A primer probe composition for human papilloma virus nucleic acid typing detection and application

Abstract

The application relates to a primer probe composition and application for human papilloma virus nucleic acid typing detection. The primer probe composition comprises one universal label primer and 28 groups of primer probe groups respectively used for detecting 28 human papilloma virus nucleic acid types; wherein each group of the primer probe group comprises one upstream primer, one downstream primer and one probe, and the 5' ends of the upstream primer and the downstream primer are marked with the universal label primer, and the base sequence of the universal label primer is shown as SEQ ID NO: 59. The primer probe composition or kit can realize single-tube and simultaneous detection of 28 HPV subtypes, has high detection accuracy, good sensitivity and specificity, and the whole detection process can be automatically realized by using a full-automatic device.

Description

Technical Field

[0001] This application relates to the field of molecular biology technology, and in particular to a primer-probe composition for human papillomavirus nucleic acid typing detection and its application. Background Technology

[0002] Human papillomavirus (HPV) belongs to the Papillomaviridae family. It is a small, non-enveloped, circular, double-stranded DNA virus with a genome of approximately 8000 base pairs (bp) in length, divided into three functional regions: the early transcription region (E region), the late transcription region (L region), and the non-transcriptional region (long control region, LCR). HPV infects humans through direct or indirect contact with contaminated objects or sexual transmission. This virus exhibits not only host specificity but also tissue specificity, infecting only the epithelial cells of human skin and mucous membranes, causing various papillomas or warts on the skin and proliferative lesions of the genital tract.

[0003] HPV that infects the genital tract and anus can be divided into two main categories based on the pathogenicity or carcinogenic risk of each genotype: low-risk and high-risk. Persistent infection with high-risk HPV is a major cause of cervical intraepithelial neoplasia and cervical cancer. Low-risk HPV is generally associated with condyloma acuminata or low-grade squamous intraepithelial lesions.

[0004] Currently, over a hundred HPV subtypes have been reported. If all these subtypes were classified and tested, it would not only lead to resource waste and overtreatment, but also have little clinical significance for detecting rare subtypes. Considering the varying proportions of infection with different subtypes across different populations and the need for early screening, diagnosis, and treatment, rapid and accurate classification and testing of subtypes with significant clinical relevance is crucial for the early diagnosis and treatment of diseases such as cervical cancer and genital warts.

[0005] Currently, HPV testing methods are mainly divided into two categories: traditional diagnostics and molecular biological diagnostics. Cytology, colposcopy, and pathology all fall under the category of traditional diagnostic methods. Due to limitations in sensitivity and specificity, traditional diagnostics restricts their application in early screening and diagnosis. On July 6, 2021, the WHO released guidelines for screening and treatment of precancerous lesions of the cervical cancer in cervical cancer prevention, recommending HPV-DNA testing as the preferred screening method for cervical cancer. This marked the official entry of HPV screening into the era of molecular biological technology.

[0006] The main HPV molecular biology detection technologies on the market include amplification-independent hybridization capture-chemiluminescence technology (Qiage, Dr. Tong), and PCR detection technologies that combine multiple signal detection methods, such as fluorescent PCR, reverse dot blot hybridization, and liquid chips (Roche, Analog Devices, TransGen, etc.). Hybridization capture technology has relatively low sensitivity, reaching only 10-1. 5 The level of copies / mL. PCR detection technology is currently the mainstream technology for HPV molecular detection, with a sensitivity of up to 10. 3 While the LAMP assay achieves high copy / mL levels, it suffers from drawbacks such as requiring significant manual intervention, long overall testing time, and the potential for contamination from opening the container mid-process. This limits its suitability for specialized PCR laboratories and operations by qualified personnel, restricting its widespread adoption at the grassroots level. Recently, the increasingly popular isothermal amplification fluorescence assay has also been introduced into HPV detection. For example, Beijing Haipuwei Biotechnology Co., Ltd. obtained NMPA registration for its LAMP-based HPV detection product in 2021. The Institute of Viral Disease Control and Prevention of the Chinese Center for Disease Control and Prevention applied for a patent in August 2021 for a primer and probe kit using RAA technology to detect HPV16 / 18 and HPV6 / 11. However, unlike PCR, isothermal amplification cannot utilize temperature cycling to reduce false positives caused by mismatches. Therefore, directly using isothermal amplification fluorescence assays to avoid false positives also leads to insufficient sensitivity.

