α-1,2-Fucosyltransferase Mutants with Improved Catalytic Activity and Their Applications

By molecularly transforming the α-1,2-fucosyltransferase from Helicobacter pylori ATCC 26695, mutants with increased catalytic vitality and expression, the problems of low vitality and low expression of existing enzymes were solved, and the efficient production of 2’-fucosyl lactose was achieved.

CN116064455BActive Publication Date: 2025-07-29JIANGNAN UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202211496246.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-24
Publication Date
2025-07-29
Estimated Expiration
2042-11-24

AI Technical Summary

Technical Problem

The existing α-1,2-fucosyltransferase has low catalytic activity, low expression and poor stability, which limits the industrial application and large-scale synthesis of 2’-fucosyl lactose.

Method used

Through genetic engineering, a single and double-point saturated mutation library was constructed, and α-1,2-fucosyltransferase from Helicobacter pylori ATCC 26695 was molecularly modified to screen mutants with simultaneously improved catalytic vitality and soluble expression, and orderly superposition to construct a combined mutant.

Benefits of technology

The catalytic vitality and protein expression volume were improved, and the catalytic vitality of a single point mutant increased to 1.28U/mg to 1.62U/mg, and the catalytic vitality of a combined mutant increased to 1.36U/mg to 1.62U/mg, solving the technical bottleneck of enzymes and providing an effective way for the industrial production of 2’-fucosyl lactose.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116064455B_ABST
    Figure CN116064455B_ABST
Patent Text Reader

Abstract

The present invention discloses an α-1,2-fucosyltransferase mutant with improved catalytic activity and its application, belonging to the field of genetic engineering. By means of genetic engineering, the present invention establishes a saturation mutation library of single and double sites, constructs a 2'-FL engineering strain to conduct a preliminary screening of the small mutant library, synthesizes the donor substrate GDP-L-fucose and conducts a re-screening of the preliminarily screened mutants. The single-site mutants with high catalytic activity are selected for orderly superposition, and finally a combined mutant with both improved catalytic activity and protein expression level is screened. The single-site and combined mutants obtained in the present invention have reference significance for solving the technical bottleneck of glycosyltransferase, provide an effective way for the batch production of 2'-FL, and provide a new idea for the semi-rational design and construction of a new generation of 2'-FL microbial cell factories.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an α-1,2-fucosyltransferase mutant with improved catalytic activity and its applications, and belongs to the field of genetic engineering. Background Art

[0002] Fucosyltransferases (FucTs) are a class of transferases involved in the synthesis of fucosylated oligosaccharides, which can catalyze the transfer of L-fucose from donor substrate GDP-L-fucose to various sugar acceptor substrates, including oligosaccharides, glycoproteins, and glycolipids. Fucosylation is usually the last step in the biosynthesis of oligosaccharides and glycoconjugates and plays an irreplaceable and important role in many complex physiological and pathological processes.

[0003] α-1,2-Fucosyltransferase (α-1,2-FucT, EC 2.4.1.69) belongs to CAZY family 11 and can not only catalyze the formation of Lewis X antigen from substrate N-acetyl-D-lactosamine (LacNAc) for use in anti-inflammatory drugs and anti-tumor vaccines, but also catalyze the preparation of the important prebiotic 2'-fucosyllactose (2'-FL) in human milk oligosaccharides (HMOs) from substrate lactose. 2'-FL accounts for about 30% of the components of HMOs and has been approved by the US Food and Drug Administration (FDA) as Generally Recognized as Safe (GRAS) and by the European Union as a Novel Food (NF). The beneficial properties of 2'-FL (such as maintaining intestinal ecological balance, resisting the adhesion of pathogenic bacteria, immunomodulation, and promoting the development and repair of the nervous system) have attracted great attention due to its potential applications in nutritional health care and pharmaceutical uses.

