Application of Protein ZmNAC087 in Regulating Plant Stress Resistance
By overexpressing the corn protein ZmNAC087 in plants, the problem that traditional breeding methods are difficult to improve the drought and cold resistance of plants is solved, and the plant's stress resistance is significantly improved and the content of anthocyanins and chlorophyll is improved, and the plants' adaptability to adversity is enhanced.
Patent Information
- Application Number
- CN202210954696.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-10
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2042-08-10
AI Technical Summary
The prior art is difficult to effectively improve the drought resistance and cold resistance of plants, and traditional breeding methods are difficult. The separation of efficient drought resistance genes has become the main factor limiting plant stress resistance genetic engineering.
By overexpressing the corn protein ZmNAC087 or its derived protein, the stress resistance of plants is regulated, the content of anthocyanins and chlorophyll is improved, and genetic engineering methods are used to express ZmNAC087 or its derived protein in plants, combined with recombinant vectors and Agrobacterium transformation technology, the efficient expression of proteins in plants is achieved.
Significantly improve the drought resistance and cold resistance of plants, increase the total root length, reduce the reactive oxygen species level, improve the activity of antioxidant enzymes, increase the content of proline, reduce membrane damage, promote the accumulation of anthocyanins and chlorophyll, and enhance the plant's ability to adapt to adversity.
Smart Images

Figure BDA0003790814010000051 
Figure BDA0003790814010000061 
Figure HDA0003790814020000011
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of the protein ZmNAC087 in regulating plant stress resistance. Background Art
[0002] Under stress conditions, a series of response reactions will occur in plants, accompanied by many physiological, biochemical and developmental changes. Clarifying the response mechanism of plants to stress will provide a scientific basis for the research and application of stress-resistant genetic engineering. At present, the research on plant stress resistance has gradually penetrated into the cellular and molecular levels, and combined with genetics and genetic engineering research, biotechnology can be used to improve plant growth characteristics, thereby enhancing the adaptability of plants to stress.
[0003] Drought is the most important environmental factor affecting plant growth and crop yield. Drought has become a serious problem affecting agricultural production. Using genetic engineering methods to improve the drought resistance of crops and enhance the adaptability of crops and cash crops to stress is a key and major problem that needs to be solved urgently in new variety breeding. In recent years, people have conducted a large number of studies on the mechanisms of plant responses to stress such as drought from physiological, biochemical, metabolic, ecological, genetic, and evolutionary perspectives, and accumulated rich data. Especially with the development of molecular biology, people can understand the stress resistance mechanism of plants to drought stress at the molecular levels of gene composition, expression regulation, and signal transduction, opening up new ways for using genetic engineering methods to improve the stress resistance performance of plants. Due to the complexity of plant drought-resistant traits, it is very difficult to improve plant drought resistance using traditional breeding methods. With the development of molecular biology, genetic engineering methods have opened up new ways for plant drought-resistant breeding, but the isolation of highly efficient drought-resistant genes has become the main factor restricting plant stress-resistant genetic engineering.
[0004] Under adverse environmental conditions such as drought and low temperature, plants can make corresponding adjustments at the molecular, cellular and whole-plant levels to minimize the damage caused by the environment and survive. Many genes are induced to express under stress, and the products of these genes can not only directly participate in plant stress responses, but also regulate the expression of other related genes or participate in signal transduction pathways, so that plants can avoid or reduce damage and enhance their resistance to stress environments. Therefore, understanding the response and signal transduction mechanisms of plants to adverse conditions to improve the stress resistance of plant varieties has become one of the important tasks in plant genetic research and plant variety improvement. Summary of the Invention
[0005] The object of the present invention is to improve the stress resistance (such as drought resistance or cold resistance), anthocyanin content or chlorophyll content of plants.
[0006] The present invention first protects the application of the protein ZmNAC087, which can be at least one of S1)-S6):
[0007] S1) Improve the stress resistance of plants;
[0008] S2) Cultivate transgenic plants with improved stress resistance;
[0009] S3) Increase the anthocyanin content of plants;
[0010] S4) Cultivate transgenic plants with increased anthocyanin content;
[0011] S5) Increase the chlorophyll content of plants;
[0012] S6) Cultivate transgenic plants with increased chlorophyll content.
[0013] In the above applications, the protein ZmNAC087 can be a1) or a2) or a3):
[0014] a1) A protein with the amino acid sequence shown in SEQ ID NO: 1;
[0015] a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 1;
[0016] a3) A protein related to plant stress resistance, anthocyanin content, and / or chlorophyll content obtained by substituting and / or deleting and / or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID NO: 1.
[0017] Among them, SEQ ID NO: 1 consists of 329 amino acid residues.
[0018] In order to facilitate the purification of the protein in a1), a tag shown in Table 1 can be connected to the amino terminus or carboxyl terminus of the protein shown in SEQ ID NO: 1.
[0019] Table 1. Sequences of tags
[0020] Label Residue Sequence Poly-Arg 5 - 6 (usually 5) RRRRR FLAG 8 DYKDDDDK Strep-tagII 8 WSHPQFEK c-myc 10 EQKLISEEDL
[0021] For the protein in a3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.
[0022] The protein in a3) above can be artificially synthesized, or its coding gene can be synthesized first and then obtained through biological expression.
[0023] The coding gene of the protein in a3) above can be obtained by deleting the codons of one or several amino acid residues in the DNA sequence shown in SEQ ID NO: 2, and / or performing missense mutations of one or several base pairs, and / or linking the coding sequences of the tags shown in Table 1 at its 5′ end and / or 3′ end.
[0024] In the above application, the plant can be maize or Arabidopsis thaliana.
[0025] The present invention also protects the application of the nucleic acid molecule encoding the protein ZmNAC087, which can be at least one of S1)-S6):
[0026] S1) Improving the stress resistance of plants;
[0027] S2) Cultivating transgenic plants with improved stress resistance;
[0028] S3) Increasing the anthocyanin content of plants;
[0029] S4) Cultivating transgenic plants with increased anthocyanin content;
[0030] S5) Increasing the chlorophyll content of plants;
[0031] S6) Cultivating transgenic plants with increased chlorophyll content.
[0032] In the above application, the plant can be maize or Arabidopsis thaliana.