[0007] Currently, HPV molecular biology detection techniques, based on the choice of detection region, mainly fall into two categories. One is using universal primers in the L1 region. These universal primers are designed to encompass the amplification effects of multiple subtypes, and specific probes are used to differentiate and identify subtypes. Using the L1 region is currently the most common method for HPV genotyping. However, the L1 region may be missing during viral integration; for example, the HPV18 subtype has been reported to be missing in several studies, thus this design may result in missed detections. The other approach uses primers in the E6 / E7 region. This region is not lost during viral integration, and using this region for detection can avoid missed detections from the design perspective. However, because primers in this region are not highly conserved, multiple primers are needed to achieve coverage of multiple subtypes, resulting in a large amplification system and low amplification efficiency. Therefore, the subtype coverage of this method is generally not high.

[0008] Because existing products cannot simultaneously achieve the following at the design level: no missed detections, multiple genotyping capabilities, speed, simple operation and requirements (suitable for grassroots use), high sensitivity and specificity, and with the increasing popularity of early screening, there is an urgent need for a product with significant comprehensive performance advantages that is easy to operate (fully automatic, no human intervention), fast, capable of genotyping, and has high sensitivity, accuracy, and specificity to meet market needs. Summary of the Invention

[0009] To address the shortcomings of existing technologies, this application provides a novel primer-probe composition for human papillomavirus (HPV) nucleic acid typing detection and a kit comprising the primer-probe composition. The primer-probe composition or kit enables single-tube simultaneous detection of 28 HPV subtypes with high accuracy, sensitivity, and specificity. Furthermore, the entire detection process can be automated using fully automated equipment.

[0010] Therefore, the first aspect of this application provides a primer-probe composition for human papillomavirus (HPV) nucleic acid typing detection. The primer-probe composition includes a universal tag primer and 28 sets of primers-probes for nucleic acid typing detection of 28 HPV subtypes. Each set of primers-probes includes an upstream primer, a downstream primer, and a probe. The 5' end of both the upstream and downstream primers is connected to the base sequence of the universal tag primer, as shown in SEQ ID NO:59. Preferably, the 5' end of the universal tag primer is modified with biotin.

[0011] For multiplex systems, controlling competitive interference between different primers and suppressing primer dimer formation are key challenges. Previous research has confirmed that introducing universal primers can largely control competitive interference between different primers. Existing literature and patents often employ universal primer pairs, adding a universal sequence to the 5' end of both the forward and reverse specific primers. Generally, the Tm value of the universal primers is higher than that of the specific primers. Two-stage amplification is then used to reduce competitive interference between multiplex primers. However, this method still faces challenges in amplification efficiency with universal primer pairs, and primer dimer formation can still lead to suboptimal amplification efficiency.

[0012] Existing literature reports a method for reducing primer dimers using a single tag. Related existing patents also use a single universal primer (GCAAGCCCTCACGTAGCGAA) to achieve simultaneous detection of 15 pathogens. However, analysis of this universal primer revealed that it still carries the risk of dimer formation, as shown below.

[0013]

[0014] Therefore, in response to the above situation, this application redesigned a universal tag primer with the base sequence ATACGACTCACTCTTGCGA (SEQ ID NO:59). This sequence does not bind to the genome sequences of human genomes, HPV, Neisseria gonorrhoeae, or Chlamydia. Moreover, compared with previously reported sequences, this sequence is less likely to form dimers, as shown below, which is more conducive to the amplification of multiplex systems.

[0015] The sequence was ligated to the 5' end of the designed forward and reverse specific primers to form labeled specific primers. The specific primers labeled with the tag were purified by PAGE, and the 5' end of the tag was labeled with biotin and purified by HPLC. Compared with the detection performance using a single L1 primer, the detection performance of this application using the universally labeled primers was better.

[0016] In some embodiments, the base sequences of the 28 upstream primers in the 28 sets of primers and probes used for nucleic acid typing detection of 28 human papillomavirus subtypes are shown as SEQ ID NO:1 to 28, the base sequences of the 28 downstream primers are shown as SEQ ID NO:30 to 57, and the base sequences of the 28 probes are shown as SEQ ID NO:60 to 87.

