Use of GPR180 inhibitors in the preparation of drugs for improving sugar or lipid metabolism
By developing GPR180 inhibitors, the treatment problems of non-alcoholic fatty liver disease and hypercholesterolemia have been solved, and the improvement of liver steatosis and insulin sensitivity have been achieved, providing an effective drug treatment plan.
Patent Information
- Application Number
- CN202111241371.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-10-25
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2041-10-25
AI Technical Summary
The prior art lacks effective drugs for the treatment of non-alcoholic fatty liver disease (NAFLD), especially lean NAFLD, and the existing drugs have little effect on NAFLD. The relationship between NAFLD and type 2 diabetes and hypercholesterolemia is complex, and the individual differences are large, and the effect of existing drugs is limited.
By developing GPR180 inhibitors, including antibodies and gene interference sequences of GPR180, to prepare drugs for the treatment of non-alcoholic fatty liver disease, weight loss, improve insulin resistance and hypercholesterolemia, inhibit the activity or expression of GPR180 to improve liver steatosis and dyslipidemia.
GPR180 inhibitors can improve liver steatosis, reduce plasma and liver cholesterol content, improve insulin sensitivity, reduce body fat content, and effectively treat non-alcoholic fatty liver disease, obesity and hypercholesterolemia.
Smart Images

Figure CN116019914B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of medical technology, and specifically to the use of GPR180 inhibitors in preparing drugs for improving sugar or lipid metabolism, especially the use of GPR180 inhibitors in preparing drugs for treating nonalcoholic fatty liver disease (NAFLD), reducing weight and fat, and improving insulin resistance. Background Art
[0002] NAFLD is a growing and important cause of chronic liver disease worldwide. It is characterized by excessive fat deposition in the liver, not due to alcohol consumption, and can manifest as non-alcoholic fatty liver disease (NAFL) or nonalcoholic steatohepatitis (NASH). The American Association for the Study of Liver Diseases practice guidelines define NAFL as simple steatosis without hepatocellular damage based on histological evidence of hepatic steatosis. In contrast, NASH is characterized by pathological features such as macrovesicular steatosis, inflammation, and hepatocellular swelling. Compared to NAFL, NASH carries a higher risk of progression to cirrhosis or hepatocellular carcinoma.
[0003] The global prevalence of NAFLD is currently approximately 24%. With the increasing incidence of obesity, type 2 diabetes, and metabolic syndrome, NAFLD is expected to become the leading cause of liver cirrhosis requiring liver transplantation in the next decade. An assessment of the prevalence of NAFLD in different geographic regions revealed that NAFLD is prevalent across all continents: South America (31%) and the Middle East (32%) have the highest prevalence, followed by Asia (27%), North America (24%), and Europe (23%), while Africa (14%) has a lower prevalence.
[0004] The relationship between NAFLD and type 2 diabetes mellitus (T2DM) is complex and bidirectional. NAFLD is not only a disease outcome of T2DM but also a pathogenic factor. Among its etiologies, some believe that insulin resistance is both a prominent feature of NAFLD and a causal factor in its development. Insulin resistance is characterized by impaired glucose utilization in extrahepatic tissues, including adipose tissue and muscle. Adipose tissue insulin resistance leads to excessive fatty acid release through disrupted lipolysis, thereby impairing systemic insulin signaling. Furthermore, protein factors released by adipose tissue and the liver, such as adiponectin, interleukin-6 (IL-6), and dipeptidyl peptidase 4 (DPP-4), may play a causal role in insulin resistance. Other metabolic factors, such as cholesterol (CHO), can also contribute to the development of NAFLD, but the specific mechanisms remain unclear. Because cholesterol flows through the liver in significant quantities and dietary cholesterol intake fluctuates daily, cholesterol regulation is constantly in a state of dynamic equilibrium. This balance involves enhancing cholesterol synthesis when cholesterol is deficient and enhancing cholesterol excretion when cholesterol is excessive. Disruption of this dynamic balance may lead to the development of NAFLD. Evidence suggests that NAFLD patients experience an imbalance in hepatic cholesterol homeostasis, leading to cholesterol accumulation and triggering an inflammatory response in Kupffer cells. However, a comprehensive and universally accepted conceptual model for the pathogenesis of cholesterol-induced NAFLD is currently lacking.
[0005] NAFLD patients generally have dyslipidemia, with high triglycerides and high cholesterol present in their blood lipids, which are important pathogenic factors in the formation of atherosclerosis. In particular, when low-density lipoprotein cholesterol levels are high and high-density lipoprotein cholesterol levels are low, cardiovascular damage is significant. In addition, clinical studies on the left ventricular morphology and diastolic function of NAFLD patients have found that compared with the control group, the left ventricle has abnormal structure and functional impairment, indicating that NAFLD is a risk factor for cardiovascular disease. According to statistical results from a population cohort, NAFLD is associated with an increased risk of cerebral hemorrhage and ischemic stroke, indicating that NAFLD is an important risk factor for increased risk of cerebral stroke.
[0006] Furthermore, lean NAFLD is a potentially unhealthy metabolic state that occurs in individuals who are neither overweight nor obese. However, its global epidemiology and metabolic characteristics have not been extensively elucidated. Currently, many clinicians still consider lean NAFLD to be benign compared to the obese phenotype, leading to its often overlooked and underappreciated potential. Lean NAFLD is typically caused by various factors, including a high-fructose, high-fat diet, alcohol abuse, genetic mutations, and endocrine imbalances. Although patients with lean NAFLD have normal weight, metabolic disturbances may occur, with a prevalence of at least 5% in Western populations. Individuals with lean NAFLD often share the following characteristics: non-obese individuals, sedentary lifestyles, impaired insulin sensitivity, increased cardiovascular risk, and elevated liver lipid levels. These characteristics result in decreased fat storage capacity in adipose tissue, reduced mitochondrial function, and increased hepatic lipogenesis. Lean NAFLD is more likely to progress to liver fibrosis, leading to increased risk of liver-related mortality and morbidity, and thus poses a greater risk of serious consequences. Therefore, this new type of NAFLD warrants significant attention.
[0007] Due to the complex etiology of NAFLD and the large individual variability, there is no specific drug treatment. Currently, no drugs specifically for the treatment of NAFLD have been approved by the Food and Drug Administration in China, the United States, or the European Union. Regarding the treatment of NAFLD, there are two approaches: non-drug and drug intervention. Non-drug treatment involves improving metabolism through regular exercise, diet therapy, and weight loss, and may inhibit the progression of NAFLD; however, in general, non-drug intervention models have little efficacy. Therefore, the focus of NAFLD treatment is more on drug intervention models. Common mainstream drugs for the treatment of NAFLD include vitamin E, pioglitazone, metformin, statins, and the GLP1 receptor agonists liraglutide / semaglutide, among others. Unfortunately, most reported drugs have not shown significant improvement in NAFLD disease conditions. Currently, some promising agents have entered phase III clinical trials, such as the farnesoid X receptor (FXR) agonist abencholic acid, the peroxisome proliferator–activated receptor alpha / delta (PPARα / δ) agonist irabeno, the apoptosis signal-regulating kinase 1 (ASK1) inhibitor selonsertib, and the CC chemokine receptor type 2 / 5 (CCR2 / CCR5) inhibitor cenicriviroc.