[0004] In recent years, the exploration of enzyme sources for α-1,2-FucT has been gradually deepened. Many α-1,2-FucTs from bacterial sources have been cloned and characterized, including those from Helicobacter pylori, Escherichia coli strains (Escherichia coli O127:K63(B8), O128, O86), Helicobacter mustelae, and Bacteroides fragilis, etc. However, most of the reported α-1,2-FucTs exhibit problems such as low catalytic activity and poor soluble expression in microbial expression systems. In the Chinese patent application text with the publication number CN113528480A, protein modification of the α-1,2-fucosyltransferase from Helicobacter pylori NCTC11639 was disclosed, where lysine K at position 102 was mutated to glutamate E, arginine R at position 105 was mutated to cysteine C, or lysine K at position 282 was mutated to glutamate E. Finally, the catalytic activities of the mutants K102E, R105C, and K282E towards the natural substrate lactose were 139 mU / mg to 174.1 mU / mg. Although the catalytic activity was improved compared to the wild enzyme, it was still difficult to meet the industrial application of this enzyme. It can be seen that the above problems have become the technical bottleneck for the industrial application of this enzyme and have also greatly restricted the large-scale synthesis of 2'-fucosyllactose. Currently, there are few reports on the directed evolution of α-1,2-FucT. Improving the enzyme activity, soluble expression, and environmental stability of α-1,2-FucT through molecular modification is of great significance for solving the technical bottleneck of this enzyme, as well as for the research and application of enzyme mechanisms. Summary of the Invention

[0005] [Technical Problem]

[0006] The α-1,2-fucosyltransferase for synthesizing 2'-FL in the prior art has bottleneck problems such as low catalytic activity, low expression level, and poor stability, which limit the industrial application of this enzyme and the large-scale synthesis of 2'-FL.

[0007] [Technical Solution]

[0008] To solve the above-mentioned existing technical problems, the present invention conducts molecular modification research on the α-1,2-fucosyltransferase from Helicobacter pylori ATCC 26695 through semi-rational design.

[0009] The present invention aims to use genetic engineering means to initially screen a small mutant library by establishing a single- and double-site saturation mutant library, constructing a 2'-FL production strain containing mutants, synthesizing the donor substrate GDP-L-fucose, and re-screening the initially screened mutants for enzyme activity. After two-step screening, a positive mutant strain with improved catalytic activity and soluble expression is obtained. Finally, the positive mutation sites are selected for ordered stacking to construct a combinatorial mutant. This research method has reference significance for solving the technical bottleneck of glycosyltransferase, provides an effective way for the batch production of 2'-FL, and provides new ideas for semi-rational design and construction of a new generation of 2'-FL microbial cell factories, which has relatively important value in both theory and practical applications.

[0010] The first object of the present invention is to provide an α-1,2-fucosyltransferase mutant with improved catalytic activity, wherein the mutant is a mutation of one or more of the amino acids at positions 102, 105, 115, 251, 255, and 282 of the wild enzyme with the amino acid sequence shown in SEQ ID NO.1.

[0011] In one embodiment, the mutant is one of the following (a) or (b):

[0012] (a) Single-site mutant: Lysine K at position 102 is mutated to threonine T, named K102T; or, arginine R at position 105 is mutated to cysteine C, named R105C; or, aspartic acid D at position 115 is mutated to serine S, named D115S; or, tyrosine Y at position 251 is mutated to phenylalanine F, named Y251F; or, alanine A at position 255 is mutated to glycine G, named A255G; or, lysine K at position 282 is mutated to glutamic acid E, named K282E.

[0013] (b) Combinatorial mutant: Lysine K at position 102 is mutated to threonine T, and arginine R at position 105 is mutated to cysteine C, named K102T / R105C;

[0014] or, lysine K at position 102 is mutated to threonine T, arginine R at position 105 is mutated to cysteine C, and aspartic acid D at position 115 is mutated to serine S, named K102T / R105C / D115S;

[0015] or, tyrosine Y at position 251 is mutated to phenylalanine F, and alanine A at position 255 is mutated to glycine G, named Y251F / A255G;

[0016] Alternatively, the tyrosine Y at position 251 is mutated to phenylalanine F, the alanine A at position 255 is mutated to glycine G, and the lysine K at position 282 is mutated to glutamic acid E, named Y251F / A255G / K282E;

[0017] Alternatively, the lysine K at position 102 is mutated to threonine T, the arginine R at position 105 is mutated to cysteine C, the aspartic acid D at position 115 is mutated to serine S, the tyrosine Y at position 251 is mutated to phenylalanine F, and the alanine A at position 255 is mutated to glycine G, named K102T / R105C / D115S / Y251F / A255G;

[0018] Alternatively, the lysine K at position 102 is mutated to threonine T, the arginine R at position 105 is mutated to cysteine C, the aspartic acid D at position 115 is mutated to serine S, the tyrosine Y at position 251 is mutated to phenylalanine F, the alanine A at position 255 is mutated to glycine G, and the lysine K at position 282 is mutated to glutamic acid E, named K102T / R105C / D115S / Y251F / A255G / K282E.

