Extrachromosomal circular DNA related to mitochondrial damage in ginkgo vascular cambium and its screening method and application
Patent Information
- Application Number
- CN202210934294.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-04
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2042-08-04
AI Technical Summary
然而,近年来关于维管形成层的研究大部分集中在形态学、解剖学方面,对木材形成的细胞和分子调控仍然知之甚少
[0016] The present invention provides an extrachromosomal circular DNA related to mitochondrial damage in the vascular cambium of Ginkgo biloba, and the extrachromosomal circular DNA is named [TAR1 circle], obtained by detecting and identifying the vascular cambium of healthy and mitochondrial damaged ginkgo trees. circle ] is highly correlated with mitochondrial damage in the vascular cambium of Ginkgo biloba. Through the study of this eccDNA, we can further reveal the molecular mechanism of eccDNA's participation in plant mitochondrial retrograde signal transduction and provide an eccDNA reference standard for potential biomarkers of plant response to mitochondrial damage.
Smart Images

Figure CN116064519B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to extrachromosomal circular DNA associated with mitochondrial damage in the ginkgo vascular cambium, and a screening method and application thereof. Background Art
[0002] DNA, the genetic material of life, is divided into two forms: linear and circular. Extrachromosome circular DNA (eccDNA), a self-replicating circular DNA molecule distinct from conventional chromosomes, has been found in many organisms, including animals and plants. Recent research advances have revealed the origin, formation, and function of eccDNA, which plays a crucial role in the development of diseases, particularly cancer, as well as gene amplification, dosage compensation, and drug resistance.
[0003] Wood is the most abundant biomass produced by plants, primarily used in construction, pulping, and papermaking, making it one of Earth's most important natural and renewable resources. The growth of trees produced by cell division in the vascular cambium, called "secondary growth," results in the production of secondary vascular tissue, secondary phloem, and xylem (i.e., wood). The development of the vascular cambium is crucial for wood quality. Due to this unique ability to produce large woody bodies through secondary growth, trees account for over 90% of Earth's terrestrial biomass and serve as a primary feedstock for biofuels, fibers, solid wood products, and various natural compounds. Given the decline in forest area, demand for these wood products and wood energy is expected to continue to increase. To meet the growing population's demand for construction and fiber, future forestry must achieve higher bioproductivity of trees and more efficiently utilize and recycle the biomass they produce as forest products. To make biomaterials an economically viable alternative to other land uses and cost-competitive with non-renewable resources such as fossil fuels, in-depth research on the regulatory mechanisms of the tree vascular cambium is crucial to maximize yield and modify the chemical composition of the produced biomaterials. However, in recent years, most research on the vascular cambium has focused on morphology and anatomy, leaving little understanding of the cellular and molecular regulation of wood formation. The rapid development of next-generation sequencing and epigenetics has facilitated the exploration of the molecular mechanisms of eccDNA in the plant vascular cambium. This will help us further understand the regulatory mechanisms during the development of the tree vascular cambium and provide an unprecedented perspective on these mysterious molecules in the ginkgo vascular cambium. Summary of the Invention
[0004] In view of this, the object of the present invention is to provide an extrachromosomal circular DNA related to mitochondrial damage in the vascular cambium of Ginkgo biloba, wherein the extrachromosomal circular DNA is [TAR1 circle], which is highly correlated with mitochondrial damage in the vascular cambium of Ginkgo biloba, which is conducive to revealing the molecular mechanism of eccDNA participating in plant mitochondrial retrograde signal transduction.
[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:
[0006] The present invention provides an extrachromosomal circular DNA related to mitochondrial damage in the ginkgo vascular cambium, wherein the extrachromosomal circular DNA is [TAR1 circle ], the [TAR1 circle ] The nucleotide sequence is shown in SEQ ID NO.1.
[0007] The present invention provides the use of the extrachromosomal circular DNA in plant mitochondrial retrograde signal transduction. The extrachromosomal circular DNA is highly correlated with mitochondrial damage in the ginkgo vascular cambium.
[0008] The present invention also provides a method for screening the extrachromosomal circular DNA, comprising the following steps:
[0009] Extracting genomic DNA from ginkgo samples, digesting and performing rolling circle amplification to obtain eccDNA, fragmenting, purifying, and amplifying the eccDNA to obtain enriched eccDNA, and using the enriched eccDNA to construct a Circle-seq library; performing paired-end sequencing on the resulting library, and filtering the obtained sequence information for differential expression and gene annotation to obtain screened eccDNA;
[0010] The screened eccDNA was amplified by reverse PCR, and the resulting product was the extrachromosomal circular DNA-[TAR1 circle ].