[0008] GPR180 (G protein-coupled receptor 180) is a G protein-coupled receptor (GPCR), also known as the intimal thickness–related receptor (ITR). In 2003, Japanese scientists, studying a rabbit aortic catheter injury model, discovered a new gene whose expression was upregulated through genetic differential analysis. This gene is primarily expressed in vascular smooth muscle cells and encodes a novel protein with seven transmembrane domains, hence the name ITR. The ITR sequence contains a motif shared with the rhodopsin-like GPCR superfamily. In vivo analysis of this gene revealed that ITR protein expression increased with intimal thickening induced by catheter placement around the femoral artery in mice. Furthermore, ITR knockout mice were resistant to this experimental intimal thickening. Current research on GPR180 focuses on tumorigenesis, cardiovascular disease, and pupil development. Summary of the Invention
[0009] Through experimental studies, the present invention discovered that GPR180 is highly expressed in mouse kidneys, liver, hypothalamus, pancreas, lungs, epididymal white adipose tissue (eWAT), and ovaries. Within liver tissue, expression is highest in hepatocytes. Under both high-fat diet-induced obesity and Leptin receptor knockout-induced diabetes in mice, GPR180 gene expression levels in mouse livers are upregulated. Knockdown of liver GPR180 enhanced energy metabolism in both normal chow diet (NCD) and high-fat diet (HFD) mice, while reducing body fat content, including subcutaneous white adipose tissue (sWAT) and epididymal fat. This phenomenon was more pronounced in mice fed a high-fat diet. Knockdown of liver GPR180 ameliorates hepatic steatosis induced by a high-fat diet in mice and reduces cholesterol levels in plasma and liver. Knockdown of liver GPR180 also improves insulin resistance and enhances insulin sensitivity in both normal chow diet and high-fat diet mice, thus completing the present invention.
[0010] On this basis, GPR180 can be used as a therapeutic target for non-alcoholic fatty liver disease, weight loss or fat reduction, treatment of diabetes, and hypercholesterolemia.
[0011] The technical solutions of the present invention are as follows:
[0012] Use of a GPR180 inhibitor in the preparation of a medicament for treating non-alcoholic fatty liver disease. In one embodiment of the present invention, the non-alcoholic fatty liver disease is lean non-alcoholic fatty liver disease. In one embodiment of the present invention, the non-alcoholic fatty liver disease is obese non-alcoholic fatty liver disease.
[0013] Non-alcoholic fatty liver disease includes non-alcoholic fatty liver (NAFL) and nonalcoholic steatohepatitis (NASH).
[0014] Use of a GPR180 inhibitor in preparing a drug for reducing weight or body fat or treating obesity.
[0015] The use of a GPR180 inhibitor in the preparation of a drug for treating diabetes, preferably the drug is used to improve the sensitivity of diabetic patients to insulin.
[0016] Use of a GPR180 inhibitor in preparing a drug for treating hypercholesterolemia.
[0017] According to the present invention, the GPR180 inhibitor may be an inhibitor that inhibits GPR180 activity or an inhibitor that inhibits GPR180 protein expression level. The inhibitory activity may be reversible or irreversible.
[0018] Inhibitors of GPR180 activity are substances that bind to GPR180 but do not stimulate GPR180 receptor activity or produce a biological response upon binding. These inhibitors can block, inhibit, or attenuate responses mediated by GPR180 agonists and can compete with agonists for binding to GPR180. Examples of inhibitors of GPR180 activity include, but are not limited to, antibodies against GPR180, polypeptides that inhibit GPR180 activity, and small molecule compounds.
[0019] The inhibitor that inhibits the expression level of GPR180 protein can be an antisense nucleic acid sequence or interfering sequence (such as siRNA, miRNA, shRNA, dsRNA, etc.) of the GPR180 gene, or a polypeptide or small molecule compound that can inhibit the transcription of the GPR180 gene, or a polypeptide or small molecule compound that can inhibit the translation of GPR180 mRNA into protein.
[0020] According to the present invention, the antibody includes but is not limited to monoclonal antibodies, synthetic antibodies, polyclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies, single-chain Fv (scFv) (including bispecific scFv), single-chain antibodies, Fab fragments, F (ab ') fragments, disulfide-linked Fv (sdFv) and any of the above-mentioned epitope binding fragments. In particular, the antibodies used in the present invention include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules. The immunoglobulin molecules used in the present invention can be any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), category (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecules. Preferably, the antibody is a human or humanized monoclonal antibody. As used herein, "human" antibodies include antibodies with the amino acid sequence of human immunoglobulins, and include antibodies isolated from human immunoglobulin libraries or from mice or other animals expressing antibodies from human genes. Antibodies to GPR180 can be prepared using methods known in the art. For example, they can be prepared by administering immunogens to transgenic animals that have been modified to produce intact human antibodies or intact antibodies with human variable regions in response to antigenic challenge; they can also be prepared using hybridoma-based methods; they can also be produced by isolating Fv clonal variable domain sequences selected from human phage display libraries; and they can also be produced by proteolytic digestion of intact antibodies or by producing antibody fragments using recombinant host cells.
[0021] In some embodiments of the present invention, the inhibitor is an antibody against GPR180, preferably a monoclonal antibody.
[0022] In some embodiments of the present invention, the inhibitor is an interfering sequence of the GPR180 gene, such as shRNA or siRNA targeting the mRNA of GPR180. Based on the gene sequence of GPR180, its interfering sequence can be designed using methods known in the art.
[0023] In some embodiments of the present invention, the interference sequence of the GPR180 gene is any one or any combination of two or more of the following sequences: 5'-CTCCCAAATTCAGATGCTGTA-3', 5'-TGCTTCAGCCTTAGCTAATTA-3', 5'-GCTTCAGCCTTAGCTAATTAC-3', 5'-GCTCTTGCTGATTGTCTTACG-3'.
[0024] In some embodiments of the present invention, the interference sequence of the GPR180 gene is carried on an expression vector.
[0025] The expression vector may comprise a promoter and a transcription termination sequence operably linked to the interfering sequence of the GPR180 gene.
[0026] The expression vector may be a eukaryotic cell expression vector.
[0027] The eukaryotic cell expression vector can be a plasmid expression vector or a viral expression vector.
