A real-time fluorescence quantitative PCR detection method for Ailurus fulgens parvovirus
Through real-time fluorescence quantitative PCR detection method, specific primers and recombinant plasmids were designed to establish a quantitative detection system for parvovirus in the red panda, solving the problem of lack of effective detection methods in the existing technology, achieving rapid, sensitive and high specific detection effects, and protecting the health of red pandas and giant pandas.
Patent Information
- Application Number
- CN202211361469.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-02
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2042-11-02
AI Technical Summary
The existing technology has not yet established a complete detection method to deal with the detection needs of the red panda parvovirus, which has led to the inability to effectively monitor and control the spread of the virus, affecting the health of red pandas and giant pandas.
Real-time fluorescence quantitative PCR detection method was adopted to design specific primers and construct the recombinant plasmid pcDNA3.1HA-RPAV-VP1, and a quantitative detection system for red panda parvovirus was established to achieve specific and sensitive detection of viruses in the samples to be tested.
The rapid, sensitive and specific detection of the red panda parvovirus was achieved, with the lower detection limit reaching 101 copies/μL, which has high repetition and short detection time, filling the technical gap in the virus detection method and helping to protect the health of the red pandas and giant pandas.
Smart Images

Figure CN116024384B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of virus detection, and particularly relates to a real-time fluorescence quantitative PCR detection method for red panda parvovirus. Background Art
[0002] Parvovirus is a family of animal viruses that make up the Parvoviridae ( Parvoviridae ), and is a class of non-enveloped single-stranded linear DNA viruses. Among all axially symmetric DNA viruses, parvovirus is one of the smallest viruses, with a virion diameter of 18 - 26 nm. The parvovirus genome is about 4 kb - 6.3 kb in length, and its GC content is about 40% - 55%. It includes a 5' non-coding region, two open reading frames (ORF1, ORF2), and a 3' non-coding region. Among them, ORF1 encodes the non-structural protein NS through alternative splicing, and ORF2 encodes the structural protein VP. Currently, the Parvoviridae is divided into two subfamilies according to the host, namely the Parvovirinae that infect vertebrates and their cell cultures ( Parvovirinae ), and the Densovirinae that infect arthropods ( Densovirnae ). Parvoviruses can cause a variety of diseases in animals. Canine parvovirus and feline parvovirus cause severe diseases and death in dogs and cats respectively. Porcine parvovirus is the main cause of infertility in pigs, and human bocavirus is a common cause of acute respiratory diseases, especially common in acute respiratory diseases of young children. Parvoviruses have strong resistance to the environment and are one of the important infectious disease sources threatening the health of animals and even humans.
[0003] In recent years, frequent death events of red pandas ( Ailurus fulgens have occurred in the Chengdu Research Base of Giant Panda Breeding. In previous studies, the emerging metagenomics method was used to study the dead red pandas. DNA libraries were constructed and high-throughput sequencing was carried out. Through bioinformatics analysis of the sequencing results, the full-length genomes of 7 parvoviruses were obtained. The complete NS1 and VP2 amino acid sequences had identities of 87.99% - 99.84% and 92.19% - 98.90% respectively. The results of phylogenetic analysis showed that the newly discovered 7 parvoviruses might represent a new species of the genus Amdoparvovirus ( Amdoparvovirus ), named red panda parvovirus (Red Panda Amdoparvovirus, RPAV). The research on the virus metagenomics of giant pandas and related organisms in the Chengdu Research Base of Giant Panda Breeding in Sichuan found that there is extensive transmission of viruses in giant pandas and their related organisms in the same ecosystem, and there is frequent cross-species transmission of viruses. Red panda parvovirus is the cause of some red pandas getting sick or dying, posing a huge threat to the health and life of red pandas, and there is a possibility of infecting the giant panda population.