[0033] In the above application, the nucleic acid molecule encoding the protein ZmNAC087 can be a DNA molecule shown in any of b1) or b2) or b3) or b4) below:
[0034] b1) The coding region is the DNA molecule shown in SEQ ID NO: 2;
[0035] b2) The nucleotide sequence is the DNA molecule shown in SEQ ID NO: 2;
[0036] b3) A DNA molecule having 75% or more identity with the nucleotide sequence defined by b1) or (b2), and encoding the protein ZmNAC087;
[0037] b4) A DNA molecule that hybridizes with the nucleotide sequence defined by b1) or b2) under stringent conditions and encodes the protein ZmNAC087.
[0038] Among them, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc.
[0039] Among them, SEQ ID NO: 2 consists of 990 nucleotides, and the nucleotides of SEQ ID NO: 2 encode the amino acid sequence shown in SEQ ID NO: 1.
[0040] A person of ordinary skill in the art can easily mutate the nucleotide sequence encoding the protein ZmNAC087 of the present invention by using known methods, such as directed evolution and point mutation methods. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the protein ZmNAC087 isolated from the present invention, as long as they encode the protein ZmNAC087, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.
[0041] The term "identity" used herein refers to the sequence similarity with the natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, or 80% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the protein ZmNAC087 consisting of the amino acid sequence shown in SEQ ID NO: 1 of the present invention. Identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0042] In any of the above-mentioned applications, the stress resistance is drought resistance and / or cold resistance.
[0043] The improvement of the stress resistance mentioned above can be manifested as an increase in the total root length, a decrease in the H2O2 level, a decrease in the O2 - level, an increase in the SOD activity, an increase in the POD activity, an increase in the proline content, a decrease in the malondialdehyde, and / or a reduction in the membrane damage after drought or low temperature treatment.
[0044] The present invention also protects a method for cultivating transgenic plants, which may include the following steps: increasing the expression level and / or activity of the protein ZmNAC087 mentioned above in the starting plant to obtain a transgenic plant; compared with the starting plant, the transgenic plant has increased stress resistance and increased anthocyanin and / or chlorophyll content during low temperature treatment;
[0045] The plant may be maize or Arabidopsis thaliana.
[0046] In the above method, the "increasing the expression level and / or activity of the protein ZmNAC087 mentioned above in the starting plant" can be achieved by methods well known in the art such as transgenesis, multi-copy, promoter alteration, regulatory factors, etc., to increase the expression level and / or activity of the protein ZmNAC087 mentioned above in the starting plant.
[0047] In the above method, increasing the expression level and / or activity of the protein ZmNAC087 in the starting plant can be specifically achieved by introducing a nucleic acid molecule encoding the protein ZmNAC087 into the starting plant.
[0048] In the above method, introducing a nucleic acid molecule encoding the protein ZmNAC087 into the starting plant can be achieved by introducing a recombinant vector into the starting plant; the recombinant vector can be a recombinant plasmid obtained by inserting a nucleic acid molecule encoding any of the above-mentioned proteins ZmNAC087 into an expression vector.
[0049] The recombinant vector can specifically be the recombinant plasmid pROKⅡ-ZmNAC087. The recombinant plasmid pROKⅡ-ZmNAC087 can specifically be a recombinant plasmid obtained by replacing the DNA small fragments of the restriction endonucleases BamHI and KpnI of the pROKⅡ plasmid with the DNA molecule shown in SEQ ID NO: 2.
[0050] The transgenic plant can specifically be OE7 and OE12 mentioned in Example 2. At this time, the starting plant is Arabidopsis thaliana, specifically wild-type Arabidopsis thaliana (Columbia-0 subtype).
[0051] The present invention also protects a plant breeding method, including the following steps: increasing the expression level and / or activity of any of the above-mentioned proteins ZmNAC087 in a plant, so that the stress resistance of the plant increases, and the content of anthocyanin and / or chlorophyll increases during low-temperature treatment;
[0052] The plant can be maize or Arabidopsis thaliana.
[0053] Any of the above-mentioned increased stress resistance can be manifested as an increase in the total root length, a decrease in the H2O2 level, a decrease in the O2 - level, an increase in the SOD activity, an increase in the POD activity, an increase in the proline content, a decrease in the malondialdehyde, and / or a reduction in membrane damage (the starting plant is Arabidopsis thaliana).
[0054] Any of the above-mentioned low temperatures can be below 6°C (such as 6°C, 5°C, or 4°C).
[0055] Experiments have proved that overexpressing the ZmNAC087 gene in wild-type Arabidopsis thaliana can improve the drought resistance and cold resistance of Arabidopsis thaliana. The improvement of drought resistance and cold resistance is manifested as: a significant increase in the total root length, H2O2 and O2 -The level is significantly reduced, the activities of SOD and POD are significantly increased, the proline content is significantly increased, the malondialdehyde content is significantly reduced, and the membrane damage is reduced. Under low temperature stress, overexpression of the ZmNAC087 gene in wild-type Arabidopsis thaliana can increase the accumulation of anthocyanins in plants and promote chlorophyll synthesis. The protein ZmNAC087 can improve the stress resistance of plants, the anthocyanin content and the chlorophyll content of plants. The present invention has important application values. BRIEF DESCRIPTION OF THE DRAWINGS
[0056] Figure 1 For the relative expression level of the ZmNAC087 gene in transgenic Arabidopsis thaliana overexpressing ZmNAC087 detected by real-time fluorescence quantitative PCR in Step 5 of Example 2.
[0057] Figure 2 For the root length experimental result of 1 in Step 6 of Example 2.
[0058] Figure 3 For the effect of ZmNAC087 overexpression on the plant antioxidant defense system of 2 in Step 6 of Example 2.
[0059] Figure 4 For the effect of ZmNAC087 on the SODs and PODs genes of 2 in Step 6 of Example 2.
[0060] Figure 5 For the increase of proline content in plants under adversity by ZmNAC087 overexpression of 3 in Step 6 of Example 2.
[0061] Figure 6 For the alleviation of plant cell membrane damage under adversity by ZmNAC087 overexpression of 4 in Step 6 of Example 2.
[0062] Figure 7 For the increase of anthocyanin content by ZmNAC087 overexpression under low temperature stress in Step 7 of Example 2.
