Monoterpene synthase, genetic engineering strain and its application

Abstract

The invention discloses a eucalyptol synthase gene, a recombinant saccharomyces cerevisiae, and a construction method and application thereof. The construction method of the recombinant saccharomyces cerevisiae comprises: introducing a gene encoding a monoterpene synthase whose amino acid sequence is shown in SEQ ID No. 10, 11, 12 or 13 into saccharomyces cerevisiae to obtain a recombinant saccharomyces cerevisiae producing eucalyptol. The invention provides a powerful strain and a research basis for the biosynthesis of monoterpenes, and has important significance for the excavation of highly active monoterpene synthases.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to monoterpene synthase, genetic engineering strains and applications thereof. Background Art

[0002] Monoterpenoids are terpenes and their derivatives that contain two isoprene units in the molecule. According to their structure, they are classified into acyclic monoterpenes, monocyclic monoterpenes, and polycyclic monoterpenes. Cineole (1,8-cineol) is a monoterpene oxide and the main component of eucalyptus essential oil. It has attracted widespread attention due to its medicinal value and its huge application potential in food, cosmetics, and energy industries.

[0003] At present, monoterpenoids are mainly obtained by extraction from natural plants or chemical synthesis, but these methods have low yields and are highly dependent on the availability of raw materials. At the same time, the waste generated is complex in composition, polluting the environment and bringing difficulties to subsequent treatment. With the development of synthetic biology technology and metabolic engineering, microorganisms have been transformed to become cell factories for the synthesis of high-value-added chemicals, opening up a new way for green and clean production for the synthesis of terpenoids.

[0004] Monoterpene synthase is one of the key factors affecting the biosynthesis of terpenoids. The low catalytic activity of the monoterpene synthases currently discovered limits the application of monoterpene microbial synthesis (Leferink NGH, Jervis AJ, Zebec Z, ToogoodHS, Hay S, Takano E, Scrutton NS. A 'Plug and Play' Platform for theProduction of Diverse Monoterpene Hydrocarbon Scaffolds in Escherichia coli.ChemistrySelect. 2016 Jun 21;1(9):1893-1896. doi: 10.1002 / slct.201600563.PMID: 29756025; PMCID: PMC5947754.; Lei D, Qiu Z, Qiao J, Zhao GR. Plasticity engineering of plant monoterpene synthases and application for microbialproduction of monoterpenoids. Biotechnol Biofuels. 2021 Jun 30;14(1):147.doi: 10.1186 / s13068-021-01998-8. PMID: 34193244; PMCID: PMC8247113.).

[0005] Therefore, the discovery and acquisition of excellent monoterpene synthases will be of great significance to the advancement of monoterpene biosynthesis. Summary of the invention

[0006] The invention provides monoterpene synthase and application of the enzyme in producing eucalyptol.

[0007] One object of the present invention is to provide a monoterpene synthase.

[0008] The first aspect of the present invention relates to a monoterpene synthase comprising an amino acid sequence selected from the group consisting of:

[0009] a) SEQ ID NO: 10 to SEQ ID NO: 13;

[0010] b) has at least 70% identity, preferably at least 80% identity, at least 90% identity, at least 95% identity, more preferably at least 99% identity with the sequence shown in a), and still has the function.

[0011] The present invention also provides a nucleic acid encoding the monoterpene synthase.

[0012] The present invention also provides a genetically engineered bacterium expressing the monoterpene synthase, which comprises a nucleic acid encoding the monoterpene synthase.

[0013] According to an embodiment of the present invention, the genetically engineered bacteria is a recombinant strain obtained by constructing an expression frame of the nucleic acid and then introducing it into a host bacterium.

[0014] One object of the present invention is to provide a method for constructing a recombinant Saccharomyces cerevisiae that produces monoterpene substances.

[0015] The invention provides a method for constructing a recombinant yeast for producing monoterpene substances, comprising: introducing a monoterpene synthase gene into the yeast to obtain the recombinant yeast for producing monoterpene.

[0016] For example, the Saccharomyces cerevisiae is a Saccharomyces cerevisiae that can accumulate geranyl diphosphate (GPP), a precursor for monoterpene synthesis.

[0017] Optionally, according to the above construction method, the amino acid sequence of the monoterpene synthase encoded by the monoterpene synthase gene is shown in SEQ ID No. 10, 11, 12, 13. Optionally, according to the above construction method, the saccharomyces cerevisiae is to increase the content and / or activity of farnesyl pyrophosphate synthase ERG20, 3-hydroxy-3-methylglutaryl coenzyme A tHMG1, acetyl coenzyme A acyltransferase mvaE, HMG-CoA synthetase mvaS-m, isopentenyl pyrophosphate isomerase IDI1, mevalonate kinase ERG12, MVAP kinase ERG8 and / or MVAPP decarboxylase ERG19 in the starting saccharomyces cerevisiae. For example, increasing the content and / or activity of the enzyme is achieved by increasing the copy number of the corresponding enzyme gene of the starting saccharomyces cerevisiae.

[0018] Optionally, the starting brewer's yeast is TIB H1 (Chinese patent 202110934151.4), and its deposit number at the General Microbiological Center of China National Microbiological Culture Collection Administration is CGMCC No.21000.

[0019] Optionally, according to the above construction method, the starting Saccharomyces cerevisiae is further modified by at least one of the following modifications to obtain the Saccharomyces cerevisiae: A1, introduction of double point mutation gene ERG20 at positions 96 and 127 of farnesyl pyrophosphate synthase gene F96W / N127W gene; A2, introduction of tHMG1 gene; A3, introduction of mvaE gene; A4, introduction of mvaS-m gene; A5, introduction of IDI1 gene; A6, introduction of ERG12 gene; A7, introduction of ERG8 gene; A8, introduction of ERG19 gene.