[0019] In one embodiment, the amino acid sequences of the single mutants K102T, R105C, D115S, Y251F, A255G, and K282E are shown in SEQ ID NO.2 to SEQ ID NO.7 respectively; the amino acid sequences of the combined mutants K102T / R105C, K102T / R105C / D115S, Y251F / A255G, Y251F / A255G / K282E, K102T / R105C / D115S / Y251F / A255G, and K102T / R105C / D115S / Y251F / A255G / K282E are shown in SEQ ID NO.8 to SEQ ID NO.13 respectively.

[0020] The present invention provides a gene encoding the above-mentioned α-1,2-fucosyltransferase mutant.

[0021] The present invention also provides a recombinant vector carrying the above gene.

[0022] The present invention also provides a microbial cell carrying the above gene or the above recombinant vector.

[0023] In one embodiment, the microbial cell uses bacteria or fungi as an expression host.

[0024] In one embodiment, the microbial cell uses Escherichia coli DH5α or Escherichia coli BL21(DE3) as an expression host.

[0025] In one embodiment, the genetically engineered bacterium uses pETDuet-1 as an expression vector.

[0026] The present invention provides a genetically engineered bacterium for efficiently synthesizing 2'-fucosyllactose. The genetically engineered bacterium uses Escherichia coli as a host, and knocks out the β-galactosidase gene lacZ, UDP-glucose lipid carrier transferase gene wcaJ, GDP-mannose mannosyl hydrolase gene nudD, 6-phosphofructokinase-1 gene pfkA, and protease gene lon in the genome, overexpresses phosphomannomutase gene manB, mannose-1-phosphate guanylyltransferase gene manC, GDP-mannose-6-dehydrogenase gene gmd, and GDP-fucose synthase gene wcaG; and heterologously expresses the coding gene of the above α-1,2-fucosyltransferase mutant.

[0027] In one embodiment, the genetically engineered bacterium uses pRSFDuet-1 to express manB, manC, gmd, and wcaG, and uses pETDuet-1 to express the coding gene of the α-1,2-fucosyltransferase mutant.

[0028] In one embodiment, the Gene ID of the β-galactosidase gene lacZ is 945006, the Gene ID of the UDP-glucose lipid carrier transferase gene wcaJ is 946583, the Gene ID of the GDP-mannose mannosyl hydrolase gene nudD is 946559, and the Gene ID of the protease gene lon is 945085.

[0029] In one embodiment, the nucleotide sequence of the phosphomannomutase gene manB is as shown in SEQ ID NO.14, the nucleotide sequence of the mannose-1-phosphate guanylyltransferase gene manC is as shown in SEQ ID NO.15, the nucleotide sequence of the GDP-mannose-6-dehydrogenase gene gmd is as shown in SEQ ID NO.16, and the nucleotide sequence of the GDP-fucose synthase gene wcaG is as shown in SEQ ID NO.17.

[0030] The present invention also provides a method for producing 2'-fucosyllactose using whole cells. The method is to use the genetically engineered bacterium as a fermentation strain and ferment to produce 2'-fucosyllactose in a fermentation system using glycerol as a carbon source and lactose as a substrate.

[0031] In one embodiment, the genetically engineered bacterium is cultured in a fermentation system until OD 600= 0.6 ± 0.1, add IPTG with a final concentration of 0.2 - 0.5 mM, and at the same time add lactose to a final concentration of 5 - 10 g / L, and induce culture for 40 - 50 h under the conditions of 20 - 30 °C and 150 - 200 rpm.

[0032] In one embodiment, the fermentation system contains 20 - 30 g / L of glycerol, 2 - 4 g / L of casein amino acids, 2 - 5 g / L of potassium dihydrogen phosphate, 5 - 10 g / L of disodium hydrogen phosphate, 1 - 2 g / L of ammonium chloride, 1 - 2 g / L of sodium chloride, 1 - 2 g / L of magnesium sulfate heptahydrate, 5 - 10 mg / L of thiamine hydrochloride, 8 - 10 g / L of yeast extract, 1 - 2 mL / L of trace metal solution, and pH 6.8.

[0033] In one embodiment, the trace metal solution contains 20 - 25 g / L of ferric chloride hexahydrate, 1 - 2 g / L of calcium chloride dihydrate, 1 - 2 g / L of zinc chloride, 1 - 2 g / L of sodium molybdate dihydrate, 1 - 2 g / L of copper sulfate pentahydrate, 0.2 - 0.5 g / L of manganese sulfate monohydrate, and 0.2 - 0.5 g / L of boric acid.

