Two DNA aptamers that specifically recognize Omicron and Delta mutants

Abstract

The present invention discloses two DNA aptamers that specifically recognize the Omicron mutant and the Delta mutant. The nucleotide sequence of the aptamer for specifically recognizing the SARS-CoV-2 Omicron mutant is shown in SEQ ID NO: 1; the nucleotide sequence of the aptamer for specifically recognizing the SARS-CoV-2 Delta mutant is shown in SEQ ID NO: 2. Experiments have shown that compared with commercial kits, the nanoFPI sensor constructed with the above aptamers has a 1000-100000-fold increase in sensitivity in detecting SARS-CoV-2 pseudoviruses, reaching 0.4 TCID 50 / mL; and can specifically identify SARS-CoV-2 Omicron mutants and SARS-CoV-2 Delta mutants. The method provided by the present invention is low-cost, time-efficient, and suitable for both ordinary home use and large-scale application in professional testing centers. The present invention has important application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to two DNA nucleic acid aptamers that specifically recognize Omicron mutants and Delta mutants. Background Art

[0002] With the widespread spread of SARS-CoV-2, many viral mutants have emerged. Among them, the SARS-CoV-2 Omicron, Delta, Beta, and Gamma mutants have been designated by the World Health Organization as variants of concern (VOCs). These mutants are relatively more transmissible and have a certain impact on the effectiveness of specific drugs and vaccines.

[0003] Currently, the mainstream SARS-CoV-2 detection method is quantitative reverse-transcription real-time polymerase chain reaction (qRT-PCR). Although this method is highly sensitive and specific, it still has many shortcomings that limit its large-scale application. For example, this method includes steps such as RNA extraction, reverse transcription of RNA into DNA, and quantitative detection. Each step is not only time-consuming and labor-intensive, but also requires many expensive chemical reagents. At the same time, it has high requirements for the operating environment and personnel skills. Therefore, the detection of SARS-CoV-2 cannot rely solely on fluorescent quantitative methods, but also needs to develop more convenient and rapid methods as a supplement.

[0004] Currently, COVID-19 antigen test strips are available on the market. Compared with fluorescent quantitative testing, COVID-19 antigen test strips are significantly less expensive. They can produce results within 15 minutes and do not rely on the specialized personnel, precision instruments, and laboratory environments required for nucleic acid testing, meeting the needs of large-scale population screening and application in underdeveloped areas. However, because COVID-19 antigen test strips are developed based on antibodies, they have many drawbacks. For example, antibodies are produced by the immune response of mammals, a time-consuming process; antibodies are proteins, which are very easy to denature, have a high molecular weight, and a short shelf life; and properties are difficult to maintain stability between different batches.

[0005] Aptamers, as antibody analogs, possess similar functions but avoid the aforementioned shortcomings. Aptamers are single-stranded nucleotides that bind to their targets with high specificity and affinity. Systemic evolution of ligands by exponential enrichment (SELEX) is an in vitro screening technique developed in the 1990s that efficiently isolates oligonucleotide fragments that specifically bind to a target molecule from a library of random oligonucleotides. After screening, aptamer sequences can be obtained by chemical synthesis. Compared to antibodies, aptamers have a smaller molecular weight, less batch variability, lower immunogenicity, are easier to store, and are amenable to chemical modification. These advantages make aptamers well-suited for use as molecular recognition elements (MREs) in sensors. Currently, no aptamers have been identified that specifically recognize a specific SARS-CoV-2 mutant. Therefore, aptamers cannot yet be used to identify and differentiate between different SARS-CoV-2 mutants. Summary of the Invention

[0006] The purpose of the present invention is to provide nucleic acid aptamers that can identify and distinguish SARS-CoV-2 mutants (such as Omicron mutants and Delta mutants), thereby quickly, conveniently and effectively detecting SARS-CoV-2.

[0007] The present invention first protects a nucleic acid aptamer 1 for specifically identifying the SARS-CoV-2 Omicron mutant and / or a nucleic acid aptamer 1 for specifically identifying the SARS-CoV-2 Delta mutant; the nucleotide sequence of the nucleic acid aptamer 1 for specifically identifying the SARS-CoV-2 Omicron mutant is shown in SEQ ID NO: 1; the nucleotide sequence of the nucleic acid aptamer 1 for specifically identifying the SARS-CoV-2 Delta mutant is shown in SEQ ID NO: 2.