[0004] At present, the research on the new member of the genus Aleutivirus of the Parvoviridae family, the red panda parvovirus, is still in its infancy, and a perfect detection method has not been established. The real-time fluorescence quantitative PCR method is one of the internationally recognized methods for detecting viruses, with the advantages of being rapid, simple, highly specific, highly sensitive, good repeatability, and accurate quantification. Establishing a quantitative PCR detection method for the novel red panda parvovirus can fill the technical gap in the detection method for this virus, contribute to the extensive molecular biology detection of RPAV, and play a significant role in timely blocking the transmission of RPAV and protecting the health of red pandas and giant pandas. Summary of the Invention
[0005] In view of this, the purpose of the present invention is to provide a real-time fluorescence quantitative PCR detection method for the red panda parvovirus (RPAV) in view of the problems existing in the prior art. This detection method can achieve quantitative detection of the red panda parvovirus in the sample to be detected, and has multiple technical characteristics such as rapidity, high sensitivity, and strong specificity.
[0006] To achieve the purpose of the present invention, the present invention adopts the following technical solutions:
[0007] The present invention provides a real-time fluorescence quantitative PCR detection method for detecting the red panda parvovirus, and the method comprises the following steps:
[0008] (1) Perform sequence alignment based on the VP1 gene sequences of 7 red panda parvoviruses, and design specific primers RPAV-VP1-PF and RPAV-VP1-PR, RPAV-QPF and RPAV-QPR for the conserved sequence region of the virus according to the results; their nucleotide sequences are shown as Seq_1 to Seq_4 respectively;
[0009] (2) Using the DNA of the red panda parvovirus as a template, perform PCR amplification with the specific primers RPAV-VP1-PF and RPAV-VP1-PR designed in step (1) to obtain a DNA fragment of the target gene VP1;
[0010] (3) Purify the PCR amplification product, ligate it with the plasmid vector pcDNA3.1HA linearized after enzyme digestion, transform it into Escherichia coli competent cells, pick positive clones to extract plasmids, and obtain the recombinant plasmid pcDNA3.1HA-RPAV-VP1 standard product;
[0011] (4) Dilute the recombinant plasmid pcDNA3.1HA-RPAV-VP1 by 10-fold serial dilution to obtain the recombinant plasmid standard solution, and use it as a template. Perform SYBR Green I real-time fluorescence quantitative PCR with specific primers RPAV-QPF and RPAV-QPR. Use the logarithm of the copy number concentration of the recombinant plasmid standard as the abscissa and the Ct value as the ordinate to obtain the linear regression equation.
[0012] (5) Use the DNA of the sample to be tested as a template, perform SYBR Green I real-time fluorescence quantitative PCR with specific primers RPAV-QPF and RPAV-QPR, and substitute the obtained Ct value into the linear regression equation constructed in step (4) to achieve real-time fluorescence quantitative detection of parvovirus in the sample to be tested.
[0013] Further, the reaction system for the PCR amplification in step (2) is as follows: 5 μL of DNA template, 1 μL of RPAV-VP1-PF, 1 μL of RPAV-VP1-PR, 25 μL of Prime STAR, and ddH 2 O is added to 50 μL.
[0014] The reaction program for the PCR amplification in step (2) is as follows: pre-denaturation at 98 °C for 3 min, denaturation at 98 °C for 20 s, annealing at 60 °C for 20 s, extension at 72 °C for 2 min for 35 cycles, extension at 72 °C for 10 min, and storage at 16 °C for 2 min.
[0015] The size of the DNA fragment in step (2) is 2037 bp.
[0016] The concentration of the recombinant plasmid standard solution in step (4) is 8.34×10 1 ~8.34×10 8 copies / μL.
[0017] The linear regression equation in step (4) is y = -3.1557x + 36.419.
[0018] Further, the reaction system for the real-time fluorescence quantitative PCR is as follows: 5 μL of 2×SYBR Green I Mix, 0.05 μL of upstream primer RPAV-QPF (10 μM), 0.05 μL of downstream primer RPAV-QPF (10 μM), 1 μL of DNA template, and 3.9 μL of nuclease-free water (ddH 2 O).
[0019] The reaction program for the real-time fluorescence quantitative PCR is as follows: 30 s at 95 °C, 10 s at 95 °C,
[0020] 60 °C for 30 s for 40 cycles, 95 °C for 15 s, 60 °C for 60 s.