[0017] It is worth noting that the base sequences of the upstream and downstream primers and probes claimed in this application are not limited to the above-described range. Position shifts of a few bases or mismatches of a few bases in the primers and probes are also within the scope of protection of this application.

[0018] In this application, the term "primer" refers to an oligonucleotide that is capable of "initiating" DNA synthesis by a template-dependent DNA polymerase, i.e., the 3'-terminus of the oligonucleotide provides a free 3'-OH group, which can be linked to more "nucleotides" by the template-dependent DNA polymerase to establish a 3' to 5' phosphodiester bond, thereby using deoxynucleoside triphosphate and thereby releasing pyrophosphate.

[0019] In this application, the term "upstream primer" refers to an oligonucleotide that extends continuously along the negative strand; the term "downstream primer" refers to an oligonucleotide that extends continuously along the positive strand. It should be understood that when the designations of the positive and negative strands are interchanged, the corresponding names of the upstream and downstream primers can also be interchanged. That is, the upstream and downstream primers in this application are relative terms.

[0020] In this application, the upstream and downstream primers and probes in the 28 sets of primers and probes are all designed based on the E6 / E7 region of the HPV genome. Therefore, when using these primers and probes to detect HPV subtypes, there will be no missed detections due to genomic deletions caused by viral integration, resulting in high accuracy. Furthermore, the upstream and downstream primers and probes in the primer and probe sets are all subtype-specific primers and probes, ensuring the specificity of target recognition through a dual design of primers and probes. Further, the upstream and downstream primers in the primer and probe sets of this application are modified with universally tagged primers. Utilizing the effect of the same tag reduces the competitive inhibition between primers and the influence of primer dimers in the multiplex system, improving amplification efficiency and detection sensitivity.

[0021] In some embodiments, the 5' ends of the 28 probes are all modified with amino groups (NH2).

[0022] In some embodiments, the primer-probe composition further includes a set of primers and probes targeting an internal reference gene, comprising an upstream primer targeting the internal reference gene, a downstream primer targeting the internal reference gene, and a probe targeting the internal reference gene.

[0023] In this application, by setting an internal reference gene, the sampling process and the entire detection process can be monitored to ensure the accuracy of the detection process. In this application, the selected internal reference gene is the housekeeping gene β-globin.

[0024] In some embodiments, the base sequence of the upstream primer targeting the internal reference gene is shown in SEQ ID NO:29, the base sequence of the downstream primer is shown in SEQ ID NO:58, and the base sequence of the probe is shown in SEQ ID NO:88.

[0025] In some embodiments, the 5' end of the probe targeting the internal reference gene is modified with an amino group.

[0026] It should be noted that in this application, only the general tag primers are modified with biotin, while the 29 pairs of upstream and downstream primers targeting the internal reference gene and 28 human papillomavirus subtypes do not require modification with biotin.

[0027] In this application, the 28 human papillomavirus subtypes are HPV6, HPV11, HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV40, HPV42, HPV43, HPV44, HPV45, HPV51, HPV52, HPV53, HPV54, HPV56, HPV58, HPV59, HPV61, HPV66, HPV68, HPV73, HPV81, HPV82, and HPV83.

[0028] Based on research findings from the WHO International Agency for Research on Cancer (IARC) and other international organizations, the "Guidelines for Human Papillomavirus (HPV) Nucleic Acid Detection and Genotyping, and Reagent Technical Review" includes 18 high-risk HPV types, including 13 high-risk types (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, and 68) and 5 intermediate-risk types (26, 53, 66, 73, and 82). Considering other research findings and clinical relevance, this application also includes 10 low-risk types (HPV6, 11, 40, 42, 43, 44, 54, 61, 81, and 83) in the scope of genotyping testing.

[0029] The second aspect of this application provides a fully automated detection kit for human papillomavirus nucleic acid typing, comprising the primer and probe composition as described in the first aspect of this application.

[0030] In some embodiments, the kit includes nucleic acid extraction reagents, amplification reagents, and hybridization chromogenic reagents.