[0063] Figure 8 For the increase of chlorophyll content by ZmNAC087 overexpression under low temperature stress in Step 8 of Example 2. DETAILED DESCRIPTION OF THE INVENTION
[0064] The present invention will be further described in detail below in conjunction with the specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.
[0065] In the following examples, the experimental methods are conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.
[0066] The primers and their nucleotide sequences involved in the following examples are shown in Table 2.
[0067] Table 2
[0068]
[0069]
[0070] Wild-type Arabidopsis thaliana (Columbia-0 subtype) is described in the following literature: Kim H, Hyun Y, Park J, Park M, Kim M, Kim H, Lee M, Moon J, Lee I, Kim J. A genetic link between cold responses and flowering time through FVE in Arabidopsis thaliana. Nature Genetics. 2004, 36: 167-171. Hereinafter, wild-type Arabidopsis thaliana (Columbia-0 subtype) is abbreviated as wild-type Arabidopsis thaliana or WT.
[0071] The maize inbred line He 344 is described in the following literature: He Lin, Bian Jing, Xu Jingyu, Yang Kejun. Novel maize NAC transcriptional repressor ZmNAC071 confers enhanced sensitivity to ABA and osmotic stress by downregulating stress-responsive genes in transgenic Arabidopsis. J. Agric. Food Chem., 2019, 67(32): 8905-8918.
[0072] The pROKⅡ plasmid is described in the following literature: Hongyun Xu, Xinxin Shi, Lin He, Yong Guo, Dandan Zang, Hongyan Li, Wenhui Zhang, Yucheng Wang. Arabidopsis thalianatrihelix transcription factor AST1 mediates salt and osmotic stress tolerance by binding to a novel AGAG-Box and some GT motifs. Plant Cell Physiol., 2018, 59(5):946-965.
[0073] The method for measuring proline content is described in the following literature: Ju Y, Min Z, Yue X, Zhang Y, Zhang J, Zhang Z, Fang Y. Overexpression of grapevine VvNAC08 enhances drought tolerance in transgenic Arabidopsis. Plant Physiol Biochem. 2020;151:214-222.
[0074] The method for measuring malondialdehyde content is described in the following literature: Ju Y, Yue X, Min Z, Wang X, Fang Y, Zhang J. VvNAC17, a novel stress-responsive grapevine (Vitis vinifera L.) NAC transcription factor, increases sensitivity to abscisic acid and enhances salinity, freezing, and drought tolerance in transgenic Arabidopsis. Plant Physiol Biochem. 2020;146:98-111.
[0075] Example 1: Cloning of the coding gene of protein ZmNAC087 (i.e., ZmNAC087 gene)
[0076] 1. Extract the total RNA from the leaves of maize inbred line He 344, and then perform reverse transcription to obtain the cDNA of maize inbred line He 344.
[0077] 2. Using the cDNA of maize inbred line He 344 obtained in step 1 as a template, perform PCR amplification with the primer pair consisting of pROKⅡ-BamHI-ZmNAC087-F: CGGGATCCATGACACACTCTCCGTTGGC and pROKⅡ-KpnI-ZmNAC087-R: GGGGTACCTCAAAGGAACTCATACATCC, and recover the 998bp DNA fragment.
[0078] 3. Sequence the PCR amplification product recovered in step 2. The sequencing result shows that the nucleotide sequence of the PCR amplification product contains the DNA fragment shown in SEQ ID NO: 2.
[0079] Name the gene shown in SEQ ID NO: 2 as the ZmNAC087 gene. The ZmNAC087 gene encodes the protein ZmNAC087, and the amino acid sequence of the protein ZmNAC087 is shown in SEQ ID NO: 1.
[0080] Example 2. Obtaining and identification of ZmNAC087 transgenic Arabidopsis
[0081] I. Construction of recombinant plasmid
[0082] 1. Construction of recombinant plasmid pROKⅡ-ZmNAC087
[0083] (1) Extract the total RNA from the leaves of maize inbred line He 344, and then perform reverse transcription to obtain the cDNA of maize inbred line He 344.
[0084] (2) Using the cDNA of maize inbred line He 344 obtained in step (1) as a template, perform PCR amplification with the primer pair consisting of pROKⅡ-BamHI-ZmNAC087-F: CG GGATCC ATGACACACTCTCCGTTGGC (the underlined part is the recognition site of restriction endonuclease BamHI) and pROKⅡ-KpnI-ZmNAC087-R: GG GGTACC TCAAAGGAACTCATACATCC (the underlined part is the recognition site of restriction endonuclease KpnI), and recover the 998bp DNA fragment.
[0085] (3) Digest the DNA fragment recovered in step (2) with restriction endonucleases BamHI and KpnI, and recover the digested fragment.
[0086] (4) Digest the pROKⅡ plasmid with restriction endonucleases BamHI and KpnI, and recover the vector backbone of about 11kb.
[0087] (5)Ligate the digested fragments recovered in step (3) and the vector backbone recovered in step (4) to obtain the recombinant plasmid pROKⅡ-ZmNAC087.
[0088] Sequence the recombinant plasmid pROKⅡ-ZmNAC087. The sequencing results show that the recombinant plasmid pROKⅡ-ZmNAC087 is a recombinant plasmid obtained by replacing the small DNA fragments of the restriction endonucleases BamHI and KpnI of the pROKⅡ plasmid with the DNA molecule shown in SEQ ID NO: 2.
[0089] The recombinant plasmid pROKⅡ-ZmNAC087 expresses the protein ZmNAC087 shown in SEQ ID NO: 1.
[0090] II. Obtaining of recombinant Agrobacterium
[0091] 1. Introduce the recombinant plasmid pROKⅡ-ZmNAC087 into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium, named EHA105 / pROKⅡ-ZmNAC087.
[0092] 2. Introduce the pROKⅡ plasmid into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium, named EHA105 / pROKⅡ.
[0093] III. Obtaining of ZmNAC087 transgenic Arabidopsis
[0094] 1. Using the floral dip method for Arabidopsis (described in the following literature: Clough, S.J., and Bent, A.F.. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. (1998) 16, 735 - 743.), transfer EHA105 / pROKⅡ-ZmNAC087 into wild-type Arabidopsis to obtain T1 generation ZmNAC087 transgenic Arabidopsis seeds.