[0021] The present invention also provides a set of universal primers for real-time fluorescence quantitative PCR detection of red panda parvovirus, named RPAV-VP1 and RPAV-Q; the upstream primer of RPAV-VP1 is RPAV-VP1-PF, and its nucleotide sequence is shown as Seq_1 in the sequence listing, and the downstream primer is RPAV-VP1-PR, and its nucleotide sequence is shown as Seq_2 in the sequence listing; the upstream primer of RPAV-Q is RPAV-QPF, and its nucleotide sequence is shown as Seq_3 in the sequence listing, and the downstream primer is RPAV-QPR, and its nucleotide sequence is shown as Seq_4 in the sequence listing.
[0022] The present invention also provides a kit for real-time fluorescence quantitative PCR detection of red panda parvovirus, and the kit contains the above-mentioned universal primers.
[0023] Compared with the prior art, the beneficial effects of the present invention are:
[0024] The present invention designs and synthesizes specific primers according to the gene sequence of RPAV VP1, constructs a recombinant plasmid pcDNA3.1HA-RPAV-VP1, establishes a standard curve as a standard product, constructs a real-time fluorescence quantitative PCR detection system for red panda parvovirus, and realizes the specific detection of red panda parvovirus RPAV. There is no specific amplification for various viruses such as HSV; it can detect 10 1 copies / μL of the recombinant plasmid, which is 100 times that of conventional PCR; the maximum coefficient of variation for intra-group repeats is 1.41%, and the maximum coefficient of variation for inter-group repeats is 2.02%. It has the advantages of high specificity and sensitivity, good repeatability and short time consumption. The detection result can be directly read out by computer software, without the need for operations such as agarose gel electrophoresis and gel imaging detection, simplifying the experimental steps and saving the detection time. It provides a new detection method for detecting red panda parvovirus, fills the technical gap in the detection of panda parvovirus, provides a basis for diagnosing red panda parvovirus infection, and plays an important role in protecting red pandas and giant pandas. It has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 is the optimization diagram of the annealing temperature of RPAV fluorescence quantitative PCR;
[0026] Figure 2 is the optimization diagram of the primer concentration of red panda parvovirus fluorescence quantitative PCR;
[0027] Figure 3 is the standard curve diagram of red panda parvovirus fluorescence quantitative PCR;
[0028] Figure 4 It is a comparative graph of the specificity verification of real-time fluorescence quantitative PCR for red panda parvovirus;
[0029] Figure 5 It is a graph of the sensitivity verification of conventional PCR for red panda parvovirus;
[0030] Figure 6 It is a graph of the sensitivity verification of real-time fluorescence quantitative PCR for red panda parvovirus. Specific implementation method
[0031] The present invention provides a method for detecting red panda parvovirus by real-time fluorescence quantitative PCR. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments. Relevant personnel can obviously make changes or appropriate alterations and combinations to the methods and applications in this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.
[0032] Unless otherwise specified, the methods in the examples are all conventional methods, and the reagents used are all conventional commercially available reagents or reagents prepared according to conventional methods if not otherwise specified.
[0033] Samples: pcDNA3.1HA vector plasmid, Prime STAR, virus nucleic acid extraction kit, KpnⅠ and EcoRⅠ restriction endonucleases are from TaKaRa; homologous recombinase and DH5α Escherichia coli competent cells are both purchased from Novizan; DNA gel recovery kit and endotoxin-free plasmid midiprep kit are from CW Biotech; the feces, lung tissue samples and kidney tissue samples of red pandas infected with red panda parvovirus are all from the Chengdu Research Base of Giant Panda Breeding, Sichuan.