[0020] Optionally, the ERG20 F96W / N127W Gene encoding ERG20 F96W / N127W The sequence of the protein is shown in SEQ ID No. 14; and / or, the sequence of the tHMG1 protein encoded by the tHMG1 gene is shown in Genbank accession number: AJS96703.1, sequence 530-1054; and / or, the sequence of the mvaE protein encoded by the mvaE gene is shown in Genbank accession number AAG02439.1; and / or, the sequence of the mvaS-m protein encoded by the mvaS-m gene is shown in Genbank accession number AAG02438.1, in which alanine at position 110 is replaced by glycine; and / or, the IDI1 gene encodes The sequence of the IDI1 protein encoded by the ERG12 gene is shown in the Genbank accession number: NP_015208.1 sequence; and / or, the sequence of the ERG12 protein encoded by the ERG12 gene is shown in the Genbank accession number: NP_013935.1 sequence; and / or, the sequence of the ERG8 protein encoded by the ERG8 gene is shown in the Genbank accession number: NP_013947.1 sequence; and / or, the sequence of the ERG19 protein encoded by the ERG19 gene is shown in the Genbank accession number: NP_014441.1 sequence.

[0021] Optionally, the ERG20 F96W / N127W The gene sequence is shown in SEQ ID No.1, positions 722-1780; and / or, the tHMG1 gene sequence is shown in SEQ ID No.2, positions 800-2383; and / or, the mvaE gene sequence is shown in the reverse complement of SEQ ID No.3, positions 270-2681; and / or, the mvaS-m gene sequence is shown in SEQ ID No.3, positions 3358-4509; and / or, the IDI1 gene sequence is shown in the reverse complement of SEQ ID No.4, positions 270-1136; and / or, the ERG12 gene sequence is shown in SEQ ID No.4, positions 1813-3144; and / or, the ERG8 gene sequence is shown in the reverse complement of SEQ ID No.5, positions 333-1688; and / or, the ERG19 gene sequence is shown in SEQ ID No.5, positions 2365-3555.

[0022] Optionally, according to the above construction method, the monoterpene synthase gene is introduced into the starting Saccharomyces cerevisiae by introducing a monoterpene synthase gene expression cassette into the starting Saccharomyces cerevisiae; and / or A1 is introduced into the starting Saccharomyces cerevisiae by introducing ERG20 F96W / N127Wand / or, A2 is achieved by introducing a tHMG1 gene expression cassette into the starting Saccharomyces cerevisiae; and / or, A3 is achieved by introducing an mvaE gene expression cassette into the starting Saccharomyces cerevisiae; and / or, A4 is achieved by introducing an mvaS-m gene expression cassette into the starting Saccharomyces cerevisiae; and / or, A5 is achieved by introducing an IDI1 gene expression cassette into the starting Saccharomyces cerevisiae; and / or, A6 is achieved by introducing an ERG12 gene expression cassette into the starting Saccharomyces cerevisiae; and / or, A7 is achieved by introducing an ERG8 gene expression cassette into the starting Saccharomyces cerevisiae; and / or, A8 is achieved by introducing an ERG19 gene expression cassette into the starting Saccharomyces cerevisiae.

[0023] Optionally, according to the above construction method, the monoterpene synthase gene expression cassette includes a promoter, the monoterpene synthase gene and a terminator, the promoter is Gal2; the terminator is CYC1. For example, the sequence of the monoterpene synthase gene expression cassette is shown in positions 72-2159 of SEQ ID No.6, positions 72-2117 of SEQ ID No.7, positions 72-2117 of SEQ ID No.8, and positions 72-2129 of SEQ ID No.9.

[0024] Optionally, according to the above construction method, the ERG20 F96W / N127W The gene expression cassette sequence is shown in SEQ ID No.1, positions 54-2141; and / or, the tHMG1 gene expression cassette sequence is shown in SEQ ID No.2, positions 75-2769; and / or, the mvaE gene expression cassette sequence is shown in the reverse complement of SEQ ID No.3, positions 78-3357; and / or, the mvaS-m gene expression cassette sequence is shown in SEQ ID No.3, positions 2682-4728; and / or, the IDI1 gene expression cassette sequence is shown in the reverse complement of SEQ ID No.4, positions 69-1812; and / or, the ERG12 gene expression cassette sequence is shown in SEQ ID No.4, positions 1137-3256; and / or, the ERG8 gene expression cassette sequence is shown in the reverse complement of SEQ ID No.5, positions 74-2364; and / or, the ERG19 gene expression cassette sequence is shown in SEQ ID No.5, positions 1689-3774.

[0025] The present invention also provides recombinant cerevisiae yeast constructed by the above construction method.

[0026] Another object of the present invention is to provide a method for producing monoterpenes.

[0027] The present invention provides a method for producing monoterpenes, comprising culturing the above-mentioned recombinant brewer's yeast to obtain fermentation products, namely, obtaining eucalyptol, α-pinene, sabinene, myrcene, carene, terpinolene, ocimene and α-terpineol.

[0028] The present invention also provides a monoterpene synthase and an encoding gene thereof for use in the preparation and production of monoterpene, wherein the amino acid sequence of the monoterpene synthase is as shown in SEQ ID No. 10, 11, 12 or 13, or has at least 70% identity, preferably at least 80% identity, at least 90% identity, at least 95% identity, more preferably at least 99% identity with the nucleotide sequence shown in SEQ ID No. 10, 11, 12 or 13, and still has the function; more preferably, the encoding gene of the monoterpene synthase is derived from Ophiocordyceps sinensis or Hypoxylon.

[0029] The present invention also provides any of the following applications: X1, application of the above construction method in the preparation of monoterpene products; X2, application of the above construction method in the production of monoterpene; X3, application of the above recombinant Saccharomyces cerevisiae in the preparation of monoterpene products; X4, application of the above recombinant Saccharomyces cerevisiae in the production of monoterpene; X5, application of monoterpene synthase gene in the preparation of eucalyptol products; X6, application of monoterpene synthase gene in the production of eucalyptol; X7, application of monoterpene synthase in the preparation of eucalyptol products; X8, application of monoterpene synthase in the production of eucalyptol. Optionally, in the above application, the amino acid sequence of the monoterpene synthase encoded by the monoterpene synthase gene is shown in (SEQ ID No. 10-13). For another example, the nucleotide sequence of the cineole synthase gene may be shown in SEQ ID No. 6, positions 777-1940; SEQ ID No. 7, positions 777-1898; SEQ ID No. 8, positions 777-1898; and SEQ ID No. 9, positions 777-1910.

