (4) An oral glucose tolerance test was performed at week 6. After the animals were fasted overnight, blood glucose was measured at 0 min. The Chow group was gavaged with sterile saline, and the Chow+Pj group was gavaged with 0.2 mL of live bacteria. 2 h later, glucose (2 g / kg) was gavaged, and blood glucose was measured at 30, 60, 90, and 120 min.
[0072] (5) Blood, liver, epididymal fat, and brown adipose tissue were collected at week 6. Blood samples were allowed to rest for 1 hour and then centrifuged at 3000 g for 10 minutes at 4°C. Serum was collected for subsequent testing.
[0073] Experimental results:
[0074] Figure 1 The results showed that Parabacteroides johnsonii had an effect on the body weight and food intake of mice fed a normal diet. Among them, oral administration of live Parabacteroides johnsonii had no effect on the body weight of mice fed a normal diet ( Figure 1 A) and did not affect the food intake of mice ( Figure 1 B).
[0075] Figure 2The results showed that Parabacteroides johnsonii can significantly reduce the blood glucose level of mice fed a normal diet after oral administration of glucose at 30 minutes. Figure 2 A) and area under the curve ( Figure 2 B), showing that Parabacteroides johnsonii can modulate oral glucose tolerance.
[0076] Figure 3 The results showed that Parabacteroides johnsonii could significantly reduce serum triglycerides, total cholesterol and low-density lipoprotein in mice fed a normal diet. Figure 3 A) Total cholesterol ( Figure 3 B) and low-density lipoprotein ( Figure 3 C) level.
[0077] Figure 4 The results showed that Parabacteroides johnsonii had an effect on the tissue weight of mice fed a normal diet. The experimental results showed that Parabacteroides johnsonii had an effect on the liver weight of mice fed a normal diet ( Figure 4 A and D), epididymal fat weight ( Figure 4 B and E) and brown fat size ( Figure 4 C and F) have no effect.
[0078] Example 3 Effect of Parabacteroides johnsonii (P. johnsonii) on SPF obese mice induced by a high-fat diet
[0079] Experimental methods:
[0080] (1) Adjust the concentration of two cultured Parabacteroides johnsonii to 1×10 10 CFUs / mL, one portion was administered orally as live bacteria, and the other portion was administered orally as heat-killed bacteria after heating at 121°C for 15 min. The oral volume for each mouse was 0.2 mL, and the metformin dose was 200 mg / kg, administered orally once a day for eight weeks.
[0081] (2) Male C57BL / 6J mice aged 4-6 weeks were randomly divided into five groups, with 6 mice in each group. The grouping and treatment methods were as follows:
[0082] Normal diet (Chow) group: low-fat diet + oral administration of sterile saline
[0083] High-fat diet (HFD) group: high-fat feed + oral administration of sterile saline
[0084] High-fat diet + live bacteria (HFD+Pj) group: high-fat diet + oral administration of live Parabacteroides johnsonii
[0085] High-fat diet + heat-killed bacteria (HFD+kP.j) group: high-fat diet + gavage with heat-killed Parabacteroides johnsonii
[0086] High-fat diet + metformin (HFD+Metformin) group: high-fat diet + metformin
[0087] Among them, the fat content of low-fat diet is 10% (Research Diets, D12450B), and the fat content of high-fat diet is 60% (Research Diets, D12492).
[0088] (3) The drug was administered continuously for 8 weeks, and the food intake and body weight of the mice were measured every week.
[0089] (4) Oral glucose tolerance test was performed at week 7. After the animals were fasted overnight, blood glucose was measured at 0 min. The Chow group was gavaged with sterile saline, the HFD group was gavaged with sterile saline, the HFD+Pj group was gavaged with 0.2 mL of live bacteria, the HFD+kP.j group was gavaged with 0.2 mL of heat-killed bacteria, and the HFD+Metformin group was gavaged with metformin. 2 h later, glucose (2 g / kg) was gavaged, and blood glucose was measured at 30, 60, 90, and 120 min.
[0090] (5) Blood, liver, and epididymal fat were collected at week 8. After the blood samples were allowed to rest for 1 hour, they were centrifuged at 3000 g for 10 minutes at 4°C, and serum was collected for subsequent testing.