[0034] The present invention also provides a method for preparing 2'-fucosyllactose by an in vitro enzymatic method. The method is to add the above-mentioned α-1,2-fucosyltransferase mutant to a reaction system containing a donor substrate GDP-L-fucose and a receptor substrate lactose, and perform an enzymatic reaction to prepare 2'-fucosyllactose.

[0035] In one embodiment, the donor substrate GDP-L-fucose is enzymatically synthesized in a reaction system containing L-fucose, ATP, GTP, and L-fucose kinase / GDP-fucose pyrophosphorylase fkp.

[0036] The present invention also provides the use of the above-mentioned α-1,2-fucosyltransferase mutant, or the above-mentioned gene, or the above-mentioned recombinant vector, or the above-mentioned microbial cell, or the above-mentioned genetically engineered bacterium in the preparation of 2'-fucosyllactose or a product containing 2'-fucosyllactose.

[0037] The beneficial effects of the present invention:

[0038] In this invention, molecular modification research was carried out on α-1,2-fucosyltransferase (HpfutC) derived from Helicobacter pylori ATCC 26695 through semi-rational design, and single-point and multi-point mutants with improved catalytic activity and protein expression levels were obtained. The catalytic activities of single-point mutants K102T, R105C, D115S, Y251F, A255G, and K282E were increased from 0.71 U / mg of the wild enzyme to 1.28 U / mg, 1.15 U / mg, 0.78 U / mg, 1.10 U / mg, 0.95 U / mg, and 1.03 U / mg, respectively; the catalytic activities of combined mutant enzymes V1, V2, V3, V4, V5, and V6 were increased from 0.71 U / mg of the wild enzyme to 1.36 U / mg, 1.44 U / mg, 1.21 U / mg, 1.40 U / mg, 1.56 U / mg, and 1.62 U / mg, respectively. This method has reference significance for solving the technical bottleneck of glycosyltransferase, provides an effective way for the industrial production of 2'-fucosyllactose, and has broad market development prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is a schematic diagram of the enzymatic synthesis pathway of 2'-FL from lactose and L-fucose.

[0040] Figure 2 It is a thin-layer chromatogram of the enzymatic synthesis of GDP-L-fucose and 2'-FL.

[0041] Figure 3 It is an SDS-PAGE diagram of the protein purification of wild-type and single-point mutants of α-1,2-fucosyltransferase.

[0042] Figure 4 It is the ordered recombination of forward mutants. DETAILED DESCRIPTION OF THE INVENTION

[0043] The following further describes the specific implementation of the present invention in combination with examples and drawings. It should be understood that the implementation of the present invention is not limited to the following examples, and any formal modification or change made to the present invention will fall within the protection scope of the present invention.

[0044] (I) Detection method

[0045] Enzyme activity assay method of HpfutC: The reaction system is 300 μL, containing lactose with a final concentration of 5 mM, GDP-L-fucose of 2 mM, 20 μg of HpfutC pure enzyme solution, 2 mM Mn 2+ , and 50 mM Tris-HCl (pH 7.0) buffer. The enzyme reaction is carried out at 37 °C for 20 min, and the reaction is terminated by boiling water bath for 10 min.

[0046] Enzyme activity definition (U): The amount of enzyme required to catalyze the synthesis of 1 μmol of 2’-FL per unit time (min) under standard reaction conditions.

[0047] Determination of the product standard curve: Prepare 2’-FL standard solutions with final concentrations of 0.1 g / L, 0.2 g / L, 0.5 g / L, 0.8 g / L, 1.0 g / L, and 1.5 g / L. Analyze the samples by HPLC and plot the standard curve.

[0048] HPLC determination method for 2’-FL: Centrifuge the inactivated reaction system at 12,000 r / min for 5 min. Filter the supernatant through a 0.22 μm membrane and detect the production amount of 2’-FL by HPLC. HPLC detection conditions: refractive index detector; the chromatographic column is Rezex ROA-organic acid (Phenomenex, USA), the column temperature is 50 °C; the mobile phase is an aqueous solution of 0.005 mol / L H2SO4, the flow rate is 0.6 mL / min; the injection volume is 10 μL.

[0049] HPLC detection method for GDP-L-fucose: ultraviolet detector; detection wavelength 254 nm; the chromatographic column is Inertsil ODS-SP (GL Sciences, Kyoto, Japan); mobile phase A is an aqueous solution of 20 mM triethylamine-acetic acid (pH 6.0), mobile phase B is an acetonitrile solution; gradient elution; the flow rate is 0.6 mL / min; the injection volume is 10 μL.