[0030] Eucalyptus is an important component of many different plant essential oils and is a monoterpene substance. The present invention provides a new way to produce eucalyptus by mining and screening eucalyptus synthase with the ability to synthesize monoterpenes. At the same time, by further strengthening the MVA pathway in saccharomyces cerevisiae and introducing the monoterpene synthase gene, a recombinant saccharomyces cerevisiae producing eucalyptus is constructed; it provides a powerful enzyme and strain research basis for the biosynthesis of monoterpenes, which is of great significance for the production of monoterpenes. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Levels of cineole in shake flask fermentation of Saccharomyces cerevisiae strains with different monoterpene synthase sources. DETAILED DESCRIPTION

[0032] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0033] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0034] SPSS11.5 statistical software was used to process the data, and the experimental results were expressed as mean values.

[0035] Saccharomyces cerevisiae Saccharomyces cerevisiae )TIB H1 was deposited on November 4, 2020 in the General Microbiology Center of China Microorganism Culture Collection (CGMCC for short, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with the deposit registration number CGMCC No.21000.

[0036] YPD medium, each L volume of YPD medium contains: 20g peptone, 10g yeast extract, 20g glucose, 20g agar powder (added to YPD solid medium).

[0037] SD plates without uracil addition: Each L volume of SD medium without uracil addition contains: 8g Ura minusmeida (Beijing Fanjinuo Technology Co., Ltd.), 20g agar powder, and 20g glucose.

[0038] SD plates containing 5-fluoroorotic acid, each L volume of SD plates containing 5-fluoroorotic acid contains: 8g Ura minus meida (Beijing Fanjinuo Technology Co., Ltd.), 20g agar powder, 20g glucose, 60mg uracil, 1g 5-fluoroorotic acid.

[0039] Delft liquid medium, each liter of Delft liquid medium contains: 20 g glucose, 7.5 g ammonium sulfate, 0.5 g magnesium sulfate heptahydrate, 14.4 g potassium dihydrogen phosphate, 2 ml trace metal salt stock solution (1 liter volume contains 3.0 g iron sulfate heptahydrate, 4.5 g zinc sulfate heptahydrate, 4.5 g calcium chloride dihydrate, 0.84 g manganese chloride dihydrate, 0.3 g cobalt chloride hexahydrate, 0.3 g copper sulfate pentahydrate, 0.4 g sodium molybdate dihydrate, 1.0 g boric acid, 0.1 g potassium iodide, 19.0 g ethylenediaminetetraacetic acid disodium salt), 1 ml vitamin stock solution (1 liter volume contains 0.05 g D-biotin, 1.0 g D-pantothenic acid, 1.0 g vitamin B1, 1.0 g pyridoxine, 1.0 g niacin, 0.2 g 4-aminobenzoic acid, 25.0 g inositol), 60 mg uracil.

[0040] For information on the gene fragments and protein sequences in the following examples, see the table below.

[0041] Table 1 Gene fragments and protein sequence related information

[0042]

[0043] Table 2 Protein related information

[0044] Genbank login number Update time tHMG1 protein AJS96703.1 No. 530-1054 2016 / 5 / 23 mvaE protein AAG02439.1 2000 / 8 / 29 mvaS-m protein AAG02438.1: substitution of alanine at position 110 with glycine 2000 / 8 / 29 ERG12 protein NP_013935.1 2020 / 10 / 2 IDI1 protein NP_015208.1 2020 / 10 / 2 ERG19 protein NP_014441.1 2020 / 10 / 2 ERG8 protein NP_013947.1 2020 / 10 / 2

[0045] Example 1. Preparation of target gene

[0046] 1. Acquisition of genes related to MVA pathway transformation

[0047] ERG20 F96W-N127W -T ERG20 、tHMG-T hmg1 、IDI1-T IDI1 、ERG8-T ERG8 、ERG12-T ERG12 、ERG19-T ERG19 Obtaining genes and Gal1, Gal2, Gal7, Gal10 promoters, and ADH, CYC1 terminators.

[0048] Extract yeast genomic DNA as a template and use the primers required for gene amplification in Table 3 to amplify to obtain a fragment of the expected size.

[0049] The amplification system was configured using PrimSTARHS DNA polymerase (TAKARA), and the amplification system was: 10 μL 5×PS Buffer, 4 μL Dntp Mix, 1 μL each primer, 1 μL genomic DNA template, 0.5 μL HS polymerase (2.5 U / μL), and distilled water was added to a total volume of 50 μL. The amplification conditions were: 98°C pre-denaturation for 3 minutes (1 cycle); 98°C denaturation for 10 seconds, 55°C annealing for 5 seconds, 72°C extension for 2.5 minutes (30 cycles); 72°C extension for 10 minutes (1 cycle).

[0050] Table 3 shows the primer sequences

[0051]

[0052] 2. Acquisition of eucalyptol synthase and mvaS-m and mvaE genes

[0053] Previous literature studies reported that Ophiocordyceps sinensis contains terpene synthases for synthesizing secondary metabolites through whole genome sequencing. Eight terpene synthases annotated as being derived from Ophiocordyceps sinensis were found in the NCBI database. After screening and verification, CinS_OCO (GenBank: EQL03520.1, derived from Ophiocordyceps sinensis, SEQ ID No.10) has the ability to synthesize monoterpenoid substances. Based on the comparison with the amino acid sequence of CinS_OCO in the database, the proteins with higher homology were mined: OTA93495.1, 61.02%; OTA69335.1, 61.56%; OTB07499.1, 58.98%; OTB14322.1, 56.18%; XP_033432897.1, 59.72%; KAH8598469.1, 52.34%; OJJ40615.1, 48.81%; XP_025402928.1, 46.7%; XP_035358724.1, 43.7%; OJI81974.1, 43.42%. Through gene synthesis and enzyme function verification, CinS_HCO (GenBank: OTA93495.1, derived from Hypoxylon, 61.02%, SEQ ID No.11), CinS_HEC (GenBank: OTA69335.1, derived from Hypoxylon, 61.56%, SEQ ID No.12), and CinS_HCI (GenBank: OTB07499.1, derived from Hypoxylon, 58.98%, SEQ ID No.13) have the ability to synthesize monoterpenes.