[0028] The plasmid expression vector can be, but is not limited to, pcDNA3.1+ / -, pcDNA4 / HisMax B, pSecTag2 A, pVAX1, pBudCE4.1, pTracer CMV2, pcDNA3.1(-) / myc-His A, pcDNA6-Myc / His B, pCEP4, pIRES, pIRESneo, pIRES hyg3, pCMV-myc, pCMV-HA, pIRES-puro3, pIRES-neo3, pCAGGS, pSilencer1.0, pSilencer2.1-U6 hygro, pSilencer3.1-H1 hygro, pSilencer3.1-H1 neo, and pSilencer4.1-CMV neo.
[0029] The viral expression vector can be a lentiviral vector, an adenoviral vector, an adeno-associated viral expression vector or other types of viral vectors, including but not limited to pLKO.1, pLVX-IRES-ZsGreen1, pCDH-EF1-Luc2-T2A-tdTomato, pCDH-MSCV-MCS-EF1-Puro, pCDH-MSCV-MCS-EF1-copGFP, pLVX-ZsGreen1-C1, pAdEasy-1, pShuttle-CMV, pShuttle, pAdTrack, pAdTrack-CMV, pShuttle-IRES-hrGFP-1, pShuttle-IRES-hrGFP-2, pShuttle-CMV-lacZ, pShuttle-CMV-EGFP-C, pXC1, pBHGE3, pAAV-MCS, pAAV-RC, pHelper, pAAV-LacZ, pAV-GFP vectors.
[0030] In one embodiment of the present invention, the pAV-GFP vector is loaded with four interference sequences: 5'-CTCCCAAATTCAGATGCTGTA-3', 5'-TGCTTCAGCCTTAGCTAATTA-3', 5'-GCTTCAGCCTTAGCTAATTAC-3', 5'-GCTCTTGCTGATTGTCTTACG-3'.
[0031] According to the present invention, the medicament further comprises a pharmaceutically acceptable excipient.
[0032] "Pharmaceutically acceptable excipients" refers to any ingredient other than the GPR180 inhibitors described herein that is substantially non-toxic and non-inflammatory in the patient, including but not limited to any and all solvents, dispersion media or other liquid carriers, dispersion or suspension aids, diluents, isotonicity agents, preservatives, colorants, sweeteners or flavorings, stabilizers, antioxidants, antimicrobial or antifungal agents, osmolarity regulators, pH regulators, buffers, chelating agents, cryoprotectants and / or fillers, as appropriate for the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing compositions are known in the art. Exemplary antimicrobial or antifungal agents include but are not limited to benzalkonium chloride, benzethonium chloride, methylparaben, ethylparaben, propylparaben, butylparaben, benzoic acid, hydroxybenzoic acid, potassium or sodium benzoate, potassium or sodium sorbate, sodium propionate, sorbic acid, and the like, and combinations thereof. Exemplary preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, β-carotene, citric acid, ascorbic acid, and combinations thereof. Exemplary buffers for controlling pH may include, but are not limited to, sodium phosphate, sodium citrate, sodium succinate, histidine (or histidine-HCl), sodium malate, sodium carbonate, and / or combinations thereof. Exemplary cryoprotectants include, but are not limited to, mannitol, sucrose, trehalose, lactose, glycerol, dextrose, and combinations thereof. Exemplary diluents include, but are not limited to, lactose, starch, cellulose derivatives, inorganic calcium salts, and sorbitol. Exemplary binders include, but are not limited to, starch, gelatin, sodium carboxymethylcellulose, and polyvinylpyrrolidone. Exemplary antioxidants include, but are not limited to, vitamin E, sodium bisulfite, sodium sulfite, and butylated hydroxyanisole. Exemplary lubricants include, but are not limited to, magnesium stearate, micronized silica gel, and talc. Exemplary disintegrants include, but are not limited to, starch, methylcellulose, xanthan gum, and cross-linked sodium carboxymethylcellulose.
[0033] The pharmaceutical composition of the present invention may be in the form of oral dosage forms, such as tablets, capsules, pills, powders, granules, suspensions, syrups, etc.; or in the form of injectable dosage forms, such as injection solutions, powder injections, etc., administered intravenously, intraperitoneally, subcutaneously, or intramuscularly. All dosage forms are well known to those skilled in the art of pharmacy.
[0034] The drugs of the present invention can be administered to the subject by routes known in the art, including but not limited to oral, parenteral, subcutaneous, intramuscular, intravenous, intraperitoneal, intrahepatic, intramyocardial, intrarenal, vaginal, rectal, buccal, sublingual, intranasal, transdermal, etc.
[0035] The dosage administered will depend on the age, health, and weight of the recipient, the type of concomitant medication, the frequency of treatment, the route of administration, and the like. The drug may be administered in a single daily dose, or the total daily dose may be administered in divided doses of two, three, or four times daily. The drug may be administered before, during, or after surgery. The dose may be administered once or multiple times, and the duration of administration may range from a single day to several months or longer.
[0036] According to the present invention, the drug can also be used in combination with other drugs that can improve sugar metabolism or lipid metabolism, such as blood sugar lowering drugs and blood lipid lowering drugs.
[0037] The present invention further provides the use of a vector expressing an interfering sequence targeting the GPR180 gene in the preparation of a medicament for treating non-alcoholic fatty liver disease, weight loss or body fat reduction, obesity, diabetes, and / or hypercholesterolemia. Preferably, the treatment of diabetes involves increasing insulin sensitivity in diabetic patients.
[0038] In some embodiments of the present invention, the interference sequence of the GPR180 gene is any one or any combination of two or more of the following sequences: 5'-CTCCCAAATTCAGATGCTGTA-3', 5'-TGCTTCAGCCTTAGCTAATTA-3', 5'-GCTTCAGCCTTAGCTAATTAC-3', 5'-GCTCTTGCTGATTGTCTTACG-3'.
[0039] The expression vector may contain a promoter and a transcription termination sequence operably linked to the interference sequence of the GPR180 gene.
[0040] The expression vector may be a eukaryotic cell expression vector.
[0041] The eukaryotic cell expression vector can be a plasmid expression vector or a viral expression vector.
[0042] The plasmid expression vector can be, but is not limited to, pcDNA3.1+ / -, pcDNA4 / HisMax B, pSecTag2 A, pVAX1, pBudCE4.1, pTracer CMV2, pcDNA3.1(-) / myc-His A, pcDNA6-Myc / His B, pCEP4, pIRES, pIRESneo, pIRES hyg3, pCMV-myc, pCMV-HA, pIRES-puro3, pIRES-neo3, pCAGGS, pSilencer1.0, pSilencer2.1-U6 hygro, pSilencer3.1-H1 hygro, pSilencer3.1-H1 neo, and pSilencer4.1-CMV neo.
[0043] The viral expression vector can be a lentiviral vector, an adenoviral vector, an adeno-associated viral expression vector or other types of viral vectors, including but not limited to pLKO.1, pLVX-IRES-ZsGreen1, pCDH-EF1-Luc2-T2A-tdTomato, pCDH-MSCV-MCS-EF1-Puro, pCDH-MSCV-MCS-EF1-copGFP, pLVX-ZsGreen1-C1, pAdEasy-1, pShuttle-CMV, pShuttle, pAdTrack, pAdTrack-CMV, pShuttle-IRES-hrGFP-1, pShuttle-IRES-hrGFP-2, pShuttle-CMV-lacZ, pShuttle-CMV-EGFP-C, pXC1, pBHGE3, pAAV-MCS, pAAV-RC, pHelper, pAAV-LacZ, pAV-GFP vectors.