[0050] Thin layer chromatography (TLC) reagents:

[0051] Developing agent: n-butanol: ethanol: water (2:1:1, v / v / v).

[0052] Developer: Dissolve 18 mL of benzaldehyde in 540 mL of 95% ethanol and cool the solution in an ice / water bath. Mix 30 mL of 97% sulfuric acid and 6 mL of acetic acid, and add the acid mixture to the pre-cooled ethanol solution. Store the colorless solution in a -20 °C refrigerator before use.

[0053] (II) Culture medium

[0054] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride.

[0055] LB solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 18 g / L agar powder.

[0056] Primary screening fermentation medium: glycerol 20 - 30 g / L, casein amino acids 2 - 4 g / L, potassium dihydrogen phosphate 2 - 5 g / L, disodium hydrogen phosphate 5 - 10 g / L, ammonium chloride 1 - 2 g / L, sodium chloride 1 - 2 g / L, magnesium sulfate heptahydrate 1 - 2 g / L, thiamine hydrochloride 5 - 10 mg / L, yeast extract 8 - 10 g / L, trace metal solution 1 - 2 mL / L, pH 6.8;

[0057] Trace metal solution: ferric chloride hexahydrate 20 - 25 g / L, calcium chloride dihydrate 1 - 2 g / L, zinc chloride 1 - 2 g / L, sodium molybdate dihydrate 1 - 2 g / L, copper sulfate pentahydrate 1 - 2 g / L, manganese sulfate monohydrate 0.2 - 0.5 g / L, boric acid 0.2 - 0.5 g / L.

[0058] Example 1: Construction of single and double point saturation mutation libraries

[0059] Based on the sequence and structural information of α-1,2-fucosyltransferase from different microbial sources, with the aid of computer-aided design and phylogenetic analysis of sequences, the mutation "hot spots" affecting catalytic activity were rationally selected. Through semi-rational design, the mutation sites K102, R105, D115, P116, Q184, C204, E205, F209, D214, R225, Q239, Y251, A255, I266, G268, K282 and V285 of HpfutC were initially selected.

[0060] (1) Construction of wild-type recombinant plasmid pET-HpfutC

[0061] Two restriction enzyme sites, Nde I and Xho I, were introduced at the 5' end and 3' end of the wild enzyme HpfutC with the nucleotide sequence shown in SEQ ID No.1 respectively. After inserting a 6×His tag (CACCACCACCACCACCACTAA) before the stop codon of HpfutC, the corresponding sequence was synthesized by Tianlin Biotechnology (Wuxi) Co., Ltd. The sequence was ligated with the vector pETDuet-1 to obtain the wild-type recombinant plasmid pET-HpfutC.

[0062] (2) Construction of single and double point saturation mutation libraries

[0063] Using the wild-type recombinant plasmid pET-HpfutC constructed in step (1) as a template, degenerate primers for single and double amino acid sites were designed (as shown in Table 1). Saturated mutagenesis was performed by inverse PCR. The amplified linear plasmid products were recovered and purified by gel electrophoresis. The background template was completely removed by digesting with the restriction enzyme Dpn I at 37 °C for 2 h. According to the One Step Cloning Kit (ClonExpress II One Step Cloning Kit), the linear vector was subjected to a recombination reaction. 10 μL of the product of the recombination reaction was chemically transformed into E. coli DH5α competent cells and cultured overnight on a plate containing ampicillin resistance (100 μg / mL). 30 monoclonal colonies were selected from each plate and sequenced for identification. After sequence alignment of the mutation sites, a plasmid library containing 400 mutants was finally obtained.

[0064] PCR reaction system: 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 1 μL of template DNA (50 ng / μL), 25 μL of 2×Phanta Max Master Mix, and double-distilled water was added to make up 50 μL.

[0065] PCR amplification program: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing at 60 °C for 15 s, extension at 72 °C for 300 s, for 30 cycles; finally, extension at 72 °C for 5 min.

[0066] Recombination reaction system: 260 ng of purified linear vector, 4 μL of 5×CEⅡ Buffer, 2 μL of ExnaseⅡ, and double-distilled water was added to make up 20 μL.

[0067] Recombination reaction conditions: reaction at 37 °C for 30 min, and after the reaction, it was cooled and stored at 4 °C or on ice.

[0068] Table 1 Saturated mutagenesis primers

[0069]

[0070]

[0071] Note: The bold ones are the mutation sites.