[0008] The present invention also protects a nucleic acid aptamer 2 for specifically identifying the SARS-CoV-2 Omicron mutant and / or a nucleic acid aptamer 2 for specifically identifying the SARS-CoV-2 Delta mutant; the nucleotide sequence of the nucleic acid aptamer 2 for specifically identifying the SARS-CoV-2 Omicron mutant is shown in SEQ ID NO: 1, positions 23 to 62 from the 5' end; the nucleotide sequence of the nucleic acid aptamer 2 for specifically identifying the SARS-CoV-2 Delta mutant is shown in SEQ ID NO: 2, positions 23 to 62 from the 5' end.

[0009] The present invention also protects the use of the nucleic acid aptamer 1 for specifically identifying the SARS-CoV-2 Omicron mutant strain or the nucleic acid aptamer 2 for specifically identifying the SARS-CoV-2 Omicron mutant strain in detecting the Omicron mutant strain.

[0010] The present invention also protects the use of the nucleic acid aptamer 1 for specifically identifying the SARS-CoV-2 Omicron mutant strain or the nucleic acid aptamer 2 for specifically identifying the SARS-CoV-2 Omicron mutant strain in the preparation of a kit for detecting the Omicron mutant strain.

[0011] The present invention also protects the use of the nucleic acid aptamer 1 for specifically identifying the SARS-CoV-2 Delta mutant strain or the nucleic acid aptamer 2 for specifically identifying the SARS-CoV-2 Delta mutant strain in detecting the Delta mutant strain.

[0012] The present invention also protects the use of the nucleic acid aptamer 1 for specifically identifying the SARS-CoV-2 Delta mutant strain or the nucleic acid aptamer 2 for specifically identifying the SARS-CoV-2 Delta mutant strain in the preparation of a kit for detecting the Delta mutant strain.

[0013] In the above, the nucleotide sequence shown at positions 1 to 22 from the 5' end of SEQ ID NO:1, the nucleotide sequence shown at positions 1 to 22 from the 5' end of SEQ ID NO:2, the nucleotide sequence shown at positions 63 to 84 from the 5' end of SEQ ID NO:1, and the nucleotide sequence shown at positions 63 to 84 from the 5' end of SEQ ID NO:2 are all PCR amplification product binding regions.

[0014] This application conducted two exponentially enriched ligand systemic evolution (SELEX) screenings, which used different negative screening and positive screening, respectively. The RBDs of the earlier novel coronavirus strains were used for negative screening, and nucleic acid aptamers that can specifically identify the RBDs of the SARS-CoV-2 Omicron mutant and the SARS-CoV-2 Delta mutant were obtained. In order to verify their practicality, the applicant tested them using three different methods, among which the best performing one was the nanoFPI (nanostructured Fabry-Perot interference) sensor platform. Compared with commercial test kits, the nanoFPI sensor constructed with the above-mentioned nucleic acid aptamer has increased the sensitivity of detecting SARS-CoV-2 pseudovirus by 1000-100000 times, reaching 0.4TCID 50 / mL (50% tissue culture infectious dose); and can specifically identify the SARS-CoV-2 Omicron mutant and the SARS-CoV-2 Delta mutant. When using the above-mentioned sensor for measurement, the sample is first incubated with the nanochip immobilized with nucleic acid aptamers for 15 minutes, and then measured using a portable spectrometer. The measurement takes less than 1 minute. This shows that the method is low-cost and time-saving, suitable for both ordinary household use and large-scale application in professional testing centers. The present invention has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The figure shows the SELEX screening process using an 84mer ssDNA library containing 40 random sequences.

[0016] Figure 2 For three libraries (6th, 8th, 10th) and RBD Omicron The dissociation constant (K d )’s test results.

[0017] Figure 3 Frequencies of the top five sequences for both filters.

[0018] Figure 4 Determination of the dissociation constants of OMapta1 and DEapta1.

[0019] Figure 5 The platform construction and detection results of LFA based on OMapta1.

[0020] Figure 6Schematic diagram of enzyme-linked immunosorbent assay based on OMapta1.

[0021] Figure 7 The results are from the ELISA assay based on OMapta1.

[0022] Figure 8 Preparation of OMapta1 nanosensor and DEapta1 nanosensor.