[0044] In one embodiment of the present invention, the vector is pAV-GFP, which is loaded with four interference sequences of the GPR180 gene: 5'-CTCCCAAATTCAGATGCTGTA-3', 5'-TGCTTCAGCCTTAGCTAATTA-3', 5'-GCTTCAGCCTTAGCTAATTAC-3', 5'-GCTCTTGCTGATTGTCTTACG-3'.
[0045] The present invention also provides methods for treating diseases.
[0046] A method for treating non-alcoholic fatty liver disease, comprising administering a therapeutically effective amount of a GPR180 inhibitor to a subject in need thereof. Non-alcoholic fatty liver disease includes non-alcoholic fatty liver (NAFL) and non-alcoholic steatohepatitis (NASH). In one embodiment of the present invention, the non-alcoholic fatty liver disease is lean non-alcoholic fatty liver disease. In one embodiment of the present invention, the non-alcoholic fatty liver disease is obese non-alcoholic fatty liver disease.
[0047] A method for losing weight or reducing body fat or treating obesity, comprising administering a therapeutically effective amount of a GPR180 inhibitor to a subject in need thereof.
[0048] A method for treating diabetes, comprising administering a therapeutically effective amount of a GPR180 inhibitor to a subject in need thereof. Preferably, the treatment is to increase the subject's sensitivity to insulin.
[0049] A method for treating hypercholesterolemia, comprising administering to a subject in need thereof a therapeutically effective amount of a GPR180 inhibitor.
[0050] The GPR180 inhibitor is as defined above.
[0051] In some embodiments of the present invention, the inhibitor is an antibody against GPR180, preferably a monoclonal antibody.
[0052] In some embodiments of the present invention, the inhibitor is an interfering sequence of the GPR180 gene, such as shRNA or siRNA targeting GPR180 mRNA.
[0053] In some embodiments of the present invention, the interference sequence of the GPR180 gene is any one or any combination of two or more of the following sequences: 5'-CTCCCAAATTCAGATGCTGTA-3', 5'-TGCTTCAGCCTTAGCTAATTA-3', 5'-GCTTCAGCCTTAGCTAATTAC-3', 5'-GCTCTTGCTGATTGTCTTACG-3'.
[0054] In some embodiments of the present invention, the interference sequence of the GPR180 gene is carried on an expression vector.
[0055] The expression vector may comprise a promoter and a transcription termination sequence operably linked to the interfering sequence of the GPR180 gene.
[0056] The expression vector may be a eukaryotic cell expression vector.
[0057] The eukaryotic cell expression vector can be a plasmid expression vector or a viral expression vector.
[0058] The plasmid expression vector can be, but is not limited to, pcDNA3.1+ / -, pcDNA4 / HisMax B, pSecTag2 A, pVAX1, pBudCE4.1, pTracer CMV2, pcDNA3.1(-) / myc-His A, pcDNA6-Myc / His B, pCEP4, pIRES, pIRESneo, pIRES hyg3, pCMV-myc, pCMV-HA, pIRES-puro3, pIRES-neo3, pCAGGS, pSilencer1.0, pSilencer2.1-U6 hygro, pSilencer3.1-H1 hygro, pSilencer3.1-H1 neo, and pSilencer4.1-CMV neo.
[0059] The viral expression vector can be a lentiviral vector, an adenoviral vector, an adeno-associated viral expression vector or other types of viral vectors, including but not limited to pLKO.1, pLVX-IRES-ZsGreen1, pCDH-EF1-Luc2-T2A-tdTomato, pCDH-MSCV-MCS-EF1-Puro, pCDH-MSCV-MCS-EF1-copGFP, pLVX-ZsGreen1-C1, pAdEasy-1, pShuttle-CMV, pShuttle, pAdTrack, pAdTrack-CMV, pShuttle-IRES-hrGFP-1, pShuttle-IRES-hrGFP-2, pShuttle-CMV-lacZ, pShuttle-CMV-EGFP-C, pXC1, pBHGE3, pAAV-MCS, pAAV-RC, pHelper, pAAV-LacZ, pAV-GFP vectors.
[0060] The subject in need of treatment can be a human or a mammal, such as a monkey, an ape, a baboon, a cat, a dog, a pig, a sheep, a cow, a mouse, a rabbit, etc.
[0061] definition:
[0062] “And / or” will be taken as a specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” used in phrases such as “A and / or B” is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” used in phrases such as “A, B, and / or C” is intended to cover each of the following: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0063] "Comprising" and "including" have the same meaning and are intended to be open ended and permit, but not require, the inclusion of additional elements or steps. When the terms "comprising" or "including" are used herein, the terms "consisting of" and / or "consisting essentially of" are also included and disclosed. BRIEF DESCRIPTION OF THE DRAWINGS
[0064] Figure 1-1 GPR180 expression in different tissues, cells, and pathological conditions. (A) GPR180 expression was measured in different mouse tissues and normalized to that in Jejunum tissue; (B) GPR180 expression was measured in different cell lines and normalized to that in HepG2 cells; (C) GPR180 expression levels were compared in the livers of mice fed a high-fat diet (HFD) and mice fed a normal diet (NCD); and (D) GPR180 expression levels were compared in the livers of diabetic mice (DB / DB) and non-diabetic mice (DB / DM). Results are presented as mean ± SEM, n = 6-10, p < 0.05.
[0065] Figure 1-2 RT-PCR analysis of GPR180 knockdown efficiency in the livers of NCD and HFD mice. The left side shows GPR180 mRNA expression in the livers of NCD mice, and the right side shows GPR180 mRNA expression in the livers of HFD mice. Results are presented as mean ± SEM, n = 6-10, p < 0.05.
[0066] Figure 2 Mouse weight and food intake monitoring results. (A) Experimental procedure diagram. After one week of acclimation, 6-week-old C57BL / 6J mice were injected with adeno-associated virus (AAV) through the tail vein. Simultaneously, they were fed either an NCD or HFD diet, with weekly monitoring of body weight and food intake. Metabolic parameters were monitored from 11 to 12.5 weeks. (B) Body weight changes of mice on the NCD and HFD diets. (C) Food intake changes of mice on the NCD and HFD diets. All results are presented as mean ± SEM. N = 7-9.
[0067] Figure 3 : Metabolic cage test results of NCD mice, including (A) oxygen consumption, (B) activity, (C) respiratory quotient, (D) energy expenditure, and (E) carbon dioxide production. The above results are shown as mean ± SEM, n = 5.
