Primer combination and method for identifying six holly varieties

Abstract

The present invention provides a primer combination and a discrimination method for identifying different holly varieties. The nucleotide sequences of the primers are shown in Sequence Listing SEQ ID NO.1-2, SEQ ID NO.3-4, SEQ ID NO.5-6, SEQ ID NO.7-8, SEQ ID NO.9-10, SEQ ID NO.11-12 and SEQ ID NO.13-14. The present invention provides a set of PCR detection methods based on the primers. The method uses the DNA of 'Wirt L. Winn', Ilex lohfauensis, Ilex dabieshanensis, Ilex intermedia, Ilex crenata and Ilex attenuata as templates, amplifies using different annealing temperatures, and identifies different holly varieties according to the agarose gel electrophoresis results of the amplification products. The primers of the present invention have good specificity and high accuracy, which can bring convenience to the actual production and sales of holly. At the same time, the operation method is simple and the cost is low.

Description

Technical Field

[0001] This application relates to the field of biological detection, specifically to a primer combination and a PCR detection method for detecting Ilex variety resources. Background Art

[0002] Plants of the genus Ilex are evergreen or deciduous trees or shrubs of the family Aquifoliaceae. Excellent Ilex varieties have ornamental values such as fast growth rate, strong adaptability, graceful tree posture, lush branches and leaves, and bright fruit colors. The roots, branches, leaves and bark of some Ilex varieties can be used as medicine, having high economic value and ecological value. Now, with the improvement of people's living standards, the requirements for the environment are also getting higher and higher. Therefore, some excellent Ilex varieties are more widely used in the beautification of roads, parks, courtyards and campus environments.

[0003] Many excellent Ilex varieties are propagated by cuttings. During the industrialized production of seedlings, how to ensure the consistency of variety seedlings and how to ensure the quality of nursery stock have become urgent problems faced in the current production and sales of Ilex seedlings.

[0004] At present, more and more plant species delimitation, purity identification and variety discrimination are analyzed and solved through the genetic diversity in the chloroplast genome. 'Wirt L. Winn', Ilex kudingcha, Ilex dabieshanensis, Ilex intermedia, Ilex crenata and Ilex attenuata are relatively common Ilex varieties. The present invention aims to design primers using polymorphic sites in the chloroplast genome as markers to provide an efficient and accurate discrimination method for these 6 Ilex varieties, so as to solve the problems of purity detection and variety discrimination faced in the production and sales processes. Summary of the Invention

[0005] This application provides a primer combination for discriminating Ilex varieties and its application to solve the technical problem of the lack of a fast and accurate method for discriminating Ilex varieties at present.

[0006] This application provides a primer combination for discriminating Ilex varieties. The primer combination includes primer group A, and the nucleotide sequence of primer group A is shown as SEQ ID NO.1-2.

[0007] The primer combination further includes primer group B, and the nucleotide sequence of primer group B is shown as SEQ ID NO.3-4.

[0008] The primer combination further includes primer group C, and the nucleotide sequence of primer group C is shown as SEQ ID NO.5-6.

[0009] The primer combination further includes primer set D, and the nucleotide sequences of primer set D are shown in SEQ ID NO.7-8.

[0010] The primer combination further includes primer set E, and the nucleotide sequences of primer set E are shown in SEQ ID NO.9-10.

[0011] The primer combination further includes primer set F, and the nucleotide sequences of primer set F are shown in SEQ ID NO.11-12.

[0012] The primer combination further includes primer set G, and the nucleotide sequences of primer set G are shown in SEQ ID NO.13-14.

[0013] This application provides the application of the described primer combination in the method for detecting holly varieties.

[0014] This application provides a method for detecting holly varieties, the method includes using the described primer combination, and judging by the bands after agarose gel electrophoresis of the PCR amplification products.

[0015] Optionally, the amplification reaction includes denaturation, annealing and primer extension; the temperature of denaturation is 98°C; the temperature of annealing is 55-61°C; the temperature of primer extension is 72°C.

[0016] Optionally, the amplification products are detected by 2% agarose gel electrophoresis, with a voltage of 120v and a time of 25-30min.