[0023] Figure 9 Results of detecting Omicron mutants and Delta mutants using optical nanosensors based on OMapta1 and DEapta1. DETAILED DESCRIPTION

[0024] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0025] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0026] Example

[0027] 1. Experimental Methods

[0028] 1. Preparation of recombinant protein RBDs (RBDs)

[0029] (1) Insert the coding RBD into the multiple cloning site of pcDNA3.1 vector WT 、RBD Alpha 、RBD Beta 、RBD Gamma 、RBD Kappa or RBD Delta The nucleotide sequence of the gene (residue 319-541) was cloned to obtain the recombinant plasmid.

[0030] The recombinant plasmid encodes the recombinant protein RBDs. Each recombinant protein has an IL2 signal peptide at the N-terminus and RBDs (RBD WT 、RBD Alpha 、RBD Beta 、RBD Gamma 、RBD Kappa or RBD Delta ), and an 8×His tag at the C-terminus.

[0031] (2) The recombinant plasmid constructed in step (1) was transfected into HEK293F cells using the polyethyleneimine method (the concentration during transfection was 1-1.5×10 6 cells / mL), and the cells were collected after culturing for 4 days. The protein was then purified using a Ni-NTA affinity column (GE Life Sciences) and a Superdex 200 column (GE Life Sciences). The recombinant protein RBDs were finally dissolved in the final buffer (solute and concentration were 150 mM NaCl and 20 mM HEPES, the solvent was water, and the pH was 7.2).

[0032] 2. Recombinant protein spike omicron (referred to as spike omicron )

[0033] (1) Several amino acid substitutions were made in the amino acid sequence of the spike protein of the Omicron mutant (residue 1-1208) to obtain the spike protein. omicron ; Including 1) To make the protein more stable, the amino acids at 6 positions were replaced with proline (F817P, A892P, A899P, A942P, K986P and V987P respectively); 2) The amino acids at positions 682-685 (residue 682-685) are an enzyme cleavage site, and the amino acids there were replaced from 'RRAR' to 'GSAS' (Reference: Du, S., et al., Structurally Resolved SARS-CoV-2 Antibody Shows High Efficacy in Severely Infected Hamsters and Provides a Potent Cocktail Pairing Strategy. Cell, 2020.183(4): p.1013-1023e13.).

[0034] (2) Insert the spike-encoding protein into the multiple cloning site of the pcDNA3.1 vector omicron nucleotide sequence to obtain a recombinant plasmid.

[0035] Recombinant plasmid encoding recombinant protein spike omicron Recombinant protein spike omicron The N-terminus is the IL2 signal peptide, and the middle is the spike omicron , the C-terminus is an 8×His tag.

[0036] (3) The recombinant plasmid constructed in step (2) was transfected into HEK293F cells (the concentration during transfection was 1×10 6 cells / mL), and the cells were collected after culturing for 4 days. The protein was then purified using Ni-NTA resin (GE Life Sciences) and Superdex 6increase 10 / 300 column (GE Life Sciences). The recombinant protein spike omicron Dissolve in final buffer.

[0037] 3. SELEX screening of DNA aptamers that specifically recognize SARS-CoV-2 mutant RBD

[0038] The binding of SARS-CoV-2's RBD to human angiotensin-converting enzyme 2 (ACE2) mediates its entry into target cells. Mutations in SARS-CoV-2's RBD increase the efficiency of the interaction between RBD and ACE2, which may be related to the more efficient spread of the virus. Many of the hallmark mutations of emerging strains occur on the RBD, which can become ideal binding sites for aptamer specific recognition. In order to obtain nucleic acid aptamers that can specifically recognize SARS-CoV-2, the inventors of the present invention synthesized an 84mer ssDNA library containing 40 random sequences (see Figure 1 (b)), and this library was used for SELEX screening (see Figure 1 For convenience, the RBD from SARS-CoV-2X strain is labeled as RBD X , spike is marked as spike X Recombinant protein RBD Omicron As a target for SELEX screening, it is first fixed to the magnetic beads through the His tag at the C-terminus, and then incubated with the ssDNA library to bind to the RBD. Omicron The bound sequences will be captured by the aggregation of magnetic beads, while those unbound sequences will be removed. The captured ssDNA is eluted at high temperature and further amplified by PCR. The reverse primer used for amplification is modified with biotin, so the PCR products obtained are modified with biotin. These PCR products are then fixed to streptavidin magnetic beads, and the forward sequences can be separated by NaOH treatment. The released forward sequences are then precipitated and purified using ethanol, which will be used as the library for the next round of screening. Starting from the fifth round of screening, the library is first followed by RBD. WT 、RBD Alpha 、RBD Beta 、RBD Gamma 、RBDKappa and RBD Delta Incubate to perform negative screening, separating sequences that cannot bind to the six to bind to RBD Omicron Incubate to ensure the specificity of the selected aptamers. The above screening can screen out aptamers that can specifically bind to RBD. Omicron aptamers,