[0068] Figure 4 Metabolic cage test results of HFD mice, including (A) oxygen consumption, (B) activity, (C) respiratory quotient, (D) energy expenditure, and (E) carbon dioxide production. All the above results are shown as mean ± SEM, n = 5.
[0069] Figure 5 Magnetic resonance imaging (MRI) was used to assess body fat distribution in mice after 11 weeks of feeding. (A) NCD mice: MRI image on the left, fat surface area calculated and statistically analyzed on the right; (B) HFD mice: MRI image on the left, fat surface area calculated and statistically analyzed on the right. Results are presented as mean ± SEM, n = 3, P < 0.05.
[0070] Figure 6 : Statistics of tissue weights in mice after 12.5 weeks of feeding. (A) Subcutaneous adipose tissue (sWAT) weights of NCD and HFD mice; (B) Epididymal adipose tissue (eWAT) weights of NCD and HFD mice; (C) Brown adipose tissue (BAT) weights of NCD and HFD mice; (D) Appearance of BAT in HFD mice; (E) Liver weights of NCD and HFD mice. Results are presented as mean ± SEM, n = 7-9, p < 0.05.
[0071] Figure 7 Morphology of subcutaneous adipose tissue in NCD and HFD mice. (A) HE staining of subcutaneous adipocyte morphology in NCD and HFD mice treated with different viruses; (B) Size of subcutaneous adipose tissue samples from different HFD mouse treatment groups. The first six subcutaneous adipose tissue samples were from the AAV-shRNA scramble control group, and the last six subcutaneous adipose tissue samples were from the AAV-shRNA GPR180 treatment group.
[0072] Figure 8 Figure 3: Morphology of epididymal adipose tissue in NCD and HFD mice. (A) HE staining of epididymal adipocyte morphology in NCD and HFD mice treated with different viral loads. (B) Size of epididymal adipose tissue samples from different HFD mouse treatment groups. The first six samples were from the AAV-shRNA scramble control group, and the last six samples were from the AAV-shRNA GPR180 treatment group.
[0073] Figure 9: Hepatic steatosis in NCD and HFD mice treated with different viruses. (A) HE staining of the livers in NCD and HFD mice treated with different viruses; (B) Oil Red O staining of the livers in NCD and HFD mice treated with different viruses.
[0074] Figure 10 Serum and liver cholesterol levels in mice after 12.5 weeks of feeding. (A) Plasma cholesterol levels in NCD and HFD mice; (B) Liver cholesterol levels in NCD and HFD mice. Results are presented as mean ± SEM, n = 6-9, p < 0.05.
[0075] Figure 11 Mice were fed for 11 weeks and then fasted for 6 hours before undergoing insulin tolerance testing. (A) Blood glucose changes within 120 minutes after intraperitoneal insulin injection in NCD mice; (B) Blood glucose changes within 120 minutes after intraperitoneal insulin injection in HFD mice. Results are presented as mean ± SEM, n = 5, p < 0.05. DETAILED DESCRIPTION
[0076] The present invention is further described below with reference to the following examples. It should be noted that the examples are not intended to limit the scope of protection of the present invention, and those skilled in the art will understand that any improvements and variations based on the present invention are within the scope of protection of the present invention.
[0077] The conventional reagents used in the following examples are all commercially available, and the biological experiments performed are all conventional biological experiments in the art and can be performed according to the instructions in the corresponding experimental manual or kit instructions.
[0078] Experimental materials and methods of the following examples
[0079] 1. Experimental Animals
[0080] All experimental procedures were performed in accordance with the Regulations on Laboratory Animal Management of the Ministry of Health of the People's Republic of China (Document No. 55, 2001). Male C57BL / 6J mice (six weeks old) were purchased from the Animal Center of Peking University Health Science Center. Mice were housed on a 12-h light-dark cycle (light cycle: 06:00–18:00; dark cycle: 18:00–06:00), maintained at a stable temperature of 21°C–25°C, with free access to food and water, and under specific pathogen-free conditions unless otherwise stated. After one week of acclimatization, seven-week-old male C57BL / 6J mice were randomly divided into two groups and fed either a normal chow diet (Beijing Keao Xieli Feed Co., Ltd.) or a high-fat diet (Research Diet, D12492, 60% kcal from fat, 5.24 kcal / g) for 12.5 weeks. Body weight and food intake were measured weekly.
[0081] 2. Viruses and drugs
[0082] AAV-shRNA GPR180 and control virus AAV-shRNA scramble were packaged by Shandong Weizhen Biotechnology Co., Ltd. using the AAV9 serotype. The shRNA adeno-associated virus vector pAV-4in1shRNA-GFP was selected, and the GPR180 interference sequence was four: (1) CTCCCAAATTCAGATGCTGTA, (2) TGCTCAGCCTTAGCTAATTA, (3) GCTTCAGCCTTAGCTAATTAC, and (4) GCTCTTTGCTGATTGTCTTACG. The four target sequences were simultaneously loaded into a single viral vector to further improve knockdown efficiency.
[0083] siRNA: siRNA GPR180 small interfering RNA was synthesized by Suzhou Hongxun Biotechnology Co., Ltd., and the interference sequence was GCTTCAGCCTTAGCTAATTAC.
[0084] 3. Some related reagents and kits
[0085] TRIeasyTM Total RNA Extraction Reagent: Shanghai Yisheng Biotechnology Co., Ltd., Reverse Transcription Kit: Shanghai Yisheng Biotechnology Co., Ltd., Real-Time Fluorescence Quantitative PCR Kit: Shanghai Yisheng Biotechnology Co., Ltd., DH5α Competent Cells: Beijing Quanshijin Biotechnology Co., Ltd., Hematoxylin and Eosin (HE) Staining Kit: Shanghai Biyuntian Biotechnology Co., Ltd., Blood Glucose Test Strips (ACCU-CHEK): ROCHE, Blood Glucose Meter: ROCHE, Cholesterol (TC) Content Assay Kit: Nanjing Jiancheng Bioengineering Research Institute Co., Ltd.
[0086] 4. Experimental methods
[0087] (1) Tail vein injection of adeno-associated virus
[0088] The mice were fixed and the virus was injected into the tail vein, and about 100 μL of virus was pushed into the blood vessels.
[0089] (2) Insulin Tolerance Test (ITT)
[0090] Fast the mice for 6 hours before injecting insulin, and make sure the mice have drinking water. Dilute insulin with 0.9% sodium chloride solution to a working concentration of 0.1U / mL, measure the weight of the mice and inject insulin intraperitoneally. The dose for NCD mice is 0.75U / kg (insulin / body weight), and the dose for HFD mice is 1U / kg (insulin / body weight). Prepare 20% glucose solution so that it can be administered intraperitoneally when the mice have hypoglycemia to prevent death due to hypoglycemia. Set 6 blood collection time points at 0, 15min, 30min, 60min, 90min and 120min. Blood is collected from the tip of the tail and dripped onto a blood glucose test strip. The blood glucose value is recorded by a blood glucose meter.