[0054] Suzhou Jinweizhi Biotechnology Co., Ltd. artificially synthesized double-stranded DNA according to the codon-optimized gene sequences of CinS_OCO, CinS_HCO, CinS_HEC, CinS_HCI, mvaE (GenBank: AAG02439.1, HMG-CoA reductase, derived from Enterococcus), and mvaS-m (Genbank: AAG02438.1, alanine at position 110 replaced by glycine, HMG-CoA synthetase, derived from Enterococcus) and then transformed and cloned the double-stranded DNA into the cloning vector pET28a (Suzhou Jinweizhi Biotechnology Co., Ltd.) to construct plasmids containing the above genes respectively.

[0055] Using the above plasmids as templates, the primers required for gene amplification in Table 4 were used for amplification to obtain fragments of the expected size, and the products were recovered and preserved by tapping. Thus, the CinS_OCO gene (shown at positions 777-1940 of SEQ ID No.6), CinS_HCO gene (shown at positions 777-1898 of SEQ ID No.7), CinS_HEC gene (shown at positions 777-1898 of SEQ ID No.8), CinS_HCI gene (shown at positions 777-1910 of SEQ ID No.9) and mxD gene (the reverse complementary sequence of positions 270-2681 of SEQ ID No.3) and mvaS-m gene (shown in positions 3358-4509 of SEQ ID No. 3).

[0056] Table 4 shows the primer sequences

[0057]

[0058] 3. P Gal1 -ERG20 F96W-N127W -T Eer20 Construction of expression elements

[0059] Overlap PCR technique was used to clone the fragment P Gal1 , ERG20 F96W-N127W -T Eer20 For ligation amplification, the amplification system was configured using PrimSTARHS DNA polymerase (TAKARA). The amplification system was: 10 μL 5×PS Buffer, 4 μL Dntp Mix, and primer P Gal1 -f and TErg20-r, 1 μL each, 1 μL genomic DNA template (P Gal1 , ERG20 F96W-N127W -T Eer20 Each fragment was added at a molar ratio of 1:1), HS polymerase (2.5U / μL) 0.5μL, and distilled water was added to a total volume of 50μL. Amplification conditions were: 98℃ pre-denaturation for 3 minutes (1 cycle); 98℃ denaturation for 10 seconds, 55℃ annealing for 5 seconds, 72℃ extension for 3 minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle), and the product was recovered and stored by tapping. P was obtained. Gal1 -ERG20 F96W-N127W -T Eer20 Expression element. Gal1 -ERG20 F96W-N127W -T Eer20 The expression element contains ERG20 F96W-N127W Expression cassette, which expresses ERG20 F96W-N127WGene, the expression product is ERG20 F96W-N127W protein.

[0060] 4. P Gal7 -tHMG1-T hmg1 Construction of expression elements

[0061] Overlap PCR technique was used to clone the fragment P Gal7 , tHMG1-T hmg1 For ligation amplification, the amplification system was configured using PrimSTARHS DNA polymerase (TAKARA). The amplification system was: 10 μL 5×PS Buffer, 4 μL Dntp Mix, and primer P Gal7 -f and Thmg1-r 1 μL each, genomic DNA template 1 μL (P Gal7 , tHMG-T hmg1 Each fragment was added at a molar ratio of 1:1), HS polymerase (2.5U / μL) 0.5μL, and distilled water was added to a total volume of 50μL. The amplification conditions were: 98℃ pre-denaturation for 3 minutes (1 cycle); 98℃ denaturation for 10 seconds, 55℃ annealing for 5 seconds, 72℃ extension for 3 minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle). The product was recovered and stored by tapping. P Gal7 -tHMG1-T hmg1 Expression element. Gal7 -tHMG1-T hmg1 The expression element contains a tHMG1 expression cassette, which expresses the tHMG1 gene, and the expression product is tHMG1 protein.

[0062] 4. T ADH -mvaE-P GAL1 -P GAL10 -mvaS-mT CYC1 Construction of expression elements

[0063] Overlap PCR technique was used to clone the fragments obtained above. ADH ,mvaE,P GAL1 , P GAL10 ,mvaS-m,T CYC1 For ligation amplification, the amplification system was configured using PrimSTAR HS DNA polymerase (TAKARA), and the amplification system was: 5×PS Buffer 10μL, Dntp Mix 4μL, primer T ADH1 -r and T CYC1 -r 1 μL each, genomic DNA template 1 μL (T ADH ,mvaE,P GAL1 , PGAL10 ,mvaS-m,T CYC1 The molar ratio of each fragment was 1:3:5:5:3:1), HS polymerase (2.5U / μL) 0.5μL, and distilled water was added to a total volume of 50μL. The amplification conditions were: 98℃ pre-denaturation for 3 minutes (1 cycle); 98℃ denaturation for 10 seconds, 55℃ annealing for 5 seconds, 72℃ extension for 6 minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle), and the product was recovered and stored by tapping to obtain T ADH -mvaE-P GAL1 -P GAL10 -mvaS-mT CYC1 Expression element. ADH -mvaE-P GAL1 -P GAL10 -mvaS-mT CYC1 The expression element comprises an mvaE expression cassette and an mvaS-m expression cassette. The mvaE expression cassette expresses the mvaE gene, and the expression product is the mvaE protein. The mvaS-m expression cassette expresses the mvaS-m gene, and the expression product is the mvaS-m protein.