[0039] In order to screen for proteins that can specifically bind to RBD Delta The inventors of the present invention also conducted a parallel screening. Delta As a target, RBD WT 、RBD Alpha 、RBD Beta 、RBD Gamma 、RBD Kappa and RBD Omicron It is used for negative screening, and the other operating steps remain unchanged.

[0040] The specific steps are as follows:

[0041] (1) Take a centrifuge tube, add 20 μL of His-Tag Isolation and Pulldown magnetic beads, and then wash once with 500 μL SELEX buffer (solute and concentration are 2.5 mM MgCl2 and 0.02% Tween 20, solvent is (pH 7.4 PBS buffer)). Then, resuspend with 500 μL SELEX buffer and add recombinant protein RBDs, incubate at room temperature for 5 minutes; finally, wash four times with 500 μL SELEX buffer to obtain fixed recombinant protein RBDs.

[0042] (2) After completing step (1), the ssDNA library was first heated at 95°C for 5 minutes, then placed on ice for 2 minutes, and then mixed with the immobilized recombinant protein RBDs obtained in step (1) and incubated at room temperature for 1 hour.

[0043] (3) After completing step (2), wash four times with 500 μL SELEX buffer, resuspend in 100 μL ddH2O, heat at 95°C for 5 minutes, place on a magnetic stand, and collect the supernatant after 2 minutes. The supernatant contains ssDNA that can bind to the recombinant protein RBDs.

[0044] (4) A series of preliminary PCRs were performed using the supernatant collected in step (3) as a template. In this series of cycles, the cycle number that produced the most target product but did not produce other byproducts was determined as the optimal cycle number (the optimal cycle number needed to be re-determined for each round of screening). Large-scale PCR (wherein the reverse primer had a 5'biotin modification) was performed using the determined optimal cycle number to obtain dsDNA products. The dsDNA products were first purified and concentrated using an Amicon Ultra-2mL centrifugal filter with 10KDamembrane (UFC201024), then immobilized on magnetic beads (Dynabeads MyOneStreptavidinC1) via 5'biotin (incubated at room temperature for 2 hours), then washed three times with PBS buffer, and finally eluted with 100μL of 150mM NaOH aqueous solution for 10 minutes. The eluted ssDNA was neutralized with 50μL of 300mM HCl, then concentrated and purified with ethanol, and the resulting ssDNA library was put into the next round of screening.

[0045] Starting from the fifth round, negative screening was performed before positive screening. The recombinant protein RBDs were first immobilized on magnetic beads, and the ssDNA library was first incubated with the negatively screened recombinant protein RBDs. The supernatant was collected and then incubated with the positive recombinant protein RBDs.

[0046] The forward elution products from the 6th, 8th, and 10th rounds were amplified by PCR, purified, and sent to Novogene for sequencing.

[0047] In the above steps, the nucleotide sequences of the starting ssDNA library and the primers used for PCR amplification are shown in Table 1.

[0048] Table 1

[0049]

[0050]

[0051] 4. Generation of Fluorescently Labeled ssDNA Libraries

[0052] Forward elution products from rounds 6, 8, and 10 were PCR amplified using a forward primer with a 5' FAM modification and a reverse primer with a 5' biotin modification. Subsequent steps were the same as for generating ssDNA libraries in SELEX screening.

[0053] 5. Dissociation constant (K d )

[0054] The dissociation constants of the fluorescently labeled ssDNA library and nucleic acid aptamers in the 6th, 8th, or 10th rounds were determined using a saturation binding assay. The specific steps are as follows:

[0055] (1) The fluorescently labeled ssDNA library or nucleic acid aptamer from the 6th, 8th, or 10th round was first heated at 95°C for 5 minutes, then placed on ice for 2 minutes, and then gradually diluted in multiples within the range of 0-400 nM (400, 200, 100, 50, 25, 12.5, 6.25, 3.125, or 0 nM) and incubated with a certain amount of target (1.1 μg) immobilized on magnetic beads on a rotary shaker at room temperature for 1 hour.