[0091] (3)Acquisition of materials
[0092] A 1% pentobarbital solution was prepared in PBS. The volume of pentobarbital injected intraperitoneally was calculated based on the mouse's body weight, multiplying 7 μl per gram of body weight. After the mice were anesthetized, the abdominal cavity was dissected and cardiac blood, subcutaneous fat, epididymal fat, liver, pancreas, stomach, hypothalamus, duodenum, jejunum, ileum, colon, intestinal contents, brown adipose tissue (BAT), thigh muscle, and gastrocnemius muscle were extracted in sequence. A small portion of the extracted tissue was placed in a 4% paraformaldehyde solution, fixed for a certain period of time, and then replaced in a 20% sucrose solution. The remaining tissue was wrapped in labeled tin foil and placed in a liquid nitrogen tank. After sampling, the tissue in liquid nitrogen was transferred to a -80°C freezer for long-term storage.
[0093] (4) Tissue sections
[0094] After removal from paraformaldehyde, tissue can be embedded in paraffin or OCT. For paraffin embedding, serially section paraffin-embedded tissue to a thickness of approximately 7 μm. The sections are then placed on glass slides and dried in a 60°C oven for 30 minutes. Afterwards, they are stored until ready for use. For OCT embedding, after OCT embedding, the liver is gently placed in liquid nitrogen using forceps. Serial frozen sections are then removed and stored frozen at -30°C.
[0095] (5) Oil Red O staining of liver
[0096] Preparation of stock solution: In a 250 ml conical flask, add 500 mg of Oil Red O powder to 100 ml of 100% isopropanol and mix thoroughly. After preparation, seal the solution and store it.
[0097] Preparation of working solution: Before use, mix 30 ml of Oil Red O stock solution with 20 ml of ddH2O and filter through a 0.22 μm filter.
[0098] The tissue was washed once with phosphate buffer saline, fixed with 4% paraformaldehyde for 15 minutes, washed with ddH2O for 3 minutes, stained with Oil Red O working solution in the dark for 60 minutes, and washed again with ddH2O for 3 minutes. The sections were mounted with glycerol, allowed to dry at 4°C, and then observed and photographed under a microscope.
[0099] (6) Tissue HE staining
[0100] Dewaxing with graded ethanol: Paraffin sections were rinsed sequentially with the following reagents: xylene twice, absolute ethanol twice, 95% ethanol once, 90% ethanol once, 80% ethanol once, 70% ethanol once, and ddH2O twice, each treatment lasting 5 minutes. Hematoxylin was added for 5 minutes; sections were then placed in and out of a hydrochloric acid-alcohol separation solution three times; ddH2O was added twice, each for 5 minutes; and sections were treated with eosin for 5 minutes. Dehydrate the sections in a gradient manner and then transparentize them. Mount the sections with resin.
[0101] (7) Determination of lipid content in liver, plasma and cells
[0102] Liver lipid content determination: 40 mg of liver tissue was removed and added to 1 ml of lipid lysis buffer. Homogenize at high speed three times for 15 seconds each on ice. Lipase was inactivated by incubation at 75°C for 5 minutes. The supernatant was collected and lipid concentration was determined using a cholesterol (CHO) assay kit. Protein concentration was also determined simultaneously in the supernatant. Lipid content was standardized as CHO / Protein and expressed in mg / g.
[0103] Determination of plasma lipid content: Mouse whole blood was centrifuged at 1600 g at 4°C for 15 min; the upper serum was collected and the lipid concentration was determined using a cholesterol (CHO) content detection kit (unit: mg / dl).
[0104] Determination of cell lipid content: Wash cells three times with PBS, aspirate the residual liquid, and add an appropriate amount of lipid lysis buffer; transfer the lysed cell liquid to a 1.5 ml centrifuge tube and disrupt it by ultrasonication in an ice bath; inactivate lipase at 75°C for 5 minutes; centrifuge at 25°C and 12,000 rpm for 20 minutes; collect the supernatant, and determine the lipid concentration using a cholesterol (CHO) content detection kit. Simultaneously determine the supernatant protein concentration; lipid content is calibrated as CHO / Protein in mg / g.
[0105] (8) RT-PCR
[0106] To extract RNA: Weigh approximately 30 mg of tissue into a 4 ml centrifuge tube, add 1 ml of RNAtrip, and homogenize three times for 10 seconds each. For cells, add 1 ml of RNAtrip directly to a six-well plate, pipette through the cells, and transfer to a 1.5 ml centrifuge tube. Add 0.2 times the volume of chloroform to the centrifuge tube, mix thoroughly, and incubate on ice for 10 minutes, then incubate at 12,000 rpm at 4°C for 10 minutes. Pipette 400-450 μl of the upper colorless aqueous phase into a new 1.5 ml centrifuge tube, add an equal volume of isopropanol, mix thoroughly, and incubate on ice for 15 minutes, then incubate at 12,000 rpm at 4°C for 10 minutes.
[0107] The RNA precipitate was washed with 75% ethanol (prepared with DEPC water), and then dissolved with an appropriate amount of ddH2O. The RNA concentration was measured using a Nanodrop nucleic acid quantifier.
[0108] Reverse transcription: Remove residual genome; prepare the following mixture, mix thoroughly by pipetting, and incubate at 42°C for 2 min.
[0109]
[0110] Reverse transcription (20 μl): Add 10 μl of 2× SuperMix directly to the reaction tube from the previous step and mix thoroughly by pipetting. Then incubate according to the following procedure.
[0111]
[0112] After the reversal is completed, 180 μl of ddH2O is added to the 20 μl system for dilution.
[0113] Primer sequences
[0114] Based on database retrieval and software design, the following primer sequences were obtained
[0115]
[0116] (9) Data Analysis
[0117] The experimental results are expressed as mean ± standard error (SEM), and the differences between groups were analyzed using t-test (p < 0.05 indicated a significant difference). GraphPad Prism 5 software was used for graphing and statistical analysis.
[0118] In this study, male C57BL / 6J mice were divided into four groups (n = 7-9 per group), namely NCD AAV-shRNA scramble, NCD AAV-shRNA GPR180, HFD AAV-shRNA scramble, and HFD AAV-shRNA GPR180. NCD means fed a normal diet, HFD means fed a high-fat diet, AAV-shRNA scramble means injected with a control adeno-associated virus through the tail vein of mice, and AAV-shRNA GPR180 means injected with an adeno-associated virus for knocking down the GPR180 gene through the tail vein of mice. The virus dose was 5×10 11 μg / mouse. During the 12.5 weeks of feeding, various physiological indicators of mice were tested under normal diet and high-fat diet-induced NAFLD conditions.