[0091] Experimental results:
[0092] Figure 5 The results show the effect of Parabacteroides johnsonii on the body weight and food intake of SPF obese mice induced by high-fat diet. Figure 5 As shown in A, mice in the HFD and HFD+kP.j groups gained weight rapidly, but treatment with live Parabacteroides johnsonii controlled the weight gain. Comparing the weights of mice on day 56, the weights of mice in the HFD+Pj group decreased by 12.1% compared with those in the HFD group, and the weights of mice in the metformin group decreased by 9.5% ( Figure 5 B), indicating that live Parabacteroides johnsonii can effectively control the weight gain induced by a high-fat diet, while heat-killed Parabacteroides johnsonii has no such effect. Parabacteroides johnsonii exerts this effect not by suppressing the appetite of mice, such as Figure 5 As shown in C, Parabacteroides johnsonii did not affect the food intake of mice.
[0093] Figure 6 The results showed that Parabacteroides johnsonii can significantly improve oral glucose intolerance induced by high-fat diet and lower blood glucose levels, and its effect is similar to that of metformin.
[0094] Figure 7The results showed that the effects of Parabacteroides johnsonii on serum triglycerides, total cholesterol and low-density lipoprotein in SPF obese mice induced by high-fat diet showed that the treatment with live Parabacteroides johnsonii significantly reduced serum triglycerides ( Figure 7 A) Total cholesterol ( Figure 7 B) and low-density lipoprotein ( Figure 7 Compared with the model group, Parabacteroides johnsonii could reduce serum triglycerides by 36.6%, cholesterol by 28.6%, and low-density lipoprotein by 24.6%. Metformin could reduce serum triglycerides by 21.1%, cholesterol by 13%, and low-density lipoprotein by 26.2%.
[0095] Figure 8 The results showed that the effect of Parabacteroides johnsonii on tissue weight of SPF obese mice induced by high-fat diet showed that oral administration of live Parabacteroides johnsonii significantly reduced liver weight compared with the HFD and HFD+kP.j groups ( Figure 8 A and C) and epididymal fat weight ( Figure 8 B and D), compared with the model group, Parabacteroides johnsonii reduced liver weight by 13.7% and epididymal fat weight by 45.5%, while metformin reduced liver weight by 11.5% and epididymal fat weight by 31.8%.
[0096] Figure 9 The results showed that the effects of Parabacteroides johnsonii on liver triglycerides and total cholesterol in SPF obese mice induced by high-fat diet showed that oral administration of live Parabacteroides johnsonii significantly reduced liver triglycerides (compared with HFD and HFD+kP.j groups) Figure 9 A) and total cholesterol ( Figure 9 B) levels, compared with the model group, Parabacteroides johnsonii could reduce liver triglyceride by 63.6% and liver total cholesterol by 38%, while metformin reduced liver triglyceride by 39.6% and liver total cholesterol by 24.3%. These results indicate that Parabacteroides johnsonii can improve liver lipid accumulation.
[0097] Figure 10 The results show the effect of Parabacteroides johnsonii on lipid accumulation and adipocyte size in the liver of SPF obese mice induced by high-fat diet. Liver HE staining ( Figure 10 A) and Oil Red O staining ( Figure 10 B) showed that a high-fat diet led to increased lipid accumulation in the liver of mice. Parabacteroides johnsonii significantly inhibited lipid accumulation in the liver, while heat-killed Parabacteroides johnsonii did not improve lipid accumulation. Parabacteroides johnsonii also improved the size of adipocytes ( Figure 10 C).
[0098] Figure 11The results show the effect of Parabacteroides johnsonii on intestinal function in SPF obese mice induced by high-fat diet. HE staining showed that Parabacteroides johnsonii could improve intestinal wall thickness and crypt height ( Figure 11 A), AB-PAS staining showed that Parabacteroides johnsonii improved mucin secretion ( Figure 11 B), immunofluorescence showed that Parabacteroides johnsonii can promote the intestinal tight junction protein ZO-1 ( Figure 11 C) and Occludin( Figure 11 These results suggest that Parabacteroides johnsonii can improve intestinal barrier function.