[0064] 5. T IDI1 -IDI1-P GAL1 -P GAL10 -ERG12-T ERG12 Construction of expression elements

[0065] Overlap PCR was used to clone the fragment IDI1-T IDI1 , P GAL1 , P GAL10 , ERG12-T ERG12 For ligation amplification, the amplification system was configured using PrimSTAR HS DNA polymerase (TAKARA), and the amplification system was: 5×PS Buffer 10μL, Dntp Mix 4μL, primer T IDI1 -r and T ERG20 -r 1 μL each, genomic DNA template 1 μL (IDI1-T IDI1 , P GAL1 , P GAL10 , ERG12-T ERG12 The molar ratio of each fragment was 1:3:3:1), HS polymerase (2.5U / μL) 0.5μL, and distilled water was added to a total volume of 50μL. The amplification conditions were: 98℃ pre-denaturation for 3 minutes (1 cycle); 98℃ denaturation for 10 seconds, 55℃ annealing for 5 seconds, 72℃ extension for 6 minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle). The product was recovered and stored by tapping. T IDI1 -IDI1-PGAL1 -P GAL10 -ERG12 –T ERG12 Expression element. IDI1 -IDI1-P GAL1 -P GAL10 -ERG12-T ERG12 The expression element contains an IDI1 expression cassette and an ERG12 expression cassette. The IDI1 expression cassette expresses the IDI1 gene, and the expression product is the IDI1 protein. The ERG12 expression cassette expresses the ERG12 gene, and the expression product is the ERG12 protein.

[0066] 6. T ERG8 -ERG8-P GAL1 -P GAL10 -ERG19-T ERG19 Construction of expression elements

[0067] Overlap PCR technique was used to clone the ERG8-T fragment obtained above. ERG8 , P Gal1 , P Gal10 , ERG19-T ERG19 For ligation amplification, the amplification system was configured using PrimSTAR HS DNA polymerase (TAKARA), and the amplification system was: 5×PS Buffer 10μL, Dntp Mix 4μL, primer T ERG8 -r and T CYC1 -r 1 μL each, genomic DNA template 1 μL (ERG8-T ERG8 , P GAL1 , P GAL10 , ERG19-T ERG19 The molar ratio of each fragment was 1:3:3:1), HS polymerase (2.5U / μL) 0.5μL, and distilled water was added to a total volume of 50μL. The amplification conditions were: 98℃ pre-denaturation for 3 minutes (1 cycle); 98℃ denaturation for 10 seconds, 55℃ annealing for 5 seconds, 72℃ extension for 6 minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle), the product was recovered and stored by tapping, and T ERG8 -ERG8-P GAL1 -P GAL10 -ERG19- T erg19 Expression element. ERG8 -ERG8-P GAL1 -P GAL10 -ERG19- T erg19The expression element comprises an ERG8 expression cassette and an ERG19 expression cassette. The ERG8 expression cassette expresses the ERG8 gene, and the expression product is the ERG8 protein. The ERG19 expression cassette expresses the ERG19 gene, and the expression product is the ERG19 protein.

[0068] 11. Construction of PGal2- CinS_OCO -Tcyc1 expression element

[0069] The fragments PGal2, CinS_OCO, and Tcyc1 obtained above were connected and amplified using Overlap PCR technology. The amplification system (TAKARA) was configured using PrimSTAR HS DNA polymerase. The amplification system was: 5×PSBuffer 10μL, Dntp Mix 4μL, primers PGal2-f and TCYC1-r 1μL each, genomic DNA template 1μL (PGal2, CinS_OCO, Tcyc1 fragment molar ratio 1: 3: 1), HS polymerase (2.5U / μL) 0.5μL, and distilled water was added to a total volume of 50μL. The amplification conditions were: 98℃ pre-denaturation for 3 minutes (1 cycle); 98℃ denaturation for 10 seconds, 55℃ annealing for 5 seconds, 72℃ extension for 3 minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle), and the product was recovered and stored by tapping to obtain the PGal2-CinS_OCO-Tcyc1 expression element. The PGal2-CinS_OCO-Tcyc1 expression element contains the CinS_OCO expression cassette, expresses the CinS_OCO gene, and the expression product is the CinS_OCO protein.

[0070] 8. P Gal2 -CinS_HCO-T cyc1 Construction of expression elements

[0071] Overlap PCR technique was used to clone the fragment P Gal2 , CinS_HCO, T cyc1For ligation amplification, the amplification system was configured with PrimSTAR HS DNA polymerase (TAKARA), the amplification system was: 5×PS Buffer 10μL, Dntp Mix 4μL, primers PGal2-f and TCYC1-r 1μL each, genomic DNA template 1μL (PGal2, CinS_HCO, Tcyc1 fragments molar ratio 1: 3: 1), HS polymerase (2.5U / μL) 0.5μL, and distilled water was added to a total volume of 50μL. The amplification conditions were: 98℃ pre-denaturation for 3 minutes (1 cycle); 98℃ denaturation for 10 seconds, 55℃ annealing for 5 seconds, 72℃ extension for 3 minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle), the product was recovered and stored by tapping, and P was obtained. Gal2 -CinS_HCO-T cyc1 Expression element. Gal2 -CinS_HCO-T cyc1 The expression element contains a CinS_HCO expression cassette, expresses the CinS_HCO gene, and the expression product is CinS_HCO protein.

[0072] 9. P Gal2 -CinS_HEC-T cyc1 Construction of expression elements

[0073] Overlap PCR technique was used to clone the fragment P Gal2 , CinS_HEC, T cyc1 For ligation amplification, the amplification system was configured with PrimSTAR HS DNA polymerase (TAKARA), the amplification system was: 5×PS Buffer 10μL, Dntp Mix 4μL, primers PGal2-f and TCYC1-r 1μL each, genomic DNA template 1μL (PGal2, CinS_HEC, Tcyc1 fragments molar ratio 1: 3: 1), HS polymerase (2.5U / μL) 0.5μL, and distilled water was added to a total volume of 50μL. The amplification conditions were: 98℃ pre-denaturation for 3 minutes (1 cycle); 98℃ denaturation for 10 seconds, 55℃ annealing for 5 seconds, 72℃ extension for 3 minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle), the product was recovered and stored by tapping, and P was obtained. Gal2 -CinS_HEC-T cyc1 Expression element. Gal2 -CinS_HEC-T cyc1 The expression element contains a CinS_HEC expression cassette, expresses the CinS_HEC gene, and the expression product is CinS_HEC protein.