[0017] The above technical solutions provided by the embodiments of this application have the following advantages compared with the prior art:

[0018] This application has established a primer combination and a detection method applicable to detecting 6 holly varieties. When using this set of specific primers to identify and distinguish holly varieties, the results can be identified quickly and accurately; the method used is a conventional PCR reaction with a high success rate; the results are presented in the form of an agarose gel electrophoresis diagram, with a simple operation method and low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The drawings here are incorporated into the specification and form a part of this specification, showing the embodiments that conform to the present invention, and are used together with the specification to explain the principles of the present invention.

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, for those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0021] Figure 1 The electrophoresis diagram provided for Embodiment 2 of this application;

[0022] Figure 2 The electrophoresis diagrams provided for Embodiments 3-8 of this application;

[0023] Among them, 1 represents 'Wirt L. Winn', 2 represents Ilex lohfauensis Merr., 3 represents Ilex dabieshanensis, 4 represents Ilex intermedia, 5 represents Ilex crenata Thunb. and 6 represents Ilex attenuata Hook. f. Detailed implementation manners

[0024] To make the objectives, technical solutions and advantages of the embodiments of this application clearer, the technical solutions in the embodiments of this application will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of this application. Obviously, the described embodiments are part of the embodiments of this application, rather than all of them. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of this application.

[0025] According to a typical implementation manner of the present invention, a primer combination for detecting holly varieties is provided. The primer combination includes primer set A, and the nucleotide sequences of primer set A are shown in SEQ ID NO.1-2.

[0026] Primer set A is designed according to the conserved sites of the holly chloroplast genome and is intended to be used as a positive control. Bands of the same size can be amplified for all these 6 holly varieties. If no bands are amplified, it indicates that there may be problems with the sample variety, DNA template, PCR reaction solution or PCR program, etc.

[0027] 'Wirt L. Winn' can be identified by primer set B, and the nucleotide sequences of primer set B are shown in SEQ ID NO.3-4; it can also be identified by primer sets D+E+F, and the nucleotide sequences of primer sets D, E and F are shown in SEQ ID NO.7-8, SEQ ID NO.9-10 and SEQ ID NO.11-12 respectively.

[0028] Ilex lohfauensis Merr. can be identified by primer set C, and the nucleotide sequences of primer set C are shown in SEQ ID NO.5-6; it can also be identified by primer sets B+E+G, and the nucleotide sequences of primer sets B, E and G are shown in SEQ ID NO.3-4, SEQ ID NO.9-10 and SEQ ID NO.13-14 respectively.

[0029] Ilex dabieshanensis can be identified by primer set D, and the nucleotide sequences of primer set D are shown in SEQ ID NO.7-8.

[0030] Medium Ilex can be identified by primer set F, and the nucleotide sequences of primer set F are shown in SEQ ID NO.11-12.

[0031] Narrow-crowned Ilex can be identified by primer set G, and the nucleotide sequences of primer set G are shown in SEQ ID NO.13-14.

[0032] Crenate Ilex can be identified by primer set B, and the nucleotide sequences of primer set B are shown in SEQ ID NO.3-4; it can also be identified by primer set E+G, and the nucleotide sequences of primer set E and G are shown in SEQ ID NO.9-10 and SEQ ID NO.13-14.

[0033] Specifically, the forward primer of A is as shown in SEQ ID N0.1: TCCACTTGGCTACATCCGC;

[0034] The reverse primer of A is as shown in SEQ ID N0.2: ATATACCTTCTTCCCAATCT;

[0035] The forward primer of B is as shown in SEQ ID N0.3: TTTCTTTCTTTKTTTTTTAGATCA;

[0036] The reverse primer of B is as shown in SEQ ID N0.4: TTGGTATGGMAGTTATGCATGAA;

[0037] The forward primer of C is as shown in SEQ ID N0.5: CTACCCGCTCTACATCCTC;

[0038] The reverse primer of C is as shown in SEQ ID N0.6: GGACGCTWTTCATTCCGATT;

[0039] The forward primer of D is as shown in SEQ ID N0.7: TCTATTATTATCATTCTTACCT;

[0040] The reverse primer of D is as shown in SEQ ID N0.8: GGATGCCTCATTAGTTATAACT;

[0041] The forward primer of E is as shown in SEQ ID N0.9: AAGTCCAATATGTGTYTGTTGGA;

[0042] The reverse primer of E is as shown in SEQ ID N0.10: CACTTTARATTGGAATGAAGA;

[0043] The forward primer of F is shown in SEQ ID NO.11: ACAGTAGTAAGSCAAATTAGATA;