[0099] In summary, P. johnsonii (DSM18315) not only regulates the glucose and lipid metabolism of normal mice, but also improves metabolic disorders in obese mice induced by a high-fat diet, regulates body weight and oral glucose tolerance, reduces serum triglyceride, total cholesterol and low-density lipoprotein levels, inhibits liver lipid accumulation, and improves adipocyte size and intestinal barrier function. These results indicate that P. johnsonii can be used to prevent or treat obesity, and can also be extended to obesity-related diseases.
[0100] The present invention reveals for the first time the role of Parabacteroides johnsonii in alleviating obesity and metabolic disorders. Compared with existing probiotics of the genus Parabacteroides, the Parabacteroides johnsonii of the present invention has a better effect of lowering serum triglycerides, total cholesterol, low-density lipoprotein and liver triglycerides. The Parabacteroides johnsonii of the present invention can reduce serum triglycerides by 36.6%, cholesterol by 28.6%, low-density lipoprotein by 24.6%, and liver triglycerides by 63.6%. Existing probiotics under the genus Parabacteroides, such as Parabacteroides johnsonii, can reduce serum triglycerides by 26.3%, cholesterol by 8.5%, and liver triglycerides by 19% (Institute of Medical Biotechnology, Chinese Academy of Medical Sciences. A Parabacteroides and its application in improving obesity or its metabolic-related diseases: CN202010625571.X[P].2021-12-31); another Parabacteroides, Parabacteroides gibbsii, reduces serum cholesterol by 22.2% (Muen (Guangzhou) Biotechnology Co., Ltd. Application of Parabacteroides gibbsii in preventing or treating obesity or its related diseases: 201911082020.7.2020-02-28). In an embodiment of the present invention, Parabacteroides johnsonii has better regulating ability on triglycerides and total cholesterol in serum and liver than the positive drug metformin. In addition to having a good ability to regulate lipids, the Parabacteroides johnsonii in the present invention can improve intestinal barrier function by promoting the expression of intestinal ZO-1 and Occludin.
[0101] The results of the present invention not only reveal the role of Parabacteroides johnsonii in alleviating obesity and metabolic disorders, but can also be promoted and applied clinically. The Parabacteroides johnsonii (P. johnsonii DSM18315) provided by the present invention can be used to prepare a drug for preventing or treating obesity and its related diseases. The Parabacteroides johnsonii can reduce body weight, lipid accumulation, and fat cell size in animals or humans, regulate glucose and lipid metabolism in the body, and improve intestinal barrier function. Therefore, the present invention provides a new strategy for preventing or treating obesity and its related diseases. The strategy can be applied to people with clinical weight control and improved glucose and lipid metabolism needs to achieve the purpose of improving human health and well-being.
Claims
1. The use of Parabacteroides johnsonii DSM18315 in the preparation of drugs for preventing or treating obesity or its related diseases, wherein the obesity-related diseases are hyperlipidemia, diabetes, and atherosclerosis.
2. A pharmaceutical composition for use in the preparation of a drug for preventing or treating obesity or obesity-related diseases, characterized in that: The pharmaceutical composition comprises Parabacteroides johnsonii DSM18315 and a pharmaceutically acceptable carrier; The obesity-related diseases are hyperlipidemia, diabetes, and atherosclerosis.
3. The use according to claim 1 or 2, characterized in that The diabetes mellitus includes type 1 diabetes mellitus and type 2 diabetes mellitus.
4. The use according to claim 1 or 2, characterized in that The Parabacteroides johnsonii is a live strain.
5. The use according to claim 2, characterized in that The pharmaceutical composition comprises the metabolite of Parabacteroides johnsonii.
6. The use according to claim 2, characterized in that The pharmaceutical composition further comprises other bacterial species except the Parabacteroides johnsonii.
7. The use according to claim 1 or 2, characterized in that Contains 1×10 5 —1×10 14 CFUs / mL or 1×10 5 —1×10 14 CFUs / g of Parabacteroides johnsonii.
Citation Information
Patent Citations
Parabacteroides goldsteinii and use there of for preparing composition for preventing or treating obesity
CN110870876A
Application of parabacteroides to treatment and prevention of metabolic diseases
CN107550942A
Application of Parabacteroides distasonis in prevention or treatment of obesity or related diseases thereof
CN110839693A
Parabacteroides and application thereof in improvement of obesity or metabolism-related diseases thereof
CN113862168A