[0074] 10. PGal2 -CinS_HCI -T cyc1 Construction of expression elements

[0075] Overlap PCR technique was used to clone the fragment P Gal2 , CinS_HCI, T cyc1 For ligation amplification, the amplification system was configured with PrimSTAR HS DNA polymerase (TAKARA), the amplification system was: 5×PS Buffer 10μL, Dntp Mix 4μL, primers PGal2-f and TCYC1-r 1μL each, genomic DNA template 1μL (PGal2, CinS_HCI, Tcyc1 fragments molar ratio 1: 3: 1), HS polymerase (2.5U / μL) 0.5μL, and distilled water was added to the total volume of 50μL. The amplification conditions were: 98℃ pre-denaturation for 3 minutes (1 cycle); 98℃ denaturation for 10 seconds, 55℃ annealing for 5 seconds, 72℃ extension for 3 minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle), the product was recovered and stored by tapping, and P was obtained. Gal2 -CinS_HCI -T cyc1 Expression element. Gal2 -CinS_HCI -T cyc1 The expression element contains a CinS_HCI expression cassette, expresses the CinS_HCI gene, and the expression product is CinS_HCI protein.

[0076] Example 2: Construction of recombinant bacteria

[0077] 1. Preparation of competent yeast

[0078] The starting bacterial colony was cultured in YPD medium at 30°C and 250 rpm overnight, and the cell density of the overnight culture was counted. The final OD 600nm Inoculate 20 ml YPD medium with a cell turbidity of 0.1. Cultivate at 30°C, 250 rpm until OD 600nm 0.8. Use a sterile centrifuge tube to centrifuge at 2500rpm for 5 minutes to collect the cells. Discard the culture medium, suspend the cells in sterile water, and centrifuge again as above. Discard the water, suspend the cells in 1mL 100mM lithium acetate, and transfer the suspension to a sterile centrifuge tube; precipitate the cells at high speed for a short time to remove the lithium acetate; suspend the cells in 100mM lithium acetate of 4 times system and aliquot to obtain competent cells.

[0079] The construction principle of the following recombinant bacteria is that the expression element that can express Cas9 protein is pre-transferred into the strain TIB H1, and then the recombinant plasmid expressing gRNA (plasmid 1-6) is transformed into the strain together with the expression element or homologous recombination fragment. The recombinant plasmid expressing gRNA recognizes and binds to the specific PAM region of the corresponding site, and at the same time activates and guides the Cas9 protein to perform the cutting function, so that the double-stranded DNA at the corresponding site is broken. At this time, the expression element containing the homologous region or the homologous recombination fragment is integrated into the strain DNA through homologous recombination repair.

[0080] 2. Construction of recombinant plasmid containing gRNA

[0081] Construction of plasmid pBGR: Using pET32a vector as template, primers 1 and 3 were used to amplify fragment 1 containing the AmpR expression frame and ori fragment, and the Saccharomyces cerevisiae TIB H1 genome was used as a template, and primers 8 and 9 were used to amplify the Ura3 expression cassette; using p426-SNR52p-gRNA.CAN1.Y-SUP4t (DiCarlo JE, Norville JE, Mali P, et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res 2013b;41:4336–43) as a template, primers 4 and 5 were used to amplify gRNA expression frame 1, primers 10 and 11 were used to amplify gRNA expression frame 2, and primers 6 and 7 were used to amplify 2μori, and overlap was used to amplify the 2μori. PCR, using gRNA expression frame 1, gRNA expression frame 2, and 2μori fragment as templates, and primers 4 and 10 to obtain fragment 2; using the CloneExpressII kit (Novozymes), fragments 1 and 2 were recombined in vitro, transformed into DH5α competent cells for amplification, and the plasmid was extracted to obtain plasmid pBGR.

[0082] Plasmid 1: Plasmid pBGR was used as a template, and the gene fragment gRNA1 was amplified with primers gRNA1-f and gRNA1-r, and the gene fragment pBGR-2 was amplified with primers pBGR-2-f. The gene fragments gRNA1 and pBGR-2 obtained above were recombined using the CloneExpress II kit (Novozymes) to obtain plasmid 1. Plasmid 1 expresses gRNA1, and its target sequence is tgaaactctaatcctactat, tagaaacgcggacacaggag.

[0083] Plasmid 2: pBGR was used as a template, the gene fragment gRNA2 was amplified with primer gRNA2-f, and the gene fragment pBGR-2 was amplified with primer pBGR-2-f. The gene fragment gRNA2 and pBGR-2 obtained above were recombined using the CloneExpress II kit (Novozymes) to obtain plasmid 2. Plasmid 2 expresses gRNA2, and its target sequence is gcaatgcgatgttagtttag.

[0084] Plasmid 3: pBGR was used as a template, the gene fragment gRNA3 was amplified with primer gRNA3-f, and the gene fragment pBGR-2 was amplified with primer pBGR-2-f. The gene fragments gRNA3 and pBGR-2 obtained above were recombined using the CloneExpress II kit (Novozymes) to obtain plasmid 3. Plasmid 3 expresses gRNA3, and its target sequence is cgccattcaagagcagcaac.

[0085] Plasmid 4: pBGR was used as a template, the gene fragment gRNA4 was amplified with primer gRNA4-f, and the gene fragment pBGR-2 was amplified with primer pBGR-2-f. The gene fragments gRNA4 and pBGR-2 obtained above were recombined using the CloneExpress II kit (Novozymes) to obtain plasmid 4. Plasmid 4 expresses gRNA4, and its target sequence is ttgtcacagtgtcacatcag.

[0086] Plasmid 5: pBGR was used as a template, the gene fragment gRNA6 was amplified with primer gRNA6-f, and the gene fragment pBGR-2 was amplified with primer pBGR-2-f. The gene fragments gRNA6 and pBGR-2 obtained above were recombined using the CloneExpress II kit (Novozymes) to obtain plasmid 6. Plasmid 6 expresses gRNA6, and its target sequence is atatgtctctaattttggaa.

[0087] The primers used above are shown in Table 5.