[0056] (2) After completing step (1), wash three times (to remove fragments that cannot bind to the target), resuspend the fragments that can bind to the target with 100 μL of elution buffer, then heat at 95°C for 10 minutes, place on a magnetic stand for 2 minutes, and collect the supernatant.

[0057] (3) After completing step (2), the fluorescence intensity of the supernatant collected in step (2) was measured. The fluorescence intensity was read using a TecanSpark plate reader with the excitation wavelength set to 485±20 nm and the emission wavelength set to 535±25 nm. The model Y=Bmax×X / (K d +X) to derive K d .

[0058] 6. Preparation of Gold Label Immunochromatographic Test Strips

[0059] (1) The aptamer OMapta1 was immobilized on colloidal gold using the method described in references (Yeom, JH, et al., Inhibition of Xenograft tumor growth by gold nanoparticle-DNA oligonucleotide conjugates-assisted delivery of BAXmRNA. PLoS One, 2013. 8(9): p.e75369. Zhang, X., M.R. Servos, and J. Liu, Instantaneous and quantitative functionalization of gold nanoparticles with thiolated DNA using a pH-assisted and surfactant-free route. J Am Chem Soc, 2012. 134(17): p.7266-9.). Briefly, the thiol-modified OMapta1 was treated with 50 mM dithiothreitol (DTT) at room temperature for 20 minutes, then extracted three times with ethyl acetate (to remove DTT and thiol groups), and the extracted aptamer was purified and concentrated with ethanol. The treated aptamers were then mixed with colloidal gold, and 0.5 M citrate buffer (pH 3.0) was added to a final concentration of 10 mM. The mixture was allowed to stand at room temperature for 5 minutes and centrifuged at 1400 g for 30 minutes to collect the precipitate. The precipitate was resuspended in ultrapure water and centrifuged again. The precipitate was collected and resuspended in a resuspension solution (solutes and concentrations: 10% sucrose, 1% BSA, 0.1% PEG 20000, 0.5% Tween 20, and 0.1% NaN3, in water) and then applied to a glass fiber gold pad (RB45, Whatman) using a pipette and dried at 50°C for 2 hours. A sample pad (SB08, Whatman) was then saturated with a buffer solution (solutes and concentrations: 5% sucrose, 1% BSA, 0.05% Tween 20, and 0.1% NaN3, in water) and dried in a drying oven for 2 hours.

[0060] (2) Use a pipette to apply SARS-CoV-2 Spike Neutralizing Antibody (SinoBiological, 40591-MM45) to a nitrocellulose membrane (Sartorius, CN140 backed) as a test line. Take 20pM of a biotin-labeled nucleic acid probe (CS-Bio) that can complement the 5' end of OMapta1 and mix it with 60pM streptavidin (HARVEYBIO, MA100809), let it stand at room temperature for 1 hour, and obtain a probe labeled with streptavidin. Use a pipette to apply the probe labeled with streptavidin next to the test line as a control line. Then, place the nitrocellulose membrane in a 50°C oven to dry for 2 hours. Finally, stick the treated sample pad, gold pad, and absorbent paper (Shanghai Kinbio Tech, CH37M) to the nitrocellulose membrane, with adjacent parts overlapping by 2 mm (to ensure that the sample can flow through the entire device), to obtain a gold-labeled immunochromatographic test strip.

[0061] 7. Aptamer-based enzyme-linked immunosorbent assay (ELISA)

[0062] (1) Take a high-binding 96-well plate (Corning, Cat. No. 9018) and add 100 μL of recombinant protein spike to each well. omicron solution (concentrations of 20,000, 10,000, 5,000, 2,500, 1,250, 625, 312.5, 156.25, or 0 ng / mL) and coated overnight at 4°C.

[0063] (2) After completing step (1), wash three times with PBS buffer, then block with 2% (v / v) BSA aqueous solution at 37°C for 1 hour, then aspirate the BSA aqueous solution and wash three times with SELEX buffe.

[0064] (3) After completing step (2), 50 μL of biotin-modified OMapta1 (concentration 0.4 μM) was added to each well, incubated at room temperature for 1 hour, and washed three times with SELEX buffer. Then, 50 μL of streptavidin-labeled horseradish peroxidase (HRP) (Cell Signaling Technology, Cat. No. 3999; 1:3000) was added to each well and allowed to interact with the biotin-modified aptamer at room temperature for 50 minutes.