[0011] Preferably, the ginkgo samples are healthy and mitochondrially damaged ginkgo vascular cambium samples.
[0012] Preferably, the digestion enzyme is an exonuclease, and the rolling circle amplification enzyme is Phi29 enzyme.
[0013] Preferably, the filtering differential expression selects eccDNA with a P value < 0.05 and |log2FC| > 1.
[0014] Preferably, the template for inverse PCR amplification is enriched eccDNA.
[0015] Beneficial effects of the present invention:
[0016] The present invention provides an extrachromosomal circular DNA related to mitochondrial damage in the vascular cambium of Ginkgo biloba, and the extrachromosomal circular DNA is named [TAR1 circle], obtained by detecting and identifying the vascular cambium of healthy and mitochondrial damaged ginkgo trees. circle ] is highly correlated with mitochondrial damage in the vascular cambium of Ginkgo biloba. Through the study of this eccDNA, we can further reveal the molecular mechanism of eccDNA's participation in plant mitochondrial retrograde signal transduction and provide an eccDNA reference standard for potential biomarkers of plant response to mitochondrial damage. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 Samples were collected from ginkgo trees, where A was a healthy ginkgo tree sample and B was a ginkgo tree sample with mitochondrial damage.
[0018] Figure 2 The volcano plot shows the differentially expressed eccDNA in mitochondrial damaged samples with healthy samples as the control.
[0019] Figure 3 This is a cluster diagram of differentially expressed eccDNA in samples with mitochondrial damage, with healthy samples as controls. GB_H represents healthy ginkgo samples, and GB_D represents ginkgo samples with mitochondrial damage.
[0020] Figure 4 The results of agarose gel electrophoresis after inverse PCR, where GD represents genome DNA and GB_D represents DNA from mitochondrial damage samples.
[0021] Figure 5 The results of TAR1 gene expression measurement, GB_H is a healthy sample, and GB_D is a mitochondrial damage sample. DETAILED DESCRIPTION
[0022] The present invention provides an extrachromosomal circular DNA related to mitochondrial damage in the ginkgo vascular cambium, wherein the extrachromosomal circular DNA is [TAR1 circle ], the [TAR1 circle ] The nucleotide sequence is shown in SEQ ID NO.1.
[0023] The present invention provides the use of the extrachromosomal circular DNA in plant mitochondrial retrograde signal transduction. The extrachromosomal circular DNA is highly correlated with mitochondrial damage in the ginkgo vascular cambium.
[0024] The present invention also provides a method for screening the extrachromosomal circular DNA, comprising the following steps:
[0025] Extracting genomic DNA from ginkgo samples, digesting and performing rolling circle amplification to obtain eccDNA, fragmenting, purifying, and amplifying the eccDNA to obtain enriched eccDNA, and using the enriched eccDNA to construct a Circle-seq library; performing paired-end sequencing on the resulting library, and filtering the obtained sequence information for differential expression and gene annotation to obtain screened eccDNA;
[0026] The screened eccDNA was amplified by reverse PCR, and the resulting product was the extrachromosomal circular DNA-[TAR1 circle ].
[0027] In the present invention, the ginkgo samples are preferably healthy and mitochondrially damaged ginkgo vascular cambium samples, and the ginkgo samples are preferably ground and lysed before genomic DNA extraction. The present invention does not specifically limit the method for extracting the genomic DNA, and a conventional ginkgo tissue DNA extraction method or kit in the art can be used. In the present invention, the digestion enzyme is preferably an exonuclease, and the rolling circle amplification enzyme is preferably Phi29 enzyme. In the present invention, the digested DNA is preferably first identified using qPCR, and the purpose of the identification is to determine whether the linear DNA has been completely digested.
[0028] In the present invention, the platform for double-end sequencing is preferably the Illumina Nova Seq sequencing platform, and the mode of the sequencing platform is preferably the PE150 mode. In the present invention, the obtained sequence information is preferably identified using Circle-MAP (v1.1.3) software and normalized using edgeR (v0.6.9) software. In the present invention, differential expression is filtered to select eccDNA with a P value <0.05 and |log2FC|>1; the gene annotation software is preferably Bedtools (v2.17.0) software.
[0029] In the present invention, the template for the inverse PCR amplification is preferably enriched eccDNA, and the inverse PCR is preferably performed using Ginkgo biloba whole genome DNA as a control.
[0030] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0031] In the following examples, unless otherwise specified, all methods are conventional.