[0031] In this application, the amplification reagent contains all the primers (universal tag primers and 29 pairs of upstream and downstream primers) in the primer-probe composition, used for multiplex PCR amplification of nucleic acids in the test sample. The hybridization chromogenic reagent contains all the probes in the primer-probe composition, which are used to capture target sequences in the multiplex PCR amplification products, thereby immobilizing the target sequences in the amplification products at specific sites on the hybridization membrane for subsequent chromogenic development.

[0032] In some embodiments, the kit also includes positive and negative controls.

[0033] This application utilizes the aforementioned positive and negative control materials to effectively control the test results, avoid false positives and false negatives during the testing process, and further ensure the accuracy of the test results.

[0034] In some embodiments, the nucleic acid extraction reagent includes a lysis buffer, magnetic beads, a binding buffer, a washing buffer, and an elution buffer.

[0035] In this application, the nucleic acid extraction reagent is used to obtain target nucleic acids from a sample. Specifically, the lysis buffer is used to disrupt the structure of cells in the sample, thereby fully releasing the intracellular nucleic acids; the magnetic beads are used to adsorb the released nucleic acids; the binding solution is used to promote the binding of the released nucleic acids to the magnetic beads; the washing solution is used to purify the nucleic acids, removing impurities (proteins, etc.); and the elution solution is used to separate the magnetic beads from the nucleic acids, thereby releasing the purified nucleic acids, which are then dissolved in a liquid phase (such as water).

[0036] In some embodiments, the lysis buffer includes a guanidine salt, a surfactant, and a first buffer salt; the magnetic beads are silanol magnetic beads; the binding solution is isopropanol; the rinsing solution includes a second buffer salt and an organic alcohol; and the eluent is water (e.g., purified water).

[0037] In some specific embodiments, the guanidine salt is guanidine hydrochloride, and the concentration of guanidine hydrochloride in the lysis buffer is 2-8 M; the surfactant is Tween 20, and the concentration of Tween 20 in the lysis buffer is 1-20 wt%; the first buffer salt is MOPS (3-morpholinopropanesulfonic acid), and the concentration of MOPS in the lysis buffer is 20-100 mM.

[0038] In some preferred embodiments, the lysis buffer contains 6 M guanidine hydrochloride, 10 wt% Tween20, and 100 mM MOPS.

[0039] In some specific embodiments, the second buffer salt is MOPS, and the concentration of MOPS in the rinsing solution is 5-20 mM; the organic alcohol is ethanol, and the volume concentration of ethanol is 40-70%.

[0040] In some preferred embodiments, the rinsing solution is a 70 v / v ethanol solution containing 10 mM MOPS.

[0041] In some embodiments, the amplification reagent includes Taq enzyme, UNG enzyme, dNTPs, specific primers, and universal tag primers; wherein the specific primers are 29 upstream primers targeting the internal reference gene and 28 human papillomavirus subtypes and 29 downstream primers targeting the internal reference gene and 28 human papillomavirus subtypes in the primer probe composition.

[0042] In this application, the amplification reagent is used to perform multiplex PCR amplification on the target nucleic acid obtained by lysis, thereby amplifying the corresponding target sequence in the target nucleic acid.

[0043] In some embodiments, the amplification reagent contains 0.5–1.5 U of Taq enzyme, 0.03–1 U of UNG enzyme, 0.2–0.3 mM of dNTPS, 0.005–5 μM of each specific primer, and 0.1–5 μM of universal tag primer.

[0044] In this application, the Taq polymerase is a thermostable DNA polymerase; the UNG enzyme is a uracil-N-glycosylation enzyme, whose function is to selectively hydrolyze and break the uracil glycosidic bonds in double-stranded or single-stranded DNA containing dU, forming DNA strands with missing bases. These strands are further hydrolyzed and broken under alkaline media and high temperatures, thus being eliminated. The optimal activity temperature of the UNG enzyme is 50℃, and it is inactivated at 95℃. By employing both Taq polymerase and UNG enzyme, this application ensures the accuracy of PCR results and prevents non-specific PCR amplification and contamination.