[0034] Example 1: Construction of the recombinant plasmid pcDNA3.1HA-RPAV-VP1 of red panda parvovirus (RPAV)
[0035] According to 7 VP1 gene sequences of red panda parvovirus newly discovered in the previous research of our laboratory (GenBank number: MZ357124~MZ357130), sequence alignment was performed using MEGA-X software (v10.1.8). According to the sequence alignment results, the conserved sequence region of the virus was selected, and specific amplification primers were designed in combination with the sequence of the pcDNA3.1HA vector plasmid (as shown in Seq_5 in the sequence listing). Its upstream sequence is RPAV-VP1-PF, and its nucleotide sequence is as shown in Seq_1, that is: CCAGAT TACGCTTACGGTACCATGAGTAAAATTCCTCAGC; The downstream sequence is RPAV-VP1-PR, and its nucleotide sequence is shown in Seq_2, that is: TGCTGGATATCTGCAGAATTC TTAGTAGAGATACTTTATAG, where the underlined part is the pcDNA3.1HA vector sequence. The primers were all synthesized by Sangon Biotech (Shanghai) Co., Ltd. Take the feces of red pandas infected with red panda parvovirus, extract the viral nucleic acid using a viral nucleic acid extraction kit, use the extracted viral DNA as a template, and perform PCR amplification with primers RPAV-VP1-PF and RPAV-VP1-PR to obtain the DNA fragment of the target gene VP1, and the fragment size is 2037bp; The PCR amplification reaction system is: 5 μL of DNA template, 1 μL of RPAV-VP1-PF, 1 μL of RPAV-VP1-PR, 25 μL of Prime STAR, and nuclease-free water (ddH 2 O) is added to 50 μL. The PCR reaction program is shown in Table 1:
[0036] Table 1. PCR reaction program
[0037]
[0038] Perform double digestion reaction on the pcDNA3.1HA vector plasmid using KpnⅠ and EcoRⅠ restriction endonucleases. Add samples on ice and perform water bath at 37 °C for 2 h. The pcDNA3.1HA plasmid digestion system is: 1 μg of pcDNA3.1HA, 1 μL of KpnⅠ, 1 μL of EcoRⅠ, 5 μL of 10×M buffer, and ddH 2 O is added to 50 μL. After the PCR product and the digestion product are electrophoresed on a 1.2% agarose gel, use a DNA gel recovery kit to cut and recover the specific band that meets the target fragment size (2037bp), connect it with the linearized plasmid vector pcDNA3.1HA after digestion using a homologous recombination enzyme, transform it into DH5α Escherichia coli competent cells, pick the positive clone bacterial solution for first-generation sequencing (Sangon Biotech), compare the sequencing result with the obtained red panda parvovirus VP1 gene sequence using Geneious Prime software (v2019.2.3), select the positive clone bacterial solution with exactly the same comparison result for overnight culture at 37 °C, and use an endotoxin-free plasmid mid-prep kit to extract the plasmid to obtain the recombinant plasmid pcDNA3.1HA-RPAV-VP1 (7466bp) standard product, and its nucleotide sequence is shown in Seq_6 in the sequence list. The obtained recombinant plasmid has an OD260 / OD280 ratio between 1.8 and 2.0, with high purity and can be used for subsequent standard curve establishment experiments.
[0039] Example 2: Optimization and Establishment of SYBR Green Ⅰ Fluorescent Quantitative PCR Detection Method for Red Panda Parvovirus (RPAV)
[0040] According to the sequence alignment results of red panda parvovirus in Example 1, specific primers were designed by selecting conserved sequence regions. The upstream sequence was RPAV-QPF, and its nucleotide sequence was as shown in Seq_3, i.e., CCCTCCAGGTCAACTCCTTG. The downstream sequence was RPAV-QPR, and its nucleotide sequence was as shown in Seq_4, i.e., CACAGGGTTCCAGCATGCTA. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Using the recombinant plasmid pcDNA3.1HA-RPAV-VP1 standard obtained in Example 1 as a template, the optimal annealing temperature was selected at 50°C - 60°C, and the optimal final primer concentration was selected within the range of 0.05 μM - 0.25 μM. Figure 1 It is the optimization diagram of the annealing temperature of RPAV fluorescent quantitative PCR; in the figure, M is the DNA ladder marker, and numbers 1 - 7 represent 50°C, 52°C, 54°C, 56°C, 58°C, 60°C, and H 2 O. Figure 2 It is the optimization diagram of the primer concentration of red panda parvovirus (RPAV) fluorescent quantitative PCR; in the figure, numbers 1 - 6 represent the final primer concentrations of 0.05 μM, 0.1 μM, 0.15 μM, 0.2 μM, 0.25 μM, and H 2 O. From Figure 1 、 Figure 2 It was determined that the SYBR Green Ⅰ fluorescent quantitative PCR reaction system was: SYBR Green Mix 5 μL, RPAV-QPF (10 μM) 0.05 μL, RPAV-QPF (10 μM) 0.05 μL, DNA template 1 μL, and nuclease-free water (ddH 2 O) 3.9 μL. The PCR reaction program is shown in Table 2.