[0119] Example 1 Determination of GPR180 Expression Abundance and GPR180 Knockdown Efficiency
[0120] The mRNA expression of GPR180 in various tissues was analyzed by RT-PCR and normalized to the abundance value of jejunum. The results showed that GPR180 was highly expressed in tissues such as kidney, liver, hypothalamus, pancreas, lung, epididymal fat, and ovary (see Figure 1-1 A). The expression levels of GPR180 in various cells were further detected. Figure 1-1 B shows that the expression level in hepatic parenchymal cells was the highest, followed by macrophages (Raw264.7 and Kupffer).
[0121] The gene expression of GPR180 in the liver of mice induced by normal diet and high-fat feeding was compared under different pathological conditions, e.g. Figure 1-1 C shows that GPR180 expression in the liver of mice in the HFD group was upregulated compared with that in the NCD group.
[0122] We also examined the expression of GPR180 in DB / DB diabetic mice and DB / DM non-diabetic mice and found that GPR180 was also upregulated in the liver of DB / DB diabetic mice ( Figure 1-1 D).
[0123] The above results show that GPR180 is highly expressed in the liver. Among cellular components, hepatocytes and macrophages have the highest GPR180 expression, and GPR180 expression in the liver is upregulated under the pathological conditions of obesity and diabetes.
[0124] The expression of GPR180 in the liver of NCD and HFD mice was analyzed by RT-PCR. Figure 1-2In NCD mice, the AAV-shRNA GPR180 group achieved a nearly 50% knockdown efficiency of GPR180 in the liver compared to the control group, while in HFD mice, this efficiency was close to 45%. After tail vein injection of adeno-associated virus, the liver becomes the primary target due to the first-pass effect of the liver, with the majority of the virus being accumulated in the liver.
[0125] Example 2 Changes in Body Weight and Food Intake of GPR180 Knockout Mice
[0126] The body weight and food intake of mice were continuously monitored weekly under different dietary conditions ( Figure 2 A).
[0127] like Figure 2 As shown in B, in NCD mice, the weight of mice injected with AAV shRNA-GPR180 adeno-associated virus was slightly lighter than that of the control group, but there was no statistical difference; in HFD mice, the weight of mice injected with AAV shRNA-GPR180 adeno-associated virus was significantly lower than that of the control group, and the difference was significant. However, no matter whether it was an HFD diet or an NCD diet, the food intake data of the two different adeno-associated virus treatment groups did not differ ( Figure 2 C).
[0128] Example 3 GPR180 knockout mice enhance energy metabolism
[0129] To examine the energy metabolism of mice, we used metabolic cages to monitor their energy metabolism in real time. Mice were first placed in the cages for 24 hours to acclimate. Then, starting at 9:00 AM the following morning, the cages were activated and oxygen consumption, activity, respiratory quotient, energy expenditure, and carbon dioxide production were recorded over the next 24 hours.
[0130] 1. NCD diet mice
[0131] like Figure 3 As shown in the NCD mice, the oxygen consumption of the AAV-shRNA GPR180 group increased compared with the control group ( Figure 3 A), no difference in activity ( Figure 3 B); there was no significant difference in respiratory quotient ( Figure 3 C); energy consumption slightly increased ( Figure 3 D), but there is no difference in carbon dioxide production ( Figure 3 E).
[0132] 2. HFD diet mice
[0133] In mice fed a HFD diet, the oxygen consumption of the AAV-shRNA GPR180 group was significantly increased compared with the control group ( Figure 4 A), no difference in activity ( Figure 4B); respiratory quotient decreased ( Figure 4 C), indicating that the mice's fat utilization increased; energy consumption increased ( Figure 4 D) and increased carbon dioxide production ( Figure 4 E).
[0134] These results show that in both NCD and HFD mice, AAV-shRNA GPR180-treated mice experienced increased oxygen consumption and enhanced energy expenditure. However, the HFD AAV-shRNA GPR180 mice showed a more significant increase in energy metabolism, a decrease in respiratory quotient, improved fat utilization, and increased carbon dioxide production.
[0135] Example 4 GPR180 knockout mice reduce body fat content
[0136] In order to compare the changes in body fat distribution in GPR180 knockdown mice, the anesthetized mice were scanned with a magnetic resonance imaging (MRI) device, and the images were acquired using the same slice and resolution. Figure 5 As shown in A, the white area is adipose tissue.
[0137] Mice fed the NCD diet had a low body fat content, but the fat surface area of the AAV-shRNA GPR180-treated group decreased by about 70% compared to the control group ( Figure 5 A). Fat surface area was calculated using ImageJ software.
[0138] The white areas of mice fed the HFD diet were large and bright, indicating that the fat was widely distributed and abundant. The fat surface area of the AAV-shRNA GPR180 group decreased by about 40% compared with the control group ( Figure 5 B).
[0139] The above results show that AAV-shRNA GPR180 treatment can significantly reduce body fat content in mice fed two different diets.
[0140] Example 5 Effects of GPR180 knockdown on fat and liver tissue weight in mice
[0141] Mice were sampled after MRI, metabolic cage, ITT and other tests were completed, and each tissue was weighed.
[0142] From the overall appearance observation, there was no significant difference in body size between the AAV-shRNA scramble and AAV-shRNA GPR180 groups of NCD mice; however, in the HFD mice, the AAV-shRNA scramble control mice were obese and large in size, while the AAV-shRNA GPR180 mice were less obese and smaller in size.
[0143] Analysis of the weight of each tissue revealed that there was no difference in the weight of subcutaneous fat (sWAT) between the two groups in NCD mice ( Figure 6 A); however, in HFD mice, the sWAT weight of the AAV-shRNA GPR180-treated group was significantly reduced ( Figure 6 A). The weight of epididymal fat (eWAT) was different in both NCD and HFD mice, and the eWAT weight of mice treated with AAV-shRNA GPR180 was reduced; the reduction in eWAT in HFD mice was more significant, with a statistically significant difference ( Figure 6 B). In NCD mice, the weight of brown adipose tissue (BAT) increased in the AAV-shRNAGPR180-treated group ( Figure 6 C); The weight of brown adipose tissue (BAT) of AAV-shRNA GPR180-treated mice in HFD was reduced ( Figure 6 C), although the weight was reduced, its color was brown, while the control group was white ( Figure 6 D). There was no significant difference in liver weight between NCD and HFD mice, but the liver weight of the HFD AAV-shRNA GPR180-treated mice was slightly lighter than that of the control group, but this was not statistically significant ( Figure 6 E).
[0144] Example 6 Effect of GPR180 gene knockdown on subcutaneous fat (sWAT) morphology
[0145] HE staining was used to observe the morphology of sWAT and found that there was no significant difference in the size of adipocytes between the AAV-shRNA scramble and AAV-shRNAGPR180 groups in NCD mice ( Figure 7 A), but in HFD mice, the subcutaneous adipocyte volume of the AAV-shRNA GPR180-treated group was significantly smaller than that of the control group ( Figure 7 A).
[0146] When the sWAT was collected, the volume of sWAT in the AAV-shRNA GPR180-treated group was significantly smaller than that in the control group. In addition, the surface of the fat pad was reddish, indicating that AAV-shRNA GPR180 treatment enhanced the beige coloration of sWAT. Figure 7 B).