[0044] The reverse primer of F is shown in SEQ ID NO.12: TAAGATGAATCAATAGTTG;

[0045] The forward primer of G is shown in SEQ ID NO.13: GGGCTAATCAATATGAAATGGACC;

[0046] The reverse primer of G is shown in SEQ ID NO.14: TCCSCACCTTGGAAATGAA;

[0047] With the gradual heating up of the holly seedling market, the sales prospects of some holly varieties, such as: 'Wirt L.Winn', Ilex kudingcha, Ilex dabieshanensis, Ilex intermedia, Ilex crenata and Ilex attenuata, are good. However, their appearances are highly similar, especially for the cuttage seedlings produced on a large scale through industrialization. The present invention provides a method for efficient and accurate discrimination for the detection of these holly varieties, which brings convenience to the production and sales of these holly varieties.

[0048] According to another typical embodiment of the present invention, there is provided an application of the primer combination in a method for detecting holly varieties.

[0049] According to another typical embodiment of the present invention, there is provided a method for detecting holly varieties, the method comprising using the primer combination and judging by the bands of the agarose gel electrophoresis of the PCR amplification product.

[0050] Specifically, it includes the following steps: (1) Extract the total DNA of the holly chloroplast gene sample by the CTAB method;

[0051] (2) Use the single nucleotide polymorphism primer to amplify the DNA product by the polymerase chain reaction method;

[0052] (3) Analyze the agarose gel electrophoresis result to detect the sample attribution;

[0053] (4) Align the sequences, and when the similarity index reaches more than 99.9%, it is determined as holly.

[0054] In some embodiments, in the amplification reaction, the concentration of the primer combination is 5 - 10 μM, and the concentration of the template is 0.5 - 1 μg / μL.

[0055] In some embodiments, the amplification reaction includes denaturation, annealing, and primer extension; the temperature of denaturation is 92-98°C; the temperature of annealing is 55-61°C; the temperature of primer extension is 72°C.

[0056] By controlling the annealing temperature at 55-61°C, there are obvious beneficial effects; the annealing temperature needs to be strictly controlled. A higher temperature will lead to amplification failure and no bands, while a lower temperature is likely to cause non-specific amplification and it is difficult to distinguish the target band.

[0057] In some embodiments, the amplification product is detected by 2% agarose gel electrophoresis at a voltage of 120v for 25-30 minutes.

[0058] The method of the present invention will be described in detail below with reference to examples, comparative examples, and experimental data.

[0059] Example 1

[0060] The total DNA of the sample was extracted by the CTAB method. The experimental steps are as follows:

[0061] Take fresh leaves of Ilex (or take spare leaves from the -80°C refrigerator) and place them in a mortar containing liquid nitrogen and grind them into fine powder. Take 200-400 μL of the powder and place it in a 2.0 mL centrifuge tube, add 800 μL of preheated CTAB solution at 65°C (add 0.2% β-mercaptoethanol immediately) to promote cell lysis and prevent DNA oxidation. Use a vortex oscillator to mix well, then place it in a 65°C constant temperature oven for 30 minutes, and invert and mix the solution every 10 minutes during this period. Then add 400 μL of chloroform and isoamyl alcohol mixed solution (24:1), invert and mix for 1 minute, centrifuge at 12,000 rpm for 10 minutes. Then carefully pipette the supernatant into a new 1.5 mL centrifuge tube, add 400 μL of pre-cooled isopropanol, invert and mix, and then place it in a -20°C refrigerator to precipitate for 1 hour. Take out the centrifuge tube, centrifuge at 12,000 rpm for 10 minutes, discard the supernatant, add 1 mL of 70% ethanol, invert and mix, and then centrifuge at 12,000 rpm for 1 minute. Discard the supernatant, place it upside down on a dry filter paper to drain. Add 200 μL of double-distilled water to dissolve the DNA and store it at -20°C for later use.

[0062] Example 2

[0063] Use primer set A, namely primers SEQ ID N0.1 and 2, and amplify the template DNA of the sample to be tested by polymerase chain reaction solution (PCR reaction working solution). The PCR amplification system is a 50 μL system as follows:

[0064] 5×PCR buffer dNTPs Primer F Primer R Template Enzyme Water 10μL 5μL 1μL 1μL 1μL 1μL 31μL

[0065] Among them, the dNTPs concentration was 2.5 mM, the Primer concentration was 10 μM, the template concentration was 1 μg / μL, and both the enzyme and 5×PCR buffer were from KOD FX (TOYOBO).