[0088] Table 5 Primer sequences

[0089]

[0090] 3. Construction of GPP-1 strain

[0091] Competent cells were prepared by culturing the starting strain Saccharomyces cerevisiae TIB H1 overnight in YPD liquid medium, and the following sequence was added: 240 μL PEG (50% w / v), 36 μL 1.0 mol / L lithium acetate, 25 μL salmon sperm DNA (sigma) DNA (2 mg / mL), 50 μL water and gene (P Gal1-ERG20 F96W-N127W -T Erg20 Expression element, P Gal7 -tHMG1-T hmg1 Expression element, plasmid 1); shake vigorously until the cells are completely mixed, keep warm at 30°C for 30 minutes, and place in a 4°C water bath for 20 minutes; centrifuge at 6000-8000rpm for 15s, remove the transformation mixture; pipette 100μL of sterile water into the reaction tube, gently suspend the precipitate and spread it on a SD plate without uracil, wait for colonies to grow, select colonies to the SD plate containing 5-fluoroorotic acid, and the colonies grown on the plate are named GPP-1 and preserved.

[0092] 4. Construction of GPP-2 strain

[0093] Competent cells were prepared by culturing the starting strain Saccharomyces cerevisiae GPP-1 overnight in YPD liquid medium. The following sequence was added: 240 μL PEG (50% w / v), 36 μL 1.0 mol / L lithium acetate, 25 μL salmon sperm DNA (sigma) (2 mg / mL), 50 μL water and gene (T ADH - mxD -P GAL1 -P GAL10 - mvaS-m -T CYC1 Expression element, plasmid 2); shake vigorously until the cells are completely mixed, keep warm at 30°C for 30 minutes, and place in a 4°C water bath for 20 minutes; centrifuge at 6000-8000rpm for 15s, remove the transformation mixture; pipette 100μL of sterile water into the reaction tube, gently suspend the precipitate and spread it on a SD plate without uracil, wait for colonies to grow, select colonies to the SD plate containing 5-fluoroorotic acid, and the colonies grown on the plate are named GPP-2 and preserved.

[0094] 5. Construction of GPP-3 strain

[0095] Competent cells were prepared by culturing the starting strain Saccharomyces cerevisiae GPP-2 overnight in YPD liquid medium. The following sequence was added: 240 μL PEG (50% w / v), 36 μL 1.0 mol / L lithium acetate, 25 μL salmon sperm DNA (sigma) (2 mg / mL), 50 μL water and gene (T IDI1 -IDI1-P GAL1 -P GAL10 -ERG12-T ERG12Expression element, plasmid 3); shake vigorously until the cells are completely mixed, keep warm at 30°C for 30 minutes, and place in a 4°C water bath for 20 minutes; centrifuge at 6000-8000rpm for 15s, remove the transformation mixture; pipette 100μL of sterile water into the reaction tube, gently suspend the precipitate and spread it on a SD plate without uracil, wait for colonies to grow, select colonies to SD plates containing 5-fluoroorotic acid, and the colonies grown on the plates are named GPP-3 and preserved.

[0096] 6. Construction of GPP-4 strain

[0097] Competent cells were prepared by culturing the starting strain Saccharomyces cerevisiae GPP-3 overnight in YPD liquid medium. The following sequence was added: 240 μL PEG (50% w / v), 36 μL 1.0 mol / L lithium acetate, 25 μL salmon sperm DNA (sigma) (2 mg / mL), 50 μL water and gene (T ERG8 -ERG8-P GAL1 -P GAL10 -ERG19-T ERG19 Expression element, plasmid 4); shake vigorously until the cells are completely mixed, keep warm at 30°C for 30 minutes, and place in a 4°C water bath for 20 minutes; centrifuge at 6000-8000rpm for 15s, remove the transformation mixture; pipette 100μL of sterile water into the reaction tube, gently suspend the precipitate and spread it on a SD plate without uracil, wait for colonies to grow, select colonies to the SD plate containing 5-fluoroorotic acid, and the colonies grown on the plate are named GPP-4 and preserved.

[0098] 7. Construction of SQ-1 strain

[0099] Competent cells were prepared by culturing the starting strain Saccharomyces cerevisiae GPP-4 overnight in YPD liquid medium. The following sequence was added: 240 μL PEG (50% w / v), 36 μL 1.0 mol / L lithium acetate, 25 μL salmon sperm DNA (sigma) (2 mg / mL), 50 μL water and gene (P Gal2 -CinS_OCO -T cyc1 Expression element, plasmid 5); shake vigorously until the cells are completely mixed, keep warm at 30°C for 30 minutes, and place in a 4°C water bath for 20 minutes; centrifuge at 6000-8000rpm for 15s, remove the transformation mixture; pipette 100μL of sterile water into the reaction tube, gently suspend the precipitate and spread it on a SD plate without uracil, wait for colonies to grow, select colonies to the SD plate containing 5-fluoroorotic acid, and the colonies grown on the plate are named SQ-1 and preserved.

[0100] 8. Construction of SQ-2 strain

[0101] Competent cells were prepared by culturing the starting strain Saccharomyces cerevisiae GPP-4 overnight in YPD liquid medium. The following sequence was added: 240 μL PEG (50% w / v), 36 μL 1.0 mol / L lithium acetate, 25 μL salmon sperm DNA (sigma) (2 mg / mL), 50 μL water and gene (P Gal2 -CinS_HCO -T cyc1 Expression element, plasmid 5); shake vigorously until the cells are completely mixed, keep warm at 30°C for 30 minutes, and place in a 4°C water bath for 20 minutes; centrifuge at 6000-8000rpm for 15s, remove the transformation mixture; pipette 100μL of sterile water into the reaction tube, gently suspend the precipitate and spread it on a SD plate without uracil, wait for colonies to grow, select colonies to the SD plate containing 5-fluoroorotic acid, and the colonies grown on the plate are named SQ-2 and preserved.

[0102] 9. Construction of SQ-3 strain

[0103] Competent cells were prepared by culturing the starting strain Saccharomyces cerevisiae GPP-4 overnight in YPD liquid medium, and the following sequence was added: 240 μL PEG (50% w / v), 36 μL 1.0 mol / L lithium acetate, 25 μL salmon sperm DNA (sigma) (2 mg / mL), 50 μL water and gene (P Gal2 -CinS_HEC -T cyc1 Expression element, plasmid 5); shake vigorously until the cells are completely mixed, keep warm at 30°C for 30 minutes, and place in a 4°C water bath for 20 minutes; centrifuge at 6000-8000rpm for 15s, remove the transformation mixture; pipette 100μL of sterile water into the reaction tube, gently suspend the precipitate and spread it on a SD plate without uracil, wait for colonies to grow, select colonies to the SD plate containing 5-fluoroorotic acid, and the colonies grown on the plate are named SQ-3 and preserved.