[0095] 2. Sow the T1 generation ZmNAC087 transgenic Arabidopsis seeds obtained in step 1 on a 1 / 2MS solid medium containing 50 mg / L kanamycin. The Arabidopsis (resistant seedlings) that can grow normally are the T1 generation ZmNAC087 transgenic positive seedlings, and the seeds received from the T1 generation ZmNAC087 transgenic positive seedlings are the T2 generation ZmNAC087 transgenic Arabidopsis seeds.
[0096] 3. Sow the T2-generation transgenic Arabidopsis thaliana seeds of different strains screened in step 2 on a 1 / 2 MS solid medium containing 50 mg / L kanamycin for screening. If the ratio of the number of Arabidopsis thaliana plants that can grow normally (resistant seedlings) to the number of Arabidopsis thaliana plants that cannot grow normally (non-resistant seedlings) in a certain strain is 3:1, then this strain is a strain with one copy of the ZmNAC087 gene inserted. The seeds obtained from the resistant seedlings in this strain are the T3-generation transgenic Arabidopsis thaliana seeds with the ZmNAC087 gene.
[0097] 4. Sow the T3-generation transgenic Arabidopsis thaliana seeds with the ZmNAC087 gene screened in step 3 on a 1 / 2 MS solid medium containing 50 mg / L kanamycin again for screening. Those that are all resistant seedlings are the T3-generation homozygous transgenic Arabidopsis thaliana with the ZmNAC087 gene.
[0098] Name the 15 T3-generation homozygous transgenic Arabidopsis thaliana strains obtained from EHA105 / pROKⅡ-ZmNAC087 as OE1 - OE15 in sequence.
[0099] According to the above steps, replace EHA105 / pROKⅡ-ZmNAC087 with EHA105 / pROKⅡ, and keep other steps unchanged to obtain the T3-generation homozygous transgenic Arabidopsis thaliana with an empty vector. Name the 1 T3-generation homozygous transgenic Arabidopsis thaliana strain obtained from EHA105 / pROKⅡ as 35S.
[0100] IV. Molecular Identification
[0101] The Arabidopsis thaliana seeds to be tested are the T3-generation seeds of OE1, the T3-generation seeds of OE2, the T3-generation seeds of OE3, the T3-generation seeds of OE4, the T3-generation seeds of OE5, the T3-generation seeds of OE6, the T3-generation seeds of OE7, the T3-generation seeds of OE8, the T3-generation seeds of OE9, the T3-generation seeds of OE10, the T3-generation seeds of OE11, the T3-generation seeds of OE12, the T3-generation seeds of OE13, the T3-generation seeds of OE14, or the T3-generation seeds of OE15.
[0102] 1. Take the Arabidopsis thaliana seeds to be tested, soak them in a 75% (v / v) ethanol aqueous solution for 30 s, and wash them 3 times with sterile water; then spread them on a 1 / 2 MS solid medium and vernalize them at 5°C for 3 days.
[0103] 2. After completing step 1, take the Arabidopsis thaliana seeds to be tested and culture them under alternating light and dark conditions at 22 ± 2°C (16 h light culture / 8 h dark culture, light intensity 80 - 100 μmol·m -2 ·s -1 ) for 7 days to obtain the Arabidopsis thaliana seedlings to be tested.
[0104] 3. Extract the genomic DNA of the Arabidopsis thaliana seedlings to be tested and use it as a template. Perform PCR amplification using the primer pair consisting of pROKⅡ-BamH I-ZmNAC087-F: CGGGATCCATGACACACTCTCCGTTGGC and pROKⅡ-KpnI-ZmNAC087-R: GGGGTACCTCAAAGGAACTCATACATCC to obtain the PCR amplification product. Then make the following judgment: If a DNA fragment of approximately 998 bp is contained in a certain PCR amplification product, the Arabidopsis thaliana seedling to be tested corresponding to this PCR amplification product is a positive seedling. The results show that the seedlings obtained from the T3-generation seeds of OE1, OE2, OE3, OE4, OE5, OE6, OE7, OE8, OE9, OE10, OE11, OE12, OE13, OE14, OE15 are all positive seedlings.
[0105] V. Real-time fluorescence quantitative PCR to detect the relative expression level of the ZmNAC087 gene in Arabidopsis thaliana transgenic for ZmNAC087
[0106] The Arabidopsis thaliana seeds to be tested are the T3-generation seeds of OE1, OE2, OE3, OE4, OE5, OE6, OE7, OE8, OE9, OE10, OE11, OE12, OE13, OE14, OE15, the T3-generation seeds of 35S, or the seeds of wild-type Arabidopsis thaliana.
[0107] 1. Take the Arabidopsis thaliana seeds to be tested, soak them in 70% (v / v) ethanol aqueous solution for 30 s, and wash them 3 times with sterile water. Then spread them on the 1 / 2MS solid medium and vernalize at 5°C for 3 days.
[0108] 2. After completing step 1, take the Arabidopsis thaliana seeds to be tested and culture them under alternating light and dark conditions at 22 ± 2°C (16 h light culture / 8 h dark culture, light intensity 80 - 100 μmol·m -2 ·s -1 ) for 7 days to obtain the Arabidopsis thaliana seedlings to be tested. Put the Arabidopsis thaliana seedlings to be tested into liquid nitrogen for preservation to obtain the samples to be tested.
[0109] 3. Extract the total RNA of the sample to be tested using the Trizo1 method, and then reverse transcribe the first-strand cDNA. Dilute the cDNA 10-fold with sterile water as a template, and detect the relative expression level of the ZmNAC087 gene by real-time quantitative PCR (the AtACTIN7 gene is used as an internal reference gene).
[0110] The primers for detecting the ZmNAC087 gene are 5’-TGTTCCGCACGGGTTG-3’ and 5’-TTGCGTCGTTAGATTCGTC-3’.
[0111] The primers for detecting the AtACTIN7 gene are 5’-CCAGCCATCGCTCATCGGAATG-3’ and 5’-CAGACACTGTATTTTCTCTCTG-3’.
[0112] The detection results are shown in Figure 1 (1-15 are OE1 - OE15 in sequence). The results show that, compared with wild-type Arabidopsis thaliana, the relative expression levels of the ZmNAC087 gene in OE1 - OE15 are all significantly increased. Among them, the relative expression levels of the ZmNAC087 gene in OE7 and OE12 are the highest and are used for subsequent experiments. There is no significant difference in the relative expression level of the ZmNAC087 gene between 35S and wild-type Arabidopsis thaliana.