[0065] (4) After completing step (3), wash the sample five times with SELEX buffer and add the substrate o-phenylenediamine dihydrochloride (OPD). After 5 minutes, add 2M concentrated sulfuric acid to terminate the reaction. Measure the OD value at 450 nm using a TecanSpark microplate reader.

[0066] 8. Production and titration of pseudoviruses

[0067] Pseudoviruses were produced and titrated according to the method in reference (Nie, J., et al., Establishment and validation of a pseudovirusneutralization assay for SARS-CoV-2. Emerg Microbes Infect, 2020.9(1): p.680-686. Nie, J., et al., Development of in vitro and in vivo rabies virusneutralization assays based on a high-titer pseudovirus system. Sci Rep, 2017.7: p.42769.).

[0068] 9. Measuring pseudoviruses using a nanostructured Fabry–Pérot interferometer (nanoFPI)

[0069] The nanoFPI sensor chip was manufactured and the nucleic acid aptamer was fixed to the sensor chip according to the method in reference (Chen, C., et al., Development of a structure-switching aptamer-based nanosensor for salicylic acid detection. Biosens Bioelectron, 2019.140: p.111342.7. Feng, S., et al., An aptamer nanopore-enabled microsensor for detection of theophylline. Biosens Bioelectron, 2018.105: p.36-41.).

[0070] To prepare the saliva-spiked SELEX buffer, first wipe the back of the throat five times with a cotton swab. Then, insert the swab into 2 mL of SELEX buffer and stir 10 times. Use the cotton swab to squeeze the side of the tube to squeeze out as much liquid as possible and remove it. Use the saliva-spiked SELEX buffer to dilute the pseudovirus to the desired concentration. Apply 100 μL of pseudovirus to the chip using a pipette and incubate on a shaker for 15 minutes. After washing three times, the transduction signal is collected using a spectrometer and compared to the signal before sample addition to determine the signal offset. At least three replicates are performed for each sample.

[0071] 2. Experimental Conclusion

[0072] 1. DNA aptamers that can specifically recognize Omicron mutant RBD and Delta mutant RBD

[0073] A total of ten rounds of screening were performed, with the screening pressure gradually increasing. The input amount of DNA library was reduced from 3 nmol to 0.2 nmol, and the incubation time with positive targets was reduced from 60 min to 30 min. The incubation time of negative screening was increased from 30 min to 60 min, and the input amount of positive targets was reduced from 5 μg to 1 μg.

[0074] In each round of screening, sequences that do not bind to the target or bind very weakly will be eliminated, while fragments with high affinity will be retained and successfully enter the next round of screening. Therefore, as the selection proceeds, the affinity of the library to the target will gradually increase. In order to monitor the smooth progress of the screening, the first screening (RBD Omicron ) were fluorescently labeled and their interactions with RBD were detected. Omicron The dissociation constant (K d ). Test results are shown in Figure 2 The results showed that as the screening progressed, the K d Gradually decreases, indicating that the screening is going smoothly.

[0075] The initial library was designed with adapter sequences compatible with the sequencing platform at both ends (see Figure 1 In (b), the libraries from rounds 6, 8, and 10 were amplified and sequenced using the Illumina Novaseq-PE150 sequencing platform. The frequencies of the top five sequences from the two screens are shown in Figure 3 By RBD Omicron The most enriched sequence was named OMapta1, which accounted for 47% of the entire library in the tenth round, and was enriched 312 times compared with the sixth round. DeltaThe most enriched sequence was named DEapta1, which was greatly enriched after six rounds of screening, accounting for 21.3% of the library in the sixth round and reaching 69.5% of the library in the tenth round.

[0076] The aptamer that was finally screened and could specifically bind to the Omicron mutant strain was OMapta1:

[0077] CTACACGACGCTCTTCCGATCT TTCACCCCCTAGTAGCTTGTTCGCGCAGTCTTGAACCCTG AGATCG GAAGAGCACACGTCTG (SEQ ID NO: 1), the aptamer that can specifically bind to the Delta mutant is DEapta1:

[0078] CTACACGACGCTCTTCCGATCT TAAGACCGCAATAAAATCCGGAACTGACGGGTAGGACCTT AGATCG GAAGAGCACACGTCTG (SEQ ID NO: 2), the underline indicates the PCR amplification product binding region.