[0032] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0033] Example 1
[0034] 1. Sample collection and processing
[0035] Between August and September 2020, ginkgo trees of the same age but different growth conditions (healthy and mitochondrial damaged) were selected in Lushan, Jiangxi Province as the subjects of sampling. Figure 1 Wood blocks containing phloem, vascular cambium, and xylem were collected from the trunk approximately 1 meter above the ground, quickly frozen in liquid nitrogen, and then stored at -80°C. The vascular cambium tissue was then separated from the wood blocks using cryosectioning.
[0036] 2. Library Preparation, High-Throughput Sequencing, and Analysis of Ginkgo Vascular Cambium eccDNA
[0037] The specific steps for eccDNA library preparation are as follows:
[0038] 1) Grind and lyse the collected Ginkgo vascular cambium samples, extract genomic DNA, and perform quality control;
[0039] 2) After passing quality control, the linear DNA is digested with Plasmid-Safe ATP-dependent DNAase;
[0040] 3) Perform qPCR using a pair of specific primers to confirm that linear DNA is completely removed after exonuclease treatment; the specific primer sequences are as follows:
[0041] Gb-GAPDH-F:CTGCCAAGGCTGTAGGTAAGG (SEQ ID NO. 2);
[0042] Gb-GAPDH-R:TCAGATTCCTCCTTGATGGCG (SEQ ID NO.3);
[0043] 4) Amplification of eccDNA-enriched DNA samples using phi29 polymerase and random hexamer oligomers;
[0044] 5) The phi29-amplified DNA product was sheared to an average fragment size of 300-500 base pairs using a focused ultrasound device (Bioruptor, Diagenode) and then purified using the MinElute PCR purification kit;
[0045] 6) The fragmented DNA samples were used to construct sequencing libraries. The libraries were sequenced using the Illumina Nova Seq sequencing platform in PE150 mode for paired-end sequencing. This process was primarily performed by Shanghai DaChe Biotechnology Co., Ltd.
[0046] After sequencing the healthy and mitochondrial damaged samples, the sequencing results were normalized for eccDNA using edgeR (v0.6.9) software. 442 and 2533 eccDNAs were identified in the healthy and mitochondrial damaged samples, respectively. Using the healthy samples as controls, 151 differentially expressed eccDNAs were screened in the mitochondrial damaged samples with a P value < 0.05 and |log2FC| > 1. Figure 2 、 Figure 3 As shown. Bedtools (v2.17.0) software was used to annotate these eccDNAs. A total of 4 eccDNAs were annotated to 5 genes, one of which was significantly upregulated in the mitochondrial damaged Ginkgo vascular cambium with a logFC value of 5.35270525. This eccDNA was annotated to the gene region of Gb_32800 (Transcript antisense toribosomal RNA, TAR1), which we named [TAR1 circle ](Chr12:479980-480424+), the sequence of which is shown in SEQ ID Shown in NO.1: GCTCGCGGCGTTGGTCTGCGGGCTTTCCATCCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGTGCGAGTCGGCGGGCGCTAACCCAGATCCCACAAAGGGTGTTGGTTGATTAAGACAGCAGGACGGTGGTCATGGAAGTCGAAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCCGAAAATGGATGGCGCTGA AGCGCGCGACCTATACTCGGCCGTCGGGGCAAGTTCCAGGCTCCGATGAGTAGGAGGACGCGGGGGGCGTTAAGAAACCTTGGGCACGAGCCCGGGTGGACCGGCCCCCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGACTGAAGTGGGGAAAGGTTCCATGTGAATAGCACTTGGACATGGGTTAGTCGATCCTAAGAGATGGG.
[0047] Example 2
[0048] Using inverse PCR technology, we verified the expression of [TAR1 in Ginkgo vascular cambium circle ] exists, the specific experimental steps are:
[0049] 1. Inverse PCR Amplification
[0050] [TAR1 circle The PCR amplification primer sequences are:
[0051] F:5'-ATGAGAACTTTGAAGACTG-3'(SEQ ID NO.4);
[0052] R: 5'-CTGTCTTAATCAACCAAC-3' (SEQ ID NO. 5).
[0053] Prepare the PCR amplification system according to the reaction system in Table 1 below:
[0054] Table 1 50 μl PCR amplification system
[0055]
[0056]
[0057] The PCR reaction was performed according to the reaction conditions in Table 2 below:
[0058] Table 2 PCR amplification conditions
[0059]
[0060] 2. Agarose Gel Electrophoresis
[0061] Prepare 1% agarose gel using 1×TAE electrophoresis buffer and run electrophoresis at 100V for 30min. Figure 4 As shown;
[0062] Example 3
[0063] Fluorescence quantitative PCR (qRT-PCR) technology was used to verify the expression of TAR1 in the vascular cambium of healthy and mitochondrially damaged Ginkgo biloba. The specific experimental steps are as follows:
[0064] 1. Preparation of RNA from healthy and mitochondrially damaged Ginkgo vascular cambium:
[0065] 1) Grind healthy and mitochondrially damaged Ginkgo vascular cambium samples into powder using liquid nitrogen. Then, add 1 mL of TRIzol and shake vigorously in a centrifuge tube for 2 minutes to completely dissolve the tissue in TRIzol. Let it stand at room temperature for about 10 minutes.