[0113] VI. Identification of the stress resistance (specifically drought resistance and cold resistance) of transgenic Arabidopsis thaliana overexpressing ZmNAC087
[0114] 1. Root length experiment
[0115] The seeds of Arabidopsis thaliana to be tested are the T3 generation seeds of OE7, the T3 generation seeds of OE12, the T3 generation seeds of 35S, or the seeds of wild-type Arabidopsis thaliana.
[0116] The experiment is repeated three times and the average value is taken. The steps for each repetition are as follows:
[0117] (1) Take the seeds of Arabidopsis thaliana to be tested, soak them in 75% (v / v) ethanol aqueous solution for 30 s, and wash them 3 times with sterile water. Then spread them on 1 / 2MS solid medium and vernalize them at 5°C for 3 days.
[0118] (2) After completing step (1), take the seeds of Arabidopsis thaliana to be tested and culture them under alternating light and dark conditions at 22 ± 2°C (16 h light culture / 8 h dark culture, light intensity 80 - 100 μmol·m -2 ·s -1 ) for 7 days to obtain the seedlings of Arabidopsis thaliana to be tested.
[0119] (3) After completing step (2), take 120 Arabidopsis thaliana seedlings to be tested with basically the same growth status, and randomly divide them into three groups: control treatment, low-temperature treatment, and drought treatment, with 40 plants in each group; then perform the following treatments:
[0120] Control treatment: Transfer the Arabidopsis thaliana seedlings to be tested to 1 / 2 MS solid medium, and culture them vertically for 7 days under the conditions of 22 ± 2 °C with a light-dark cycle (16 h light culture / 8 h dark culture, light intensity 80 - 100 μmol·m -2 ·s -1 ).
[0121] Low-temperature treatment: Transfer the Arabidopsis thaliana seedlings to be tested to 1 / 2 MS solid medium, and culture them vertically for 7 days under the conditions of 5 °C with a light-dark cycle (16 h light culture / 8 h dark culture, light intensity 80 - 100 μmol·m -2 ·s -1 ).
[0122] Drought treatment: Transfer the Arabidopsis thaliana seedlings to be tested to 1 / 2 MS solid medium containing 300 mM mannitol, and culture them vertically for 7 days under the conditions of 22 ± 2 °C with a light-dark cycle (16 h light culture / 8 h dark culture, light intensity 80 - 100 μmol·m -2 ·s -1 ).
[0123] (4) After completing step (3), observe the phenotypes of the Arabidopsis thaliana seedlings to be tested in each group, count the total root length, and calculate the average value for each group.
[0124] The phenotypes of the Arabidopsis thaliana seedlings to be tested in each group are shown in Figure 2 the left figure in the middle.
[0125] The statistical results of the total root length are shown in Figure 2 the right figure in the middle.
[0126] The results show that in 1 / 2 MS solid medium, there is no significant difference in the total root length among wild-type Arabidopsis thaliana, two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12), and Arabidopsis thaliana transformed with an empty vector (i.e., 35S); after low-temperature (5 °C) and drought (mannitol) treatments, compared with wild-type Arabidopsis thaliana, the total root length sum of the two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12) increased significantly; there is no significant difference in the total root length between Arabidopsis thaliana transformed with an empty vector (i.e., 35S) and wild-type Arabidopsis thaliana.
[0127] 2. Effects of ZmNAC087 overexpression on the plant antioxidant defense system
[0128] (1) To verify whether the ZmNAC087 gene is involved in regulating ROS scavenging under low temperature and drought stress conditions, take the Arabidopsis thaliana seedlings to be tested that have completed step (3) in step 1, and use nitroblue tetrazolium (NBT) staining to compare the O2 content of two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing the ZmNAC087 gene (i.e., OE7 and OE12), Arabidopsis thaliana transformed with an empty vector (i.e., 35S), and wild-type Arabidopsis thaliana. The method of NBT staining refers to the following literature: Zhang X., Wang L., Meng H., Wen H., Fan Y., Zhao J. Maize ABP9 enhances tolerance to multiple stresses in transgenic Arabidopsis by modulating ABA signaling and cellular levels of reactive oxygen species. Plant Mol. Biol. 2011, 75(4 - 5), 365 - 378. - The results of NBT staining are shown in A of
[0129] The results showed that there was no significant difference in NBT staining among wild-type Arabidopsis thaliana, two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing the ZmNAC087 gene (i.e., OE7 and OE12), and Arabidopsis thaliana transformed with an empty vector (i.e., 35S) on 1 / 2 MS solid medium. After treatment with low temperature (5°C) and drought (mannitol), compared with wild-type Arabidopsis thaliana, the NBT staining of the two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing the ZmNAC087 gene (i.e., OE7 and OE12) became lighter, and there was no significant difference in NBT staining between Arabidopsis thaliana transformed with an empty vector (i.e., 35S) and wild-type Arabidopsis thaliana. Figure 3
[0130] (2) Take the Arabidopsis thaliana seedlings to be tested that have completed step (3) in step 1, and detect the content of H2O2 and O2 - content.
[0131] Refer to the method described in the literature (Velikova, V., Yordanov, I., and Edreva, A. (2000). Oxidative stress and some antioxidant systems in acid rain-treated bean plants: protective role of exogenous polyamines. Plant Science 151, 59 - 66.) to detect the H2O2 content in the leaves of the Arabidopsis thaliana seedlings to be tested.
[0132] The method described in the reference (Able A J, Guest D I, Sutherland M W. 1998. Use of a new tetrazolium-based assay to study the production of superoxide radicals by tobacco cell cultures challenged with avirulent zoospores of Phytophthora parasitica var nicotianae. Journal of Plant Physiology, 117, 491 - 499.) was used to detect the content of superoxide anion (O2 - ) in the leaves of Arabidopsis thaliana seedlings to be tested.
[0133] The detection results are shown in Figure 3 B in it. The results showed that the contents of H2O2 and O2 - in the T3 generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 were significantly lower than those in wild-type Arabidopsis thaliana and Arabidopsis thaliana transformed with empty vector.