[0079] 2. Determination of the dissociation constants of OMapta1 and DEapta1

[0080] In order to measure the dissociation constants of OMapta1 and DEapta1, the inventors of the present invention first synthesized 5'-end fluorescein (FAM)-labeled OMapta1 and DEapta1, named OMapta1-FAM and DEapta1-FAM, respectively. A series of different concentrations of OMapta1-FAM or DEapta1-FAM were respectively combined with a fixed concentration of RBD. Omicron or RBD Delta Combined, the fluorescence intensity signal of the eluted sequence was measured, and then nonlinear fitting was performed using the “Onesite-Total” method.

[0081] The results showed that the adjusted R 2 More than 0.9979, K d 8.972nM (see Figure 4 Middle (a); DEapta1 and RBD Delta K d is 33.8 nM, and the adjusted R 2 is 0.9988 (see Figure 4 (b)).

[0082] To test its binding specificity, a series of different concentrations of FAM-OMapta1 were combined with a fixed concentration of RBD. WT、RBD Alpha 、RBD Beta 、RBD Gamma 、RBD Kappa 、RBD Delta and RBD Omicron A series of different concentrations of FAM-DEapta1 and a fixed concentration of RBD were used for the reaction. WT 、RBD Alpha 、RBD Beta 、RBD Gamma 、RBD Kappa 、RBD Delta and RBD Omicron reaction.

[0083] The results showed that OMapta1 could not bind to RBD WT 、RBD Alpha 、RBD Beta 、RBD Gamma 、RBD Kappa and RBD Delta Effective fitting, that is, OMapta1 can specifically bind to RBD Omicron DEapta1 cannot bind to RBD WT 、RBD Alpha 、RBD Beta 、RBD Gamma 、RBD Kappa and RBD Omicron Effective fit, that is, DEapta1 specifically binds to RBD Delta And strong affinity.

[0084] 3. Build LFA based on OMapta1

[0085] In order to test whether the nucleic acid aptamer OMapta1 can detect the Omicron mutant, the inventors of the present invention used OMapta1 and SARS-CoV-2 Spike Neutralizing Antibody (SinoBiological, 40591-MM45) to build a lateral flow assay (LFA) platform (see Figure 5 The results showed that 5 μg / mL of RBD Omicron The detection line of the above kit was clearly visible, while only a very weak band appeared when the above kit was used (see Figure 5 (b)); while 5 μg / mL RBD Omicron The detection line showed no bands. This indicates that the aptamer OMapta1 has good specificity for the Omicron mutant.

[0086] 4. Construction of OMapta1-based ELISA

[0087] The spike protein of SARS-CoV-2 is a homotrimeric complex composed of three monomers, and the RBD is located on the top of the spike protein. OMapta1 was screened for RBD, so OMapta1 can also bind to the spike trimer. Based on this, the inventors of the present invention constructed an enzyme-linked immunosorbent assay (ELISA) based on OMapta1 (see Figure 6 First, spike proteins at varying concentrations (0.37-47.36 nM) were immobilized on a 96-well plate. The plates were then incubated with a fixed concentration of biotin-OMapta1 to remove unbound OMapta1. Streptavidin-modified HRP was then introduced to capture OMapta1. Finally, substrate (OPD) was added for color development, and the absorbance at 450 nm was measured.

[0088] The concentration of spike protein is plotted as the horizontal axis, and the corresponding absorbance at 450 nm is plotted as the vertical axis to fit a linear standard curve. Figure 7 , adjusted R 2 The results showed that OMapta1 can be used to develop ELISA kits for detecting Omicron mutants.

[0089] 5. Construction of optical nanosensors based on OMapta1 and DEapta1 to detect and differentiate between Omicron and Delta mutants

[0090] (1) In order to develop sensors with higher affinity, the inventors of the present invention integrated OMapta1 and DEapta1 into the developed nanoFPI sensor platform (Chen, C., et al., Development of a structure-switching aptamer-based nanosensor for salicylic acid detection. Biosens Bioelectron, 2019.140: p.111342. Feng, S., et al., An aptamernanopore-enabled microsensor for detection of theophylline. Biosens Bioelectron, 2018.105: p.36-41.), respectively, to obtain OMapta1 nanosensor and DEapta1 nanosensor (see Figure 8 ).

[0091] (2) Similar to the labeling method of RBD, the pseudovirus constructed from the spike of SARS-CoV-2X strain is labeled as pseudovirus X Different pseudoviruses were diluted to certain concentrations by SELEX buffer spiked with human saliva and then detected using the OMapta1 nanosensor.