[0147] The above results indicate that AAV-shRNA GPR180 treatment can significantly reduce the size of subcutaneous adipocytes in high-fat diet-induced obese mice.
[0148] Example 7 Effect of GPR180 gene knockdown on epididymal fat (eWAT) morphology
[0149] HE staining was used to observe the morphology of eWAT. There was no significant difference in the adipocyte size between the AAV-shRNA scramble and AAV-shRNA GPR180 groups in NCD mice ( Figure 8 A). However, in HFD mice, the adipocyte volume of the AAV-shRNA GPR180-treated group was significantly smaller than that of the control group ( Figure 8 A). Combined with the analysis of the photographic results of eWAT during sampling, it was found that the eWAT of the AAV-shRNA GPR180-treated group in HFD mice was significantly smaller than that of the control group. Similarly, the fat pad surface was reddish in color, indicating that AAV-shRNA GPR180 treatment enhanced the beige coloration of eWAT ( Figure 8 B).
[0150] The above results indicate that AAV-shRNA GPR180 treatment can significantly reduce the size of epididymal adipocytes in high-fat diet-induced obese mice.
[0151] Example 8 GPR180 knockdown improves hepatic steatosis in high-fat-induced obese mice
[0152] HE staining of liver tissues revealed that there were no vacuoles caused by lipid droplets in the livers of both groups of NCD mice ( Figure 9 A); In HFD mice, both groups showed vacuolar degeneration, but the degree of vacuolar degeneration was different: in the control group, the number of vacuoles was dense and the vacuolar surface area was large, but in the AAV-shRNA GPR180-treated group, the vacuoles were sparse and the surface area was smaller than that of the control group ( Figure 9 A).
[0153] In addition, Oil Red O staining also revealed that there were no obvious lipid droplets in the livers of both NCD mouse groups; HFD mice showed varying degrees of lipid droplets. Compared with the dense distribution of lipid droplets in the livers of the control group, the lipid droplets in the AAV-shRNA GPR180-treated group were sparse ( Figure 9 B).
[0154] At the same time, the appearance of the livers of the two groups of HFD mice was compared. Although there was no difference in size, the livers of the AAV-shRNA scramble control group had obvious milky lipid droplets, which were densely distributed and larger in volume, while no lipid droplets were observed in the livers of the AAV-shRNA GPR180-treated group.
[0155] These results demonstrate that mice fed a high-fat diet produce large amounts of lipid droplets in their livers, leading to the development of a typical non-alcoholic fatty liver disease. AAV-shRNA GPR180 treatment can reduce liver steatosis in high-fat-induced obese mice, reducing lipid droplets and significantly improving the steatosis of non-alcoholic fatty liver disease.
[0156] Example 9 Effects of GPR180 knockdown on plasma and liver lipid content
[0157] The cholesterol (CHO) content in the plasma and liver of experimental mice was detected.
[0158] In NCD mice, the plasma CHO content in the AAV-shRNA GPR180-treated group was not different from that in the control group, while in HFD mice, the plasma CHO content in the AAV-shRNA GPR180-treated group showed a downward trend compared with the control group ( Figure 10 A).
[0159] In NCD and HFD mice, the CHO content in the liver tissue of the AAV-shRNA GPR180-treated group was downregulated to varying degrees, and the decrease was more obvious in the HFD group ( Figure 10 B).
[0160] Example 10 Effect of GPR180 gene knockdown on glucose metabolism in mice
[0161] After 11 weeks of feeding, we performed insulin tolerance tests on the mice. The results showed that after AAV-shRNA GPR180 treatment, both NCD mice and HFD mice showed significantly enhanced insulin sensitivity ( Figure 11 A and B).
[0162] The above describes the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included in the scope of protection of the present invention.
Claims
1. Use of a GPR180 inhibitor in the preparation of a medicament for treating non-alcoholic fatty liver disease, wherein the inhibitor is an interfering sequence of the GPR180 gene, which consists of the following four sequences: 5'-CTCCCAAATTCAGATGCTGTA-3', 5'-TGCTTCAGCCTTAGCTAATTA-3', 5'-GCTTCAGCCTTAGCTAATTAC-3' and 5'-GCTCTTGCTGATTGTCTTACG-3'.
2. The use according to claim 1, wherein the non-alcoholic fatty liver disease is non-alcoholic fatty liver.
3. The use according to claim 1 or 2, wherein the interference sequence of the GPR180 gene is carried on an expression vector.
4. The use according to claim 3, wherein the expression vector comprises a promoter and a transcription termination sequence operably linked to the interfering sequence of the GPR180 gene.
5. The use according to claim 3, wherein the expression vector is a plasmid expression vector or a viral expression vector.
6. The use according to claim 5, wherein the plasmid expression vector is selected from pcDNA3.1+ / -, pcDNA4 / HisMax B, pSecTag2 A, pVAX1, pBudCE4.1, pTracer CMV2, pcDNA3.1(-) / myc-His A, pcDNA6-Myc / HisB, pCEP4, pIRES, pIRESneo, pIRES hyg3, pCMV-myc, pCMV-HA, pIRES-puro3, pIRES-neo3, pCAGGS, pSilencer1.0, pSilencer2.1-U6 hygro, pSilencer3.1-H1 hygro, pSilencer3.1-H1 neo, or pSilencer4.1-CMV neo.
7. The use according to claim 5, wherein the viral expression vector is selected from a lentiviral vector, an adenoviral vector, and an adeno-associated viral expression vector.
8. The use according to claim 7, wherein the viral expression vector is selected from pLKO.1, pLVX-IRES-ZsGreen1, pCDH-EF1-Luc2-T2A-tdTomato, pCDH-MSCV-MCS-EF1-Puro, pCDH-MSCV-MCS-EF1-copGFP, pLVX-ZsGreen1-C1, pAdEasy-1, pShuttle-CMV, pShuttle, pAdTrack, pAdTrack-CMV, pShuttle-IRES-hrGFP-1, pShuttle-IRES-hrGFP-2, pShuttle-CMV-lacZ, pShuttle-CMV-EGFP-C, pXC1, pBHGE3, pAAV-MCS, pAAV-RC, pHelper, pAAV-LacZ or pAV-GFP.
9. The method according to any one of claims 1 to 2, wherein the medicament further comprises a pharmaceutically acceptable excipient.
10. The use according to any one of claims 1 to 2, wherein the medicament is in the form of an oral or injectable dosage form.
11. The use according to any one of claims 1 to 2, wherein the medicine is in the form of tablets, capsules, pills, powders, granules, suspensions, syrups, injections, or powder injections.
Citation Information
Patent Citations
Application of GPR31 inhibitor to preparation of drugs for treating abnormal fat metabolism and related diseases
CN110538327A
Pharmaceutical composition containing GPR119 ligand as active ingredient for preventing or treating non-alcoholic fatty liver disease
US20170049773A1