[0134] The above results indicated that under low temperature and drought stress conditions, the ZmNAC087 gene actively regulated ROS scavenging. Therefore, the Arabidopsis thaliana seedlings to be tested that completed step (3) in step 1 were taken to detect the activities of two key ROS scavenging enzymes, SOD and POD.
[0135] The method described in the reference (Wang, Y.C., Gao, C.Q., Liang, Y.N., Wang, C., Yang, C.P., and Liu, G.F. (2010). A novel bZIP gene from Tamarix hispida mediates physiological responses to salt stress in tobacco plants. J. Plant Physiol.) was used to detect the SOD activity in the leaves of Arabidopsis thaliana seedlings to be tested.
[0136] The POD activity of the leaves of the Arabidopsis thaliana seedlings to be tested was detected by the method described in the reference (Han, Y., Zhang, J., Chen, X., Gao, Z., Xuan, W. and Xu, S. Carbon monoxide alleviates cadmium-induced oxidative damage by modulating glutathione metabolism in the roots of Medicago sativa. New Phytol. 2008, 177, 155 - 166.).
[0137] The detection results are shown in Figure 3 C. The results showed that there were no significant differences in the activities of SOD and POD among wild-type Arabidopsis thaliana, two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12), and Arabidopsis thaliana transformed with the empty vector (i.e., 35S) in the 1 / 2 MS solid medium; after treatment with low temperature (5 °C) and drought (mannitol), compared with wild-type Arabidopsis thaliana, the activities of SOD and POD in two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12) were significantly increased, and there were no significant differences in the activities of SOD and POD between Arabidopsis thaliana transformed with the empty vector (i.e., 35S) and wild-type Arabidopsis thaliana.
[0138] (3) The Arabidopsis thaliana seedlings to be tested that completed step (3) in step 1 were taken to further analyze the effects of ZmNAC087 on SODs and PODs genes. The specific steps were as follows: First, the total RNA of the Arabidopsis thaliana seedlings to be tested was extracted, and then reverse transcribed to obtain the cDNA of the Arabidopsis thaliana seedlings to be tested; using the cDNA of the Arabidopsis thaliana seedlings to be tested as a template, the relative expression levels of CSD1, CSD2, CSD3, FSD2, FSD3, PRX22, and PRX39 were detected by real-time quantitative PCR (using Act7 (AT5G09810) and TUB2 (AT5G62690) as internal references). Taking the average value of the gene expression levels of Act7 (AT5G09810) and TUB2 (AT5G62690) as the internal reference, and taking the expression level of each gene in wild-type Arabidopsis thaliana on the 1 / 2 MS solid medium as 1, use 2 -ΔΔCt method to calculate the relative expression level. All samples were subjected to three independent biological replicates.
[0139] The primers for detecting CSD1 were CSD1-F and CSD1-R.
[0140] The primers for detecting CSD2 were CSD2-F and CSD2-R.
[0141] The primers for detecting CSD3 were CSD3-F and CSD3-R.
[0142] The primers for detecting FSD2 are FSD2-F and FSD2-R.
[0143] The primers for detecting FSD3 are FSD3-F and FSD3-R.
[0144] The primers for detecting PRX22 are AtPRX22-F and AtPRX22-R.
[0145] The primers for detecting PRX39 are AtPRX39-F and AtPRX39-R.
[0146] The primers for detecting Act7 are ACT7-F and ACT7-R.
[0147] The primers for detecting TUB2 are TUB2-F and TUB2-R.
[0148] Test results see Figure 4 The results showed that there was no significant difference in the expression of SODs (CSD1 / 2 / 3, FSD2 / 3) and PODs genes (PRX22, PRX39) in wild-type Arabidopsis, two T3 homozygous transgenic ZmNAC087 Arabidopsis lines (i.e., OE7 and OE12) and empty vector Arabidopsis (i.e., 35S) on 1 / 2MS solid medium. After low temperature (5℃) and drought (mannitol) treatment, the SODs (CSD1 / 2 / 3, FSD2 / 3) and PODs (PRX22, PRX39) of two T3 homozygous transgenic ZmNAC087 Arabidopsis lines (i.e., OE7 and OE12) were significantly increased compared with wild-type Arabidopsis.
[0149] The above results indicate that the ZmNAC087 gene can actively regulate ROS clearance mediated by SODs and PODs genes.
[0150] 3. ZmNAC087 overexpression increases proline content in plants under stress
[0151] (1) Take the Arabidopsis seedlings to be tested that have completed step 1 (3), and detect the proline content in the leaves of the Arabidopsis seedlings to be tested according to the method described in the literature (Bates, LS, Waldren, RP, and Teare, ID (1973). Rapid determination of free proline for water-stress studies. Plant Soil 39, 205-207.).
[0152] Test results see Figure 5A. The results showed that there was no significant difference in the proline content among wild-type Arabidopsis thaliana, two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12), and Arabidopsis thaliana transformed with an empty vector (i.e., 35S) in the 1 / 2MS solid medium. After treatment with low temperature (5°C) and drought (mannitol), compared with wild-type Arabidopsis thaliana, the proline content in the two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12) increased significantly, while there was no significant difference in the proline content between Arabidopsis thaliana transformed with an empty vector (i.e., 35S) and wild-type Arabidopsis thaliana.
[0153] (2) Taking the Arabidopsis thaliana seedlings to be tested that completed step (3) in step 1, the effects of ZmNAC087 on five proline metabolism-related genes, namely P5CS1, P5CS2, P5CDH1, P5CDH2, and PRODH, were further analyzed. The specific steps were as follows: First, the total RNA of the Arabidopsis thaliana seedlings to be tested was extracted, and then reverse transcription was carried out to obtain the cDNA of the Arabidopsis thaliana seedlings to be tested. Using the cDNA of the Arabidopsis thaliana seedlings to be tested as a template, the relative expression levels of P5CS1, P5CS2, P5CDH1, P5CDH2, and PRODH were detected by real-time quantitative PCR (using Act7 (AT5G09810) and TUB2 (AT5G62690) as internal references). Taking the average value of the gene expression levels of Act7 (AT5G09810) and TUB2 (AT5G62690) as the internal reference, and taking the expression level of each gene in wild-type Arabidopsis thaliana on the 1 / 2MS solid medium as 1, the relative expression level was calculated using the 2- ΔΔCt method. All samples were subjected to three independent biological replicates.