[0104] 10. Construction of SQ-4 strain

[0105] Competent cells were prepared by culturing the starting strain Saccharomyces cerevisiae GPP-4 overnight in YPD liquid medium, and the following sequence was added: 240 μL PEG (50% w / v), 36 μL 1.0 mol / L lithium acetate, 25 μL salmon sperm DNA (sigma) (2 mg / mL), 50 μL water and gene (P Gal2 -CinS_HCI -T cyc1Expression element, plasmid 5); shake vigorously until the cells are completely mixed, keep warm at 30℃ for 30 minutes, and place in a 4℃ water bath for 20 minutes; centrifuge at 6000-8000rpm for 15s, remove the transformation mixture; pipette 100μL of sterile water into the reaction tube, gently suspend the precipitate and spread it on the SD plate without uracil, wait for the colonies to grow, select the colonies to the SD plate containing 5-fluoroorotic acid, and the colonies grown on the plate are named SQ-4 and preserved.

[0106] Example 3: Application of recombinant bacteria in the production of monoterpenes

[0107] 1. Engineering bacteria culture and product extraction

[0108] The yeast engineering strains SLQ-1, SLQ-2, SLQ-3, and SLQ-4 prepared in Example 2 were activated in Delft liquid culture medium, respectively. Seed solution was prepared in Delft liquid culture medium (30° C., 250 rpm, 16 h), and inoculated into a 100 mL conical flask containing 20 mL Delft liquid culture medium and 2 ml of sec-butylbenzene-n-dodecane at an inoculum size of 1%. The culture was carried out at 30° C. and 250 rpm for 2-3 days. Finally, the liquid in the conical flask was transferred to a 50 ml centrifuge tube, centrifuged at 5000 rpm for 5 min, and the organic phase was collected for later use.

[0109] 2. Qualitative and quantitative analysis of monoterpenoid substances produced by bacteria

[0110] The organic phase collected in step 1 was diluted 50 times with n-hexane and detected by GC-MS. GC-MS determination conditions: injection port temperature 260℃, injection volume 1μL, no splitting, solvent delay 3min; chromatographic column: HP-5ms (30m*0.25mM); chromatographic conditions: 60℃, 3min, 40℃ / min to 150℃, 20℃ / min to 220℃, 40℃ / min to 260℃ for 2min; MS conditions: Full Scan: 50-750 amu. Mixed standards of different monoterpenes were used for qualitative and quantitative analysis.

[0111] The results are as follows Figure 1 As shown, the yield of each engineered bacteria after 3 days of fermentation is as follows:

[0112] The eucalyptol yields of SQ-1, SQ-2, SQ-3, and SQ-4 were 134.3±3.14 mg / L, 154.3±11.81 mg / L, 153.3±2.32 mg / L, and 148.1±6.39 mg / L, respectively. In addition to the main eucalyptol, a-pinene, sabinene, myrcene, carene, terpinolene, ocimene, and a-terpineol monoterpenes were also produced.

[0113] This example demonstrates that the monoterpene synthase gene can be expressed in Saccharomyces cerevisiae to produce eucalyptol, α-pinene, sabinene, myrcene, carene, terpinolene, ocimene, and α-terpineol.

[0114] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A method for constructing a recombinant Saccharomyces cerevisiae that produces monoterpene substances, characterized in that: The method comprises introducing a monoterpene synthase encoding gene into Saccharomyces cerevisiae to obtain a recombinant Saccharomyces cerevisiae producing eucalyptol, wherein the amino acid sequence of the monoterpene synthase encoded by the monoterpene synthase encoding gene is shown in SEQ ID No. 10, 11, 12 or 13; The starting strain of the cerevisiae yeast is a cerevisiae yeast capable of accumulating the monoterpene synthesis precursor geranyl diphosphate GPP; The brewer's yeast starting strain is transformed as follows to obtain the brewer's yeast: A1. Introduce double point mutation gene ERG20 at positions 96 and 127 of farnesyl pyrophosphate synthase gene F96W / N127W Gene; A2, introduction of 3-hydroxy-3-methylglutaryl coenzyme A tHMG1 gene; A3, introduction of acetyl-CoA acyltransferase mvaE gene; A4, introduction of HMG-CoA synthetase mvaS-m gene; A5, introduction of the isopentenyl pyrophosphate isomerase IDI1 gene; A6, introduction of mevalonate kinase ERG12 gene; A7, introduction of MVAP kinase ERG8 gene; A8. Introduce the MVAPP decarboxylase ERG19 gene.

2. A recombinant Saccharomyces cerevisiae constructed by the construction method according to claim 1.

3. A method for producing monoterpenes, characterized in that: The method comprises culturing the recombinant brewer's yeast according to claim 2, obtaining a fermentation product, and collecting eucalyptol or its byproducts, wherein the byproducts are α-pinene, sabinene, myrcene, carene, terpinolene, ocimene, and / or α-terpineol.

4. The method for producing a monoterpene according to claim 3, characterized in that: The culture temperature is 25-35°C and the culture time is 24-72h.

5. The method for producing a monoterpene according to claim 4, characterized in that: The culturing is carried out under stirring or shaking conditions.

6. The method for producing a monoterpene according to claim 4, characterized in that: An extractant is added to the culture medium; the extractant is selected from: n-dodecane, butyl oleate, dioctyl phthalate, dibutyl phthalate, isopropyl myristate.

7. Use of a monoterpene synthase or a gene encoding the same in the preparation of a monoterpene, characterized in that: The amino acid sequence of the monoterpene synthase is shown in SEQ ID No. 10, 11, 12 or 13; and the monoterpene is eucalyptol.

8. An application, characterized in that: Any of the following applications: X1. Use of the recombinant Saccharomyces cerevisiae according to claim 2 in the preparation of a eucalyptol product; X2. Use of the recombinant Saccharomyces cerevisiae described in claim 2 in the production of eucalyptol.

Images