[0041] Table 2. SYBR Green Ⅰ Real-Time Fluorescent Quantitative PCR Reaction Program
[0042] Note: For different types of instruments, the melting curve acquisition program is not exactly the same. Just use the default melting curve acquisition program of the instrument.
[0043] Example 3: Establishment of the Standard Curve of SYBR Green Ⅰ Fluorescent Quantitative PCR Detection Method for Red Panda Parvovirus (RPAV)
[0044] The molecular weight of the recombinant plasmid standard pcDNA3.1HA-RPAV-VP1 (7466 bp) constructed according to Example 1 was converted to copy number concentration, and the formula used was copies / μL=(6.02×10 23 )×(ng / μL×10 -9 ) / (DNA length×660). A series of recombinant plasmid standard solutions with a concentration gradient were prepared by 10-fold serial dilution of the recombinant plasmid pcDNA3.1HA-RPAV-VP1. Using different concentrations of the recombinant plasmid standard solutions as templates, SYBR Green I real-time fluorescence quantitative PCR was performed with the specific primers RPAV-QPF and RPAV-QPR. The real-time fluorescence quantitative PCR system and reaction procedure were as described in Example 2.
[0045] Figure 3 is the standard curve of fluorescence quantitative PCR for red panda parvovirus (RPAV); as Figure 3 shown, with the logarithm of the copy number concentration of the recombinant plasmid standard as the abscissa and the Ct value as the ordinate, a linear regression equation was obtained to establish the standard curve. When the concentration of the recombinant plasmid pcDNA3.1HA-RPAV-VP1 was between 8.34×10 1 ~8.34×10 8 copies / μL, there was a good linear relationship between the Ct value and the logarithm of the recombinant plasmid copy number concentration. The linear equation was y = -3.1557x + 36.419, and the correlation coefficient (R 2 ) was 0.9972.
[0046] Example 4: Specificity verification of the SYBR Green I fluorescence quantitative PCR detection method for red panda parvovirus (RPAV)
[0047] Herpes simplex virus (HSV), Sendai virus (SeV), Vesicular stomatitis virus (VSV), and Porcine deltacoronavirus (PDCoV) were stored in our laboratory, and the nucleic acid of Bocavirus was stored in our laboratory. The viral nucleic acids of HSV, SeV, VSV, and PDCoV were extracted using a viral nucleic acid extraction kit. The RNA viral nucleic acid was reverse transcribed into cDNA by reverse transcription PCR. Using the recombinant plasmid pcDNA3.1HA-RPAV-VP1 standard solution, the extracted viral DNA, and the reverse transcribed viral cDNA as templates respectively, and using nuclease-free water as a blank control, the established SYBR Green I fluorescence quantitative PCR detection method for red panda parvovirus was used for analysis.
[0048] Figure 4It is a comparative diagram for the specificity verification of real-time fluorescence quantitative PCR of red panda parvovirus; in the figure, 1 is pcDNA3.1HA-RPAV-VP1, 2 is H 2 O, 3 is HSV, 4 is SeV, 5 is PDCoV, 6 is VSV, 7 is Bocavirus; as Figure 4 shown, only the qPCR sample with pcDNA3.1HA-RPAV-VP1 as the template has a typical amplification curve. There are no obvious peaks in the control virus and the blank control, indicating that the established SYBR Green Ⅰ fluorescence quantitative PCR detection method for red panda parvovirus has the specificity for detecting RPAV.
[0049] Example 5: Sensitivity verification of SYBR Green Ⅰ fluorescence quantitative PCR detection method for red panda parvovirus (RPAV)
[0050] The recombinant plasmid pcDNA3.1HA-RPAV-VP1 was diluted 10-fold serially to obtain a series of recombinant plasmid standard solutions with concentration gradients of 8.34×10 8 ~8.34×10 1 copies / μL. Using the recombinant plasmid standard solutions with different concentrations as templates and nuclease-free water as the blank control, conventional PCR and real-time fluorescence quantitative PCR detections were carried out respectively.