[0072] Example 2: Primary screening of a small α-1,2-fucosyltransferase mutant library

[0073] According to the de novo synthesis pathway of 2'-fucosyllactose, BZWNDPAL-pRSF-CBGW was used as the starting strain (BZWNDPAL carrying plasmid pRSF-CBGW, and both strain BZWNAPAL and expression vector pRSF-CBGW have been described in the patent application text with the publication number CN114480240A). The plasmid libraries containing mutants in Example 1 were respectively transformed into the competent cells of the starting strain BZWNDPAL-pRSF-CBGW, and engineering strains containing 400 HpfutC mutants were respectively obtained.

[0074] Single colonies were respectively picked and transferred to 96-well deep-well plates (Deep-well Multiwell Plate, MTP) containing 0.8 mL of LB liquid medium. Two engineering strains containing wild enzyme HpfutC were set as control groups in each MTP. After culturing at 37 °C and 200 rpm for 12 h, seed solutions were obtained. The seed solutions were transferred to 48-well MTPs containing 2 mL of primary screening fermentation medium at an inoculation amount of 3% (v / v), and the remaining bacterial solutions were added with glycerol as a master plate for preservation. When cultured at 37 °C until the OD 600 reached 0.6 - 0.8, IPTG with a final concentration of 0.3 mM was added, and lactose was simultaneously added to a final concentration of 5 g / L, and induced culture was carried out at 25 °C and 200 rpm for 48 h.

[0075] After fermentation, samples were taken and the OD of the bacterial cells was measured 600 . 1 mL of the fermentation broth was boiled for 10 min to completely break the cells, centrifuged at 12000 r / min for 10 min, the supernatant was filtered through a 0.22 μm membrane, and the production amount of 2'-FL and the consumption amounts of lactose and glycerol were detected by HPLC. Through preliminary screening, 22 mutant strains higher than the control group were obtained. The corresponding single-point and double-point HpfutC mutants were K102P, K102I, K102N, K102T, K102V, R105P, R105V, R105E, R105C, D115S, P116C, Q184Y, E205D, Q239S, Y251F, A255G, K282E, V285F, K102T / R105P, K102T / R105I, K102G / R105C. The yields of the remaining mutant strains decreased or no products were produced.

[0076] Example 3: Synthesis of the donor substrate GDP-L-fucose and rescreening of the primary screening mutants

[0077] Using GDP-L-fucose and lactose as substrates, the enzyme activities of the mutants screened in Example 2 were determined by using the catalysis of the mutants screened in Example 2 to generate 2'-FL ( Figure 1 ).

[0078] (1) Expression and purification of mutants

[0079] The primary screening mutants in Example 2 were separately transformed into Escherichia coli BL21(DE3) cells. Positive transformants were picked and cultured overnight at 37 °C and 200 rpm in LB medium to obtain a seed solution. The seed solution was inoculated into LB medium at an inoculation amount of 3% (v / v) and cultured at 37 °C for 3 - 4 h until the OD 600 value was 0.6 - 0.8. Then the temperature was lowered to 20 °C, and IPTG with a final concentration of 0.3 mM was added to induce for 20 h to obtain a fermentation broth.

[0080] The fermentation broth was centrifuged at 4 °C and 8000 rpm for 20 min to remove the supernatant. 20 mL of buffer (50 mM Tris, 200 mM NaCl, adjusted to pH 7.5) was added to the bacterial cells to fully resuspend the cells. Under ice bath conditions, the resuspended cells were ultrasonically disrupted. The conditions for ultrasonic disruption were: working time 1 s, stopping time 2 s, for a total of 15 min. The disrupted cells were centrifuged at 4 °C and 8000 rpm for 10 min to obtain a crude enzyme solution. It was filtered through a 0.45 μm microporous filter membrane for standby.

[0081] At 4 °C, using a constant flow pump, 6 - 12 column volumes of deionized water were pumped into the nickel ion affinity chromatography column, and then the column environment was equilibrated with a buffer of low salt concentration (50 mM Tris, 500 mM NaCl, adjusted to pH 7.0). When the pH value of the effluent at the lower end of the column was the same as that of the low salt concentration buffer, the filtered crude enzyme solution was added to the equilibrated nickel ion affinity chromatography column. First, the column was rinsed with a buffer containing low - concentration imidazole (50 mM Tris, 500 mM NaCl, 50 mM imidazole, adjusted to pH 7.0) until the baseline was balanced for the impurity proteins, and then eluted with an eluent containing high - concentration imidazole (50 mM Tris, 500 mM NaCl, 500 mM imidazole, adjusted to pH 7.0). The eluate at the absorption peak was collected.