[0154] The primers for detecting P5CS1 were P5CS1-F and P5CS1-R.
[0155] The primers for detecting P5CS2 were P5CS2-F and P5CS2-R.
[0156] The primers for detecting P5CDH1 were P5CDH1-F and P5CDH1-R.
[0157] The primers for detecting P5CDH2 were P5CDH2-F and P5CDH2-R.
[0158] The primers for detecting PRODH were ProDH-F and ProDH-R.
[0159] The primers for detecting Act7 were ACT7-F and ACT7-R.
[0160] The primers for detecting TUB2 were TUB2-F and TUB2-R.
[0161] The detection results are shown in Figure 5B-F. The results showed that there were no significant differences in the relative expression levels of P5CS1, P5CS2, P5CDH1, P5CDH2, and PRODH among wild-type Arabidopsis thaliana, two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12), and Arabidopsis thaliana transformed with the empty vector (i.e., 35S) in the 1 / 2MS solid medium. After treatment with low temperature (5°C) and drought (mannitol), compared with wild-type Arabidopsis thaliana, the relative expression levels of P5CS1 and P5CS2 in the two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12) were significantly increased, the relative expression levels of PRODH and P5CDH1 were significantly decreased, and the relative expression level of P5CDH2 had no significant difference.
[0162] The above results indicate that under low temperature and drought stress conditions, ZmNAC087 mainly promotes proline accumulation by inducing the proline synthesis genes P5CS1 and P5CS2 and inhibiting the proline degradation genes PRODH and P5CDH1, ultimately enhancing the tolerance of plants to low temperature and drought stress.
[0163] 4. Overexpression of ZmNAC087 alleviates plant cell membrane damage under adversity
[0164] (1) PI staining can reflect cell membrane damage based on fluorescence levels. Take the Arabidopsis thaliana seedlings to be tested that have completed step (3) in step 1, and perform PI staining according to the method described in the literature (He Lin, Bian Jing, Xu Jingyu, Yang Kejun. Novel maize NAC transcriptional repressor ZmNAC071 confers enhanced sensitivity to ABA and osmotic stress by downregulating stress-responsive genes in transgenic Arabidopsis. J. Agric. Food Chem., 2019, 67(32): 8905 - 8918.).
[0165] The detection results are shown in Figure 6 Figure A. The results showed that there were no significant differences in the PI staining results among wild-type Arabidopsis thaliana, two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12), and Arabidopsis thaliana transformed with the empty vector (i.e., 35S) in the 1 / 2MS solid medium. After treatment with low temperature (5°C) and drought (mannitol), compared with wild-type Arabidopsis thaliana, the fluorescence of the two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12) was significantly weaker, indicating less membrane damage in their bodies.
[0166] (2) High levels of ROS accumulation in cells can cause membrane lipid peroxidation, leading to the accumulation of a large amount of MDA. Take the Arabidopsis thaliana seedlings to be tested that have completed step (3) in step 1, and refer to the method in the literature (Ju Y, Yue X, Min Z, Wang X, Fang Y, Zhang J. VvNAC17, a novel stress-responsive grapevine (Vitis vinifera L.) NAC transcription factor, increases sensitivity to abscisic acid and enhances salinity, freezing, and drought tolerance in transgenic Arabidopsis. Plant Physiol Biochem. 2020;146:98-111.) to detect the content of malondialdehyde. Observe the degree of membrane damage of different plant lines by detecting the content of MDA.
[0167] The detection results are shown in Figure 6 Figure B below. The results showed that there was no significant difference in the content of malondialdehyde among wild-type Arabidopsis thaliana, two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing the ZmNAC087 gene (i.e., OE7 and OE12), and Arabidopsis thaliana transformed with an empty vector (i.e., 35S) on 1 / 2 MS solid medium; after low-temperature (5°C) and drought (mannitol) treatments, compared with wild-type Arabidopsis thaliana, the content of malondialdehyde in two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing the ZmNAC087 gene (i.e., OE7 and OE12) decreased significantly.
[0168] Thus, it can be seen that the overexpression of ZmNAC087 helps to reduce the membrane damage of plants under abiotic stress, thereby improving the stress resistance of plants.
[0169] The above results indicate that overexpressing the ZmNAC087 gene in wild-type Arabidopsis thaliana can improve the drought resistance and cold resistance of Arabidopsis thaliana. The improvement of drought resistance and cold resistance is manifested as: a significant increase in the total root length, a significant decrease in the levels of H2O2 and O2 - a significant increase in the activities of SOD and POD, a significant increase in the proline content, a significant decrease in the malondialdehyde content, and a reduction in membrane damage.
[0170] VII. Overexpression of ZmNAC087 Increases Anthocyanin Content under Low-Temperature Stress
[0171] 1. Take the Arabidopsis thaliana seedlings to be tested that have completed step (3) in step 1, and detect the anthocyanin content in the leaves of the Arabidopsis thaliana seedlings to be tested with reference to the method described in the literature (Xie XB, Li S, Zhang RF, Zhao J, Chen YC, Zhao Q, Yao YX, You CX, Zhang XS, Hao YJ. 2012. The bHLH transcription factor MdbHLH3 promotes anthocyanin accumulation and fruit colouration in response to low temperature in apples. Plant, Cell & Environment 35: 1884–1897.).
[0172] Partial detection results are shown in Figure 7 Figure A. The results show that there is no significant difference in the anthocyanin content among wild-type Arabidopsis thaliana, two T3-generation homozygous transgenic Arabidopsis thaliana lines with the ZmNAC087 gene (i.e., OE7 and OE12), and Arabidopsis thaliana transformed with an empty vector (i.e., 35S) on 1 / 2 MS solid medium; after treatment at low temperature (5 °C), compared with wild-type Arabidopsis thaliana, the anthocyanin content in two T3-generation homozygous transgenic Arabidopsis thaliana lines with the ZmNAC087 gene (i.e., OE7 and OE12) increased significantly.