[0051] Figure 5 It is a diagram for the sensitivity verification of conventional PCR of red panda parvovirus (RPAV); in the figure, numbers 1-9 respectively represent H 2 O, 8.34×10 8 copies / μL, 8.34×10 7 copies / μL, 8.34×10 6 copies / μL, 8.34×10 5 copies / μL, 8.34×10 4 copies / μL, 8.34×10 3 copies / μL, 8.34×10 2 copies / μL, 8.34×10 1 copies / μL; as Figure 5 shown, the detection limit of conventional PCR is 8.34×10 3 copies / μL.
[0052] Figure 6 It is a diagram for the sensitivity verification of real-time fluorescence quantitative PCR of red panda parvovirus; in the figure, numbers 1-9 respectively represent H 2 O, 8.34×10 8copies / μL, 8.34×10 7 copies / μL, 8.34×10 6 copies / μL, 8.34×10 5 copies / μL, 8.34×10 4 copies / μL, 8.34×10 3 copies / μL, 8.34×10 2 copies / μL, 8.34×10 1 copies / μL. As Figure 6 shown, the detection limit of real-time fluorescence quantitative PCR is 8.34×10 1 copies / μL, which can confirm that the sensitivity of real-time fluorescence quantitative PCR is 100 times that of conventional PCR.
[0053] Example 6: Repeatability verification of SYBR Green I fluorescence quantitative PCR detection method for red panda parvovirus (RPAV)
[0054] Select the recombinant plasmid standard solution of 5 dilution gradients of 8.34×10 7 ~8.34×10 3 copies / μL in Example 2 as templates to perform intra-group and inter-group real-time fluorescence quantitative PCR reactions respectively, and use the standard deviation (SD) and coefficient of variation (CV) of Ct values as the judgment criteria. The experimental results are shown in Table 3.
[0055] Table 3. Results of repeatability experiment of SYBR Green I fluorescence quantitative PCR detection method
[0056]
[0057] As can be seen from Table 3, the maximum coefficient of variation of intra-group repeat of the SYBR Green I fluorescence quantitative PCR detection system for red panda parvovirus (RPAV) is 1.41%, and the maximum coefficient of variation of inter-group repeat is 2.02%, indicating that the detection system established by the present invention has good repeatability.
[0058] Example 7: Detection of red panda parvovirus (RPAV) in red panda samples
[0059] Extract viral nucleic acids from 10 dead red panda tissue samples provided by the Chengdu Research Base of Giant Panda Breeding in Sichuan. Use the real-time fluorescence quantitative PCR detection system established by the present invention to detect RPAV in 20 viral nucleic acids, and compare the obtained Ct values with the standard curve established by the present invention. When the concentration of viral nucleic acids exceeds the detection limit of 8.34×10 determined in Example 3 1When it is [[ID=]], the test result is determined to be negative. Table 4 shows the test results of 20 samples.
[0060] Table 4. Test Results of 20 Samples by SYBR Green I Fluorescent Quantitative PCR Detection Method for RPAV
[0061]
[0062] Note: +, positive; -, negative.
[0063] As can be seen from Table 4, the detection rate of red panda parvovirus in the samples is 45%, which can be used for the detection of RPAV in red panda samples and has a good detection effect. The present invention fills the technical gap in the detection of novel red panda parvovirus.
[0064] In summary, the detection method for red panda parvovirus (RPAV) provided by the present invention has the advantages of high specificity, high sensitivity, good repeatability and short time consumption. In the embodiment of the present invention, specific primers were designed and synthesized according to the gene sequence of RPAV VP1, a recombinant plasmid pcDNA3.1HA-RPAV-VP1 was constructed as a standard product to establish a standard curve, and a real-time fluorescent quantitative PCR detection system for red panda parvovirus was established, realizing the quantitative detection of RPAV.