[0082] The eluate was transferred into a dialysis bag with a molecular weight cut - off of 10 kDa, clamped with a dialysis clip, and placed in dialysis buffer A (10 mM EDTA·2Na, 50 mM Tris, adjusted to pH 7.0), and placed in a chromatography cabinet at 4 °C for dialysis for 18 h, and the fresh dialysis buffer A was changed every 6 h to remove imidazole and other metal ions in the eluate. Then the dialysis bag was transferred to dialysis buffer B (50 mM Tris, adjusted to pH 7.0), and also dialyzed for 18 h, and the fresh dialysis buffer B was changed every 6 h. After dialysis, the pure enzyme solution in the dialysis bag was collected into a 10 mL EP tube and stored in a 4 °C refrigerator for standby.

[0083] (2) Measurement of mutant enzyme activity

[0084] The purified wild-type HpfutC and the initially screened mutants were subjected to enzymatic reactions. Thin layer chromatography was used to preliminarily detect the product formation ( Figure 2 , enzymatic reaction 2), and HPLC was used to further detect the production amount of GDP-L-fucose. As shown in Table 2, the catalytic activities of most of the initially screened mutants were higher than that of the wild enzyme. Among them, the specific enzyme activities of K102T, R105C, D115S, Y251F, A255G, and K282E were increased to 1.81, 1.63, 1.11, 1.56, 1.35, and 1.47 times that of the wild enzyme, and the catalytic activities were increased from 0.71 U / mg of the wild enzyme to 1.28 U / mg, 1.15 U / mg, 0.78 U / mg, 1.10 U / mg, 0.95 U / mg, and 1.03 U / mg, respectively. As Figure 3 shown, the pure enzyme solutions of the 6 mutants all reached electrophoretic purity, and the relative molecular weight of the purified mutant enzymes was approximately 35 kDa.

[0085] Table 2. Relative enzyme activities of wild-type HpfutC and initially screened mutants

[0086]

[0087]

[0088] Example 4: Ordered superposition combination of forward mutations

[0089] Studies have shown that the effects of introducing multiple positive mutations on wild enzymes are complex, and additive effects, partial additive effects, synergistic effects, antagonistic effects, or no effects on each other may occur between different mutations. In this example, an orderly superposition method was used to explore the influence modes among the six positive mutations of K102T, R105C, D115S, Y251F, A255G, and K282E. The six single-point mutations were divided into group I (K102T, R105C, D115S) and group II (Y251F, A255G, K282E). The single-point mutation sites within the groups were superposed and combined to obtain V1 (K102T / R105C), V2 (K102T / R105C / D115S), V3 (Y251F / A255G), and V4 (Y251F / A255G / K282E). Based on V2, mutations were superposed again to obtain the combined mutants V5 (K102T / R105C / D115S / Y251F / A255G) and V6 (K102T / R105C / D115S / Y251F / A255G / / K282E)( Figure 4 ). Table 3 shows the primers of the combined mutants, and the construction method is the same as that in Example 1.

[0090] Table 3. Primers for combined mutations

[0091]

[0092]

[0093] Note: The bold ones are mutation sites.

[0094] The purified wild-type enzyme HpfutC and the combinatorial mutants were assayed for enzyme activity. As shown in Table 4, the catalytic activity of the combinatorial mutants was significantly improved compared with that of the wild-type enzyme. The enzyme activities of V1, V2, V3, V4, V5, and V6 were increased to 1.93, 2.05, 1.71, 1.98, 2.22, and 2.30 times that of the wild-type enzyme, respectively. The catalytic activities were increased from 0.71 U / mg of the wild-type enzyme to 1.36 U / mg, 1.44 U / mg, 1.21 U / mg, 1.40 U / mg, 1.56 U / mg, and 1.62 U / mg, respectively.