[0066] The PCR amplification program was as follows:

[0067]

[0068] Among them, for the primer pair of SEQ ID N0.1 and 2, bands could be amplified in all 6 varieties. Based on this example, it represented that the preparatory work was complete.

[0069] Example 3

[0070] The primer set B, namely the primers of SEQ ID N0.3 and 4, the PCR reaction working solution used, and the template DNA of the sample to be tested were the same as those in Example 1.

[0071] The PCR amplification program was as follows:

[0072]

[0073]

[0074] Among them, for the primer pair of SEQ ID N0.3 and 4, the bands amplified from the 'Wirt L.Winn' holly variety were significantly higher than those of other varieties, while there were no bands for Ilex crenata. Therefore, the 'Wirt L.Winn' and Ilex crenata varieties could be distinguished from the 6 varieties respectively.

[0075] Example 4

[0076] The primer set C, namely the primers of SEQ ID N0.5 and 6, the PCR reaction working solution used, and the template DNA of the sample to be tested were the same as those in Example 1.

[0077] The PCR amplification program was as follows:

[0078]

[0079] From the electrophoresis results, it could be seen that among the amplified bands, the bands amplified from Ilex lohfauensis were lower than those of other varieties, so the Ilex lohfauensis variety could be distinguished from the 6 varieties.

[0080] Example 5

[0081] The primer set D, namely the primers of SEQ ID N0.7 and 8, the PCR reaction working solution used, and the template DNA of the sample to be tested were the same as those in Example 1.

[0082] The PCR amplification program was as follows:

[0083]

[0084] It can be seen from the electrophoresis results that the bands amplified from Ilex dabieshanensis are much smaller than those of other varieties. Therefore, Ilex dabieshanensis can be distinguished from the six varieties.

[0085] Example 6

[0086] The primer set F, namely the primers of SEQ ID N0.11 and 12, the PCR reaction working solution used, and the template DNA of the sample to be tested are the same as those in Example 1.

[0087] The PCR amplification program is as follows:

[0088]

[0089] It can be seen from the electrophoresis results that only Ilex intermedia did not amplify bands. Therefore, Ilex intermedia can be distinguished from the six varieties.

[0090] Example 7

[0091] The primer set G, namely the primers of SEQ ID N0.13 and 14, the PCR reaction working solution used, and the template DNA of the sample to be tested are the same as those in Example 1.

[0092] The required PCR amplification program for G is as follows:

[0093]

[0094] It can be seen from the electrophoresis results that the bands amplified from Ilex attenuata are significantly higher than those of other varieties, and only Ilex lohfauensis did not amplify bands. Therefore, through the primer set G, Ilex attenuata and Ilex lohfauensis can be distinguished from the six varieties respectively.

[0095] Example 8

[0096] The primer combinations D, E, and F are used, namely the primers of SEQ ID N0.7 and 8, the primers of SEQ ID N0.9 and 10, and the primers of SEQ ID N0.11 and 12. The PCR reaction working solution used, and the template DNA of the sample to be tested are the same as those in Example 1.

[0097] The required PCR amplification program for D is the same as that in Example 5, and the required PCR amplification program for F is the same as that in Example 6.

[0098] The required PCR amplification program for E is as follows:

[0099]

[0100] It can be seen from the electrophoresis results of D that the band sizes of Ilex dabieshanensis are significantly different from those of other varieties; it can be seen from the electrophoresis results of E that 'Wirt L. Winn', Ilex dabieshanensis and Ilex intermedia are different from other varieties; it can be seen from the electrophoresis results of F that no bands were amplified from Ilex intermedia; therefore, through the primer combinations of D, E and F, 'Wirt L. Winn' can be clearly distinguished from the 6 varieties again.

[0101] Example 9

[0102] The primer combination B+E+G, namely SEQ ID NO.3-4, SEQ ID NO.9-10 and SEQ ID NO.13-14, the PCR reaction working solution used, and the template DNA of the sample to be tested are the same as those in Example 1.

[0103] The PCR amplification procedure required for B is the same as that in Example 3, the PCR amplification procedure required for E is the same as that in Example 8, and the PCR amplification procedure required for G is the same as that in Example 7.