[0092] Test results are shown in Figure 9 (a). The results showed that pseudovirus Omicron BA.1 and pseudovirus Omicron BA.2 Both can be used at 0.4TCID 50 A significant signal was generated at a concentration of 1 TCID / mL, and the signal increased with the increase of pseudovirus concentration. 50 / mL of pseudovirus is approximately equivalent to 1000 viruses / ml (Lelie, N., et al., Analytical sensitivity and effectiveness of different SARS-CoV-2 testing options.medRxiv, 2021: p.2021.11.26.21265946.), which shows that the OMapta1 nanosensor is 1000-100000 times more sensitive than commercially available antigen detection kits.

[0093] (3) In order to test the specificity of OMapta1 nanosensor, pseudovirus was also detected using OMapta1 nanosensor. WT 、pseudovirus Alpha 、pseudovirus Beta 、pseudovirus Gamma 、pseudovirus Kappa and pseudovirus Delta Although the total number of pseudoviruses in the mixture is Omicron 6 times of that of the mixture, but the mixture was 50 / mL and 40TCID 50 / mL) cannot trigger effective signal intensity (signals <1nm are generally invalid).

[0094] (4) Following the above step (2), the OMapta1 nanosensor was replaced with the DEapta1 nanosensor, and the other steps remained unchanged.

[0095] Test results are shown in Figure 9 (b). The results showed that pseudovirus DeltaCan be 0.4TCID 50 / mL、4TCID 50 / mL or 40TCID 50 The DEapta1 nanosensor produced a significant signal at a concentration of 1000 / mL, and the signal increased with increasing pseudovirus concentration. The DEapta1 nanosensor is 1,000-100,000 times more sensitive than commercially available antigen detection kits.

[0096] (5) To test the specificity of the DEapta1 nanosensor, the DEapta1 nanosensor was also used to detect pseudovirus. WT 、pseudovirus Alpha 、pseudovirus Beta 、pseudovirus Gamma 、pseudovirus Kappa 、pseudovirus OmicronBA.1 and pseudovirus OmicronBA.2 Although the total number of pseudoviruses in the mixture is Omicron 7 times, but the mixture was 50 / mL、4TCID 50 / mL and 40TCID 50 / mL) cannot trigger effective signal intensity (signals <1nm are generally invalid).

[0097] The above results indicate that the combination of OMapta1 nanosensor and DEapta1 nanosensor can fully detect and distinguish Omicron mutants and Delta mutants.

[0098] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Nucleic acid aptamer 1 for specific recognition of SARS-CoV-2 Omicron mutant and / or nucleic acid aptamer 1 for specific recognition of SARS-CoV-2 Delta mutant; The nucleotide sequence of the nucleic acid aptamer 1 for specifically recognizing the SARS-CoV-2 Omicron mutant is shown in SEQ ID NO: 1; The nucleotide sequence of the nucleic acid aptamer 1 for specifically identifying the SARS-CoV-2 Delta mutant strain is shown in SEQ ID NO:

2.

2. Nucleic acid aptamer 2 for specific recognition of the SARS-CoV-2 Omicron mutant and / or nucleic acid aptamer 2 for specific recognition of the SARS-CoV-2 Delta mutant; The nucleotide sequence of the nucleic acid aptamer 2 for specifically recognizing the SARS-CoV-2 Omicron mutant is shown in SEQ ID NO: 1 from position 23 to position 62 from the 5' end; The nucleotide sequence of the nucleic acid aptamer 2 for specifically identifying the SARS-CoV-2 Delta mutant strain is shown in SEQ ID NO: 2 from positions 23 to 62 from the 5' end.

3. Use of the nucleic acid aptamer 1 for specifically identifying the SARS-CoV-2 Omicron mutant strain described in claim 1 or the nucleic acid aptamer 2 for specifically identifying the SARS-CoV-2 Omicron mutant strain described in claim 2 in the preparation of a kit for detecting the Omicron mutant strain.

4. Use of the nucleic acid aptamer 1 for specifically identifying the SARS-CoV-2 Delta mutant strain described in claim 1 or the nucleic acid aptamer 2 for specifically identifying the SARS-CoV-2 Delta mutant strain described in claim 2 in the preparation of a kit for detecting the Delta mutant strain.

Images