[0065] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A real-time fluorescence quantitative PCR detection method for detecting parvovirus of red panda for non-diagnostic purposes, characterized in that, the method comprises the following steps: (1) Sequence alignment is performed according to 7 VP1 gene sequences of parvovirus of red panda, and specific primers RPAV-VP1-PF and RPAV-VP1-PR, RPAV-QPF and RPAV-QPR are designed according to the results for the conserved sequence region of the virus; their nucleotide sequences are shown in SEQ ID NO:1 to SEQ ID NO:4 respectively; (2) Using the DNA of parvovirus of red panda as a template, PCR amplification is carried out with the specific primers RPAV-VP1-PF and RPAV-VP1-PR designed in step (1) to obtain a DNA fragment of the target gene VP1; (3) Purify the PCR amplification product, ligate it with the plasmid vector pcDNA3.1HA linearized after enzyme digestion, transform it into competent Escherichia coli cells, pick positive clones to extract plasmids, and obtain the recombinant plasmid pcDNA3.1HA-RPAV-VP1 standard; (4) Dilute the recombinant plasmid pcDNA3.1HA-RPAV-VP1 by 10-fold serial dilution to obtain a recombinant plasmid standard solution, and use it as a template to perform SYBR Green Ⅰ real-time fluorescence quantitative PCR with specific primers RPAV-QPF and RPAV-QPR. Using the logarithm of the copy number concentration of the recombinant plasmid standard as the abscissa and the Ct value as the ordinate, a linear regression equation y = -3.1557x + 36.419 is obtained, and the correlation coefficient is 0.9972; (5) Using the DNA of the sample to be tested as a template, perform SYBR Green Ⅰ real-time fluorescence quantitative PCR with specific primers RPAV-QPF and RPAV-QPR, and substitute the obtained Ct value into the linear regression equation constructed in step (4) to achieve real-time fluorescence quantitative detection of parvovirus of red panda in the sample to be tested.
2. The detection method according to claim 1, characterized in that, the reaction program of the PCR amplification in step (2) is: pre-denaturation at 98°C for 3 min, denaturation at 98°C for 20 s, annealing at 60°C for 20 s, extension at 72°C for 2 min for 35 cycles, extension at 72°C for 10 min, and storage at 16°C for 2 min.
3. The detection method according to claim 1, characterized in that, the size of the DNA fragment in step (2) is 2037 bp.
4. The detection method according to claim 1, characterized in that, The concentration of the recombinant plasmid standard solution in step (4) is 8.34×10 1 ~8.34×10 8 copies / μL.
5. The detection method according to claim 1, characterized in that, the reaction system of the real-time fluorescence quantitative PCR is all: 2×SYBR Green Ⅰ Mix 5 μL, upstream primer RPAV-QPF 0.05 μL, downstream primer RPAV-QPF 0.05 μL, DNA template 1 μL, nuclease-free water 3.9 μL.
6. The detection method according to claim 1, characterized in that, The reaction program of the real-time fluorescence quantitative PCR is as follows: 95°C for 30 s, 40 cycles of 95°C for 10 s and 60°C for 30 s, 95°C for 15 s, 60°C for 60 s.
7. A set of universal primers for the real-time fluorescence quantitative PCR detection of Ailurus fulgens parvovirus, characterized in that the universal primers are RPAV-VP1 and RPAV-Q; the upstream primer of RPAV-VP1 is RPAV-VP1-PF, and its nucleotide sequence is shown as SEQ ID NO:1 in the sequence listing, and the downstream primer is RPAV-VP1-PR, and its nucleotide sequence is shown as SEQ ID NO:2 in the sequence listing; the upstream primer of RPAV-Q is RPAV-QPF, and its nucleotide sequence is shown as SEQ ID NO:3 in the sequence listing, and the downstream primer is RPAV-QPR, and its nucleotide sequence is shown as SEQ ID NO:4 in the sequence listing.
8. A kit for the real-time fluorescence quantitative PCR detection of Ailurus fulgens parvovirus, characterized in that the kit contains the universal primers described in claim 7.
Citation Information
Patent Citations
SYBR Green I fluorescent quantitative PCR detection method for porcine parvovirus 7-type
CN111690769A