[0104] It can be seen from the electrophoresis results of B that no bands were amplified from Ilex crenata; it can be seen from the electrophoresis results of E that the band sizes amplified from Ilex lohfauensis, Ilex crenata and Ilex attenuata are higher than those of other varieties; it can be seen from the electrophoresis results of G that the band size amplified from Ilex attenuata is significantly higher than that of other varieties; therefore, through the primer combination B+E+G, Ilex lohfauensis can be distinguished from the 6 varieties.

[0105] The above are only specific embodiments of the present invention, enabling those skilled in the art to understand or implement the present invention. Various modifications to these embodiments will be obvious to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but rather to the widest scope consistent with the principles and novel features claimed herein.

Claims

1. A primer combination for identifying six holly varieties, characterized in that, The primer combination consists of primer sets A, B, C, D, E, F, and G. The nucleotide sequence of primer set A is shown in SEQ ID NO.1-2, the nucleotide sequence of primer set B is shown in SEQ ID NO.3-4, the nucleotide sequence of primer set C is shown in SEQ ID NO.5-6, the nucleotide sequence of primer set D is shown in SEQ ID NO.7-8, the nucleotide sequence of primer set E is shown in SEQ ID NO.9-10, the nucleotide sequence of primer set F is shown in SEQ ID NO.11-12, and the nucleotide sequence of primer set G is shown in SEQ ID NO.13-14; The holly varieties are 'Wirt L. Winn', Ilex lohfauensis, Ilex dabieshanensis, Ilex intermedia, Ilex crenata, and Ilex attenuata.

2. Use of the primer combination according to claim 1 in detecting the holly varieties, characterized in that The detection of holly varieties includes: separately amplifying the template DNA of the sample to be tested with primer sets A, B, C, D, E, F, and G. The sample to be tested is holly of the varieties 'Wirt L. Winn', Ilex lohfauensis, Ilex dabieshanensis, Ilex intermedia, Ilex crenata, and Ilex attenuata; In the amplification electrophoresis result of primer set A, bands can be amplified in all 6 holly varieties; In the amplification electrophoresis result of primer set B, the size of the amplified band of the 'Wirt L. Winn' variety is larger than that of the other varieties, and there is no band in Ilex crenata, which can be used to separately distinguish 'Wirt L. Winn' and Ilex crenata from the 6 varieties; In the amplification electrophoresis result of primer set C, the amplified band of Ilex lohfauensis is smaller than that of the other varieties, which is used to distinguish the Ilex lohfauensis variety from the 6 varieties; In the amplification electrophoresis result of primer set D, the amplified band of Ilex dabieshanensis among the obtained bands is smaller than that of the other varieties, which is used to distinguish Ilex dabieshanensis from the 6 varieties; In the amplification electrophoresis result of primer set F, only Ilex intermedia did not amplify a band among the obtained bands, which is used to distinguish Ilex intermedia from the 6 varieties; In the amplification electrophoresis result of primer set G, the amplified band of Ilex attenuata among the obtained bands is larger than that of the other varieties, and there is no band in Ilex lohfauensis, which can be used to separately distinguish Ilex attenuata and Ilex lohfauensis from the 6 varieties; In the amplification electrophoresis result of primer set E, the amplified bands of 'Wirt L. Winn', Ilex dabieshanensis, and Ilex intermedia among the obtained bands are smaller than those of the other varieties. In the amplification electrophoresis result of primer set D, the amplified band of Ilex dabieshanensis is smaller than that of the other varieties; in the amplification electrophoresis result of primer set F, only Ilex intermedia did not amplify a band; 'Wirt L. Winn' is distinguished from the 6 varieties by the D, E, and F primer combinations; In the amplification electrophoresis results of primer set B, no band was amplified from *Ilex crenata*; in the electrophoresis results of E, the bands amplified from *Ilex lohfauensis*, *Ilex crenata* and *Ilex attenuata* were larger than those of other varieties; in the electrophoresis results of G, the band amplified from *Ilex attenuata* was larger than those of other varieties; *Ilex lohfauensis* was distinguished from the six varieties by the primer combinations of B, E and G.

3. Method for identifying six holly varieties, characterized in that, The method includes using the primer combination described in claim 1 and judging by the agarose gel electrophoresis bands of the PCR amplification products. The concentration of the agarose gel electrophoresis is 2%, and the electrophoresis conditions are: voltage 120V, time 25 - 30 min.

Images