[0095] The pure enzyme solution was appropriately diluted, and the concentration of the recombinant enzyme was determined according to the operation instructions of the Bradford Protein Concentration Assay Kit from Beyotime. The results showed that the protein expression level of the wild-type was 0.42 mg / mL. The protein expression level of the mutant K102T was increased by 1.48 times to 0.62 mg / mL; that of R105C was increased by 1.33 times to 0.56 mg / mL; that of D115S was increased by 1.14 times to 0.48 mg / mL; that of Y251F was increased by 1.38 times to 0.58 mg / mL; that of A255G was increased by 1.31 times to 0.55 mg / mL; that of K282E was increased by 1.32 times to 0.56 mg / mL; that of V1 was increased by 1.4 times to 0.59 mg / mL; that of V2 was increased by 1.48 times to 0.62 mg / mL; that of V3 was increased by 1.33 times to 0.56 mg / mL; that of V4 was increased by 1.52 times to 0.64 mg / mL; that of V5 was increased by 1.62 times to 0.68 mg / mL; that of V6 was increased by 1.67 times to 0.7 mg / mL. The protein expression levels of the forward mutant enzymes described in the present invention were all increased compared with those of the wild-type enzyme.

[0096] Table 4. Relative enzyme activities of wild-type HpfutC and combinatorial mutants

[0097]

[0098] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. An α-1,2-fucosyltransferase mutant with increased catalytic activity, characterized in that, Based on the wild-type enzyme with the amino acid sequence shown in SEQ ID NO.1, the following mutations were made: The lysine K at position 102 was mutated to threonine T; Or, the lysine K at position 102 was mutated to threonine T, and the arginine R at position 105 was mutated to cysteine C, named K102T / R105C; Or, the lysine K at position 102 was mutated to threonine T, the arginine R at position 105 was mutated to cysteine C, and the aspartic acid D at position 115 was mutated to serine S, named K102T / R105C / D115S; Or, the lysine K at position 102 was mutated to threonine T, the arginine R at position 105 was mutated to cysteine C, the aspartic acid D at position 115 was mutated to serine S, the tyrosine Y at position 251 was mutated to phenylalanine F, and the alanine A at position 255 was mutated to glycine G, named K102T / R105C / D115S / Y251F / A255G; Or, the lysine K at position 102 was mutated to threonine T, the arginine R at position 105 was mutated to cysteine C, the aspartic acid D at position 115 was mutated to serine S, the tyrosine Y at position 251 was mutated to phenylalanine F, the alanine A at position 255 was mutated to glycine G, and the lysine K at position 282 was mutated to glutamic acid E, named K102T / R105C / D115S / Y251F / A255G / K282E.

2. A gene encoding the α-1,2-fucosyltransferase mutant according to claim 1.

3. A recombinant vector carrying the gene according to claim 2.

4. A microbial cell carrying the gene according to claim 2 or the recombinant vector according to claim 3.

5. A genetically engineered bacterium for efficiently synthesizing 2'-fucosyllactose, characterized in that, Using Escherichia coli as the host, the β-galactosidase gene lacZ, UDP-glucose lipid carrier transferase gene wcaJ, GDP-mannose mannosyl hydrolase gene nudD, 6-phosphofructokinase-1 gene pfkA, and protease gene lon in the genome were knocked out, the phosphomannomutase gene manB, mannose-1-phosphate guanylyltransferase gene manC, GDP-mannose-6-dehydrogenase gene gmd, and GDP-fucose synthase gene wcaG were overexpressed; the encoding gene according to claim 2 was heterologously expressed.

6. The genetically engineered bacterium according to claim 5, wherein The genetically engineered bacterium uses pRSFDuet-1 to express manB, manC, gmd, and wcaG, and uses pETDuet-1 to express the gene according to claim 2.

7. A method for the production of 2'-fucosyllactose by whole cells, characterized in that, The method is to ferment and produce 2'-fucosyllactose in a fermentation system using the genetically engineered bacterium according to claim 5 or 6 as the fermentation strain, glycerol as the carbon source, and lactose as the substrate.

8. A method for preparing 2'-fucosyllactose by an in vitro enzymatic method, characterized in that, The method is to add the α-1,2-fucosyltransferase mutant according to claim 1 to a reaction system containing the donor substrate GDP-L-fucose and the acceptor substrate lactose, and prepare 2'-fucosyllactose by an enzymatic reaction.

9. Use of the α-1,2-fucosyltransferase according to claim 1, or the gene according to claim 2, or the recombinant vector according to claim 3, or the microbial cell according to claim 4, or the genetically engineered bacterium according to claim 5 or 6 in the preparation of 2'-fucosyllactose or a product containing 2'-fucosyllactose.

Citation Information

Patent Citations

  • Genetically engineered bacterium for producing fucosyllactose and production method

    CN114480240A

  • Alpha-1, 2-fucosyltransferase mutant as well as construction method and application thereof

    CN113528480A

  • Engineering escherichia coli for improving yield of fucosyllactose and production method

    CN114806991A