[0066] 2) Centrifuge at 12,000 rpm for 10 minutes at 4°C and pipette the supernatant into a new centrifuge tube.
[0067] 3) Add chloroform based on the volume of supernatant aspirated, approximately 0.2 mL of chloroform per 1 mL of TRIzol. Shake vigorously for 15 seconds (you can vortex or invert rapidly for 2 minutes), and let it stand at room temperature for 3 minutes.
[0068] 4) Centrifuge at 12,000 rpm for 15 minutes at 4°C. The solution will separate into three layers: an upper inorganic phase, a middle white DNA layer, and a lower organic phase. Carefully pipette the upper aqueous phase into a new centrifuge tube, add an equal volume of isopropanol, invert to mix, and let stand at room temperature for 20-30 minutes.
[0069] 5) Centrifuge at 12,000 rpm for 10 minutes at 4°C. Discard the supernatant. The RNA precipitate will be visible as a gel attached to the tube wall.
[0070] 6) Add 1 mL of 75% alcohol to the centrifuge tube, invert for 1-2 minutes to wash the precipitate, centrifuge at 12,000 rpm for 5 minutes at 4°C, discard the supernatant, and repeat this process once;
[0071] 7) Leave the tube uncovered for about 10 minutes to allow any residual alcohol to evaporate. When the RNA becomes nearly transparent, add 20 μL of RNase-free ddH2O to fully dissolve the RNA.
[0072] 2. Preparation of cDNA from healthy and mitochondrially damaged Ginkgo vascular cambium:
[0073] Prepare the reverse transcription system according to the reaction system in Table 3 below:
[0074] Table 3 20 μl PCR amplification system
[0075] Total RNA 0.1ng~5μg <![CDATA[Anchored Oligo(dT) 18 Primer(0.5μg / ul)]]> 1 μl 2×TS Reaction Mix 10 μl RI Enzyme Mix 1 μl gDNA Remover 1 μl RNase-free Water Variable Total volume To 20μl
[0076] Mix gently, incubate at 42°C for 15 minutes, and heat at 85°C for 5 seconds.
[0077] 3. Fluorescence quantitative PCR, the specific steps are as follows:
[0078] TB using TaKaRa Premix Ex Taq TM III II (Tli RNaseH Plus) reagent.
[0079] 1) Prepare the PCR reaction mixture according to the following components (prepare the reaction mixture on ice);
[0080] Prepare the reverse transcription system according to the reaction system in Table 4 below:
[0081] Table 4 20 μl PCR amplification system
[0082]
[0083]
[0084] 2) Applied Biosystems TM QuantStudio TM 6. Real-time quantitative PCR instrument;
[0085] Perform fluorescence quantitative PCR reaction according to the reaction conditions in Table 5 below:
[0086] Table 5 Fluorescence quantitative PCR reaction conditions
[0087]
[0088] After the fluorescence quantitative PCR reaction, the results can be obtained Figure 5 It can be seen that the expression level of TAR1 gene in samples with mitochondrial damage was significantly increased compared with healthy Ginkgo samples, indicating that the [TAR1 circle ] is highly correlated with mitochondrial damage in the ginkgo vascular cambium. Because the TAR1 gene is involved in mitochondrial retrograde signal transduction, it further reveals the molecular mechanism of eccDNA participating in plant mitochondrial retrograde signal transduction.
[0089] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.
Claims
1. An extrachromosomal circular DNA associated with mitochondrial damage in the vascular cambium of Ginkgo biloba, characterized in that: The extrachromosomal circular DNA is [TAR1 circle ], the [TAR1 circle ] The nucleotide sequence is shown in SEQ ID NO.
1.
2. The use of the extrachromosomal circular DNA according to claim 1 in assessing the risk of mitochondrial damage in the vascular cambium of Ginkgo biloba, characterized in that: The expression level of the extrachromosomal circular DNA increases in the vascular cambium of Ginkgo biloba with damaged mitochondria.
Citation Information
Patent Citations
Extra-chromosomal circular DNA-mediated engineering of plant traits
US20200283787A1