[0173] 2. Take the Arabidopsis thaliana seedlings to be tested that have completed step (3) in step 1, and further analyze the effects of ZmNAC087 on two anthocyanin synthesis-related genes, F3H and ANS. The specific steps are as follows: First, extract the total RNA of the Arabidopsis thaliana seedlings to be tested, and then reverse transcribe to obtain the cDNA of the Arabidopsis thaliana seedlings to be tested; using the cDNA of the Arabidopsis thaliana seedlings to be tested as a template, detect the relative expression levels of F3H and ANS by real-time quantitative PCR (using Act7 (AT5G09810) and TUB2 (AT5G62690) as internal references). Taking the average value of the gene expression levels of Act7 (AT5G09810) and TUB2 (AT5G62690) as the internal reference, and taking the expression level of each gene in wild-type Arabidopsis thaliana on 1 / 2 MS solid medium as 1, use the 2- ΔΔCt method to calculate the relative expression level. All samples are subjected to three independent biological replicates.
[0174] The primers for detecting F3H are F3H-F and F3H-R.
[0175] The primers for detecting ANS are ANS-F and ANS-R.
[0176] The primers for detecting Act7 are ACT7-F and ACT7-R.
[0177] The primers for detecting TUB2 are TUB2-F and TUB2-R.
[0178] The detection results are shown in Figure 7 Figure B. The results showed that there were no significant differences in the relative expression levels of F3H and ANS among wild-type Arabidopsis thaliana, two homozygous T3 transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12), and Arabidopsis thaliana transformed with the empty vector (i.e., 35S) in the 1 / 2MS solid medium. After low-temperature (5°C) treatment, compared with wild-type Arabidopsis thaliana, the relative expression levels of F3H and ANS in the two homozygous T3 transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12) were significantly increased. Thus, under low-temperature stress, the ZmNAC087 gene promotes the expression of anthocyanin synthesis-related genes F3H and ANS, thereby increasing the accumulation of anthocyanins in plants.
[0179] VIII. Overexpression of ZmNAC087 Improves Chlorophyll Content under Low-Temperature Stress
[0180] 1. Take the Arabidopsis thaliana seedlings to be tested completed in step 1 (3), and detect the chlorophyll content in the leaves of the Arabidopsis thaliana seedlings to be tested according to the method described in the monograph (Li Hesheng. Principles and Techniques of Plant Physiological and Biochemical Experiments [M]. Beijing: Higher Education Press).
[0181] Partial detection results are shown in Figure 8 Figure A. The results showed that there were no significant differences in the chlorophyll content among wild-type Arabidopsis thaliana, two homozygous T3 transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12), and Arabidopsis thaliana transformed with the empty vector (i.e., 35S) in the 1 / 2MS solid medium. After low-temperature (5°C) treatment, compared with wild-type Arabidopsis thaliana, the chlorophyll content in the two homozygous T3 transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12) was significantly increased.
[0182] 2. Take the Arabidopsis thaliana seedlings to be tested completed in step 1 (3), and further analyze the effects of ZmNAC087 on the expression of three chlorophyll synthesis-related genes HEMA1, HEMB1, and CHLH. The specific steps are as follows: First, extract the total RNA of the Arabidopsis thaliana seedlings to be tested, and then reverse transcribe to obtain the cDNA of the Arabidopsis thaliana seedlings to be tested; using the cDNA of the Arabidopsis thaliana seedlings to be tested as a template, detect the relative expression levels of HEMA1, HEMB1, and CHLH by real-time quantitative PCR (using Act7 (AT5G09810) and TUB2 (AT5G62690) as internal references). Taking the average value of the expression levels of Act7 (AT5G09810) and TUB2 (AT5G62690) genes as the internal reference, and taking the expression level of each gene in wild-type Arabidopsis thaliana on the 1 / 2MS solid medium as 1, using 2- ΔΔCtThe relative expression levels were calculated by the method. All samples were subjected to three independent biological replicates.
[0183] The primers for detecting HEMA1 were HEMA1-F and HEMA1-R.
[0184] The primers for detecting HEMB1 were HEMB1-F and HEMB1-R.
[0185] The primers for detecting CHLH were CHLH-F and CHLH-R.
[0186] The primers for detecting Act7 were ACT7-F and ACT7-R.
[0187] The primers for detecting TUB2 were TUB2-F and TUB2-R.
[0188] The detection results are shown in Figure 8 Figure B. The results showed that there were no significant differences in the relative expression levels of HEMA1, HEMB1, and CHLH among wild-type Arabidopsis thaliana, two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12), and Arabidopsis thaliana transformed with the empty vector (i.e., 35S) in the 1 / 2MS solid medium; after low-temperature (5°C) treatment, compared with wild-type Arabidopsis thaliana, the relative expression levels of HEMA1, HEMB1, and CHLH in two T3-generation homozygous transgenic Arabidopsis thaliana lines overexpressing ZmNAC087 (i.e., OE7 and OE12) were significantly increased. Thus, under low-temperature stress, ZmNAC087 promotes chlorophyll synthesis by inducing the expression of chlorophyll synthesis-related genes such as HEMA1, HEMB1, and CHLH.
[0189] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In general, according to the principle of the present invention, this application intends to cover any modification, use, or improvement of the present invention, including those that depart from the scope disclosed in this application but are made by conventional techniques known in the art. Some basic features can be applied according to the scope of the appended claims below.
Claims
1. Use of the protein ZmNAC087, which is at least one of S3)-S6): S3) Increasing the anthocyanin content in plants; S4) Cultivating transgenic plants with increased anthocyanin content; S5) Increasing the chlorophyll content in plants; S6) Cultivating transgenic plants with increased chlorophyll content; The amino acid sequence of the protein ZmNAC087 is as shown in SEQ ID NO: 1; The plant is maize or Arabidopsis thaliana.
2. Use of the nucleic acid molecule encoding the protein ZmNAC087 described in claim 1, which is at least one of S3)-S6): S3) Increasing the anthocyanin content in plants; S4) Cultivating transgenic plants with increased anthocyanin content; S5) Increasing the chlorophyll content in plants; S6) Cultivating transgenic plants with increased chlorophyll content; The plant is maize or Arabidopsis thaliana.
3. The application according to claim 2, wherein: The nucleic acid molecule encoding the protein ZmNAC087 described in claim 1 is a DNA molecule shown as follows in b1) or b2): b1) The coding region is the DNA molecule shown in SEQ ID NO: 2; b2) The nucleotide sequence is the DNA molecule shown in SEQ ID NO: 2.