[0045] This application achieves the reduction of competitive interference and primer dimer formation in multiplex amplification systems primarily by decreasing the amount of specific primers and increasing the amount of universal tag primers. Therefore, when designing multiplex systems, the content of each specific primer in the amplification reagent is 0.005–5 μM, and the content of the universal tag primer is 0.1–5 μM.

[0046] In some specific embodiments, the amplification reagent contains 1.5 U of Taq enzyme, 0.1 U of UNG enzyme, 0.3 mM of dNTPS, 0.01 μM of each specific primer, and 1 μM of universal tag primer.

[0047] In some embodiments, the hybridization chromogenic reagent includes a hybridization membrane, a hybridization washing solution, an enzyme conjugate solution, and a chromogenic solution, wherein the hybridization membrane is immobilized with 29 probes from the primer-probe composition targeting an internal reference gene and 28 human papillomavirus subtypes.

[0048] In this application, the hybridization chromogenic reagent is used for hybridization and chromogenic development of multiplex PCR amplification products. Specifically, a specific probe is immobilized on the hybridization membrane, which can specifically bind to the corresponding target sequence in the amplification product, thereby immobilizing the target sequence at a specific site on the hybridization membrane. The hybridization washing buffer is used to provide a hybridization environment and remove interference from non-specific substances in the amplification product. The enzyme in the enzyme conjugate solution can be immobilized on the target sequence through biotin-streptavidin binding. The chromogenic solution reacts with the enzyme in the enzyme conjugate solution, thereby developing the color of the target sequence.

[0049] In some embodiments, the content of each probe on the hybridization membrane is 0.2 to 50 μM, preferably 20 μM.

[0050] In this application, the probe can be applied to the hybridization membrane using nanoliter spotting technology.

[0051] In some embodiments, the hybridization membrane is a nylon membrane; the hybridization rinsing solution includes sodium dodecyl sulfate and a third buffer salt; the enzyme conjugation solution includes streptavidin-labeled horseradish peroxidase; and the colorimetric solution includes urea peroxide, a fourth buffer salt, and tetramethylbenzidine.

[0052] In some specific embodiments, the concentration of sodium dodecyl sulfate in the hybridization rinsing solution is 5–15 wt%; the third buffer salt is phosphate, and the concentration of phosphate in the hybridization rinsing solution is 10–100 mM; the concentration of streptavidin-labeled horseradish peroxidase (HRP) in the enzyme conjugate solution is (0.1–1) μg / mL; the concentration of urea oxychloride in the chromogenic solution is 0.01–0.1 wt%; the fourth buffer salt is citrate, and the concentration of citrate in the chromogenic solution is 5–50 mM; and the concentration of tetramethylbenzidine (TMB) in the chromogenic solution is 0.01–0.05 wt%.

[0053] In some preferred embodiments, the hybridization rinsing solution contains 10 wt% SDS and 10 mM phosphate; the enzyme conjugate solution contains 0.4 μg / mL streptavidin-labeled horseradish peroxidase; and the colorimetric solution contains 0.03 wt% urea peroxide, 5 mM citrate, and 0.015 wt% TMB.

[0054] In some embodiments, a chromogenic control probe (SP probe) is also immobilized on the hybridization membrane; preferably, the concentration of the chromogenic control probe on the hybridization membrane is 0.2–50 μM. In some specific embodiments, the chromogenic control probe is immobilized at three positioning points on the hybridization membrane.

[0055] The SP probe described in this application is used for quality control of hybridization colorimetric results to ensure the accuracy of the detection results. In addition to its colorimetric quality control function, the SP probe also serves as a positioning point for automatic identification and interpretation by the software. The design of three positioning points enables the transition from manual visual interpretation to automatic software identification. After the experiment, the automatic interpretation software searches for and locates the three fixed positioning points (SP points) to determine the location of other spots. A simulated circle is then defined based on the size of the SP points. The average grayscale value of the pixels within the simulated circle is used as the spot brightness information, and the average grayscale value of the four surrounding areas is used as the background brightness. The difference in grayscale between the spot brightness and the background brightness is the contrast value of that point. The deeper the color of the spot, the greater the grayscale difference between the spot and the surrounding area, and consequently, the higher the contrast value. Therefore, the contrast value reflects the spot detection result.

[0056] In some embodiments, the positive control is Siha cells that test positive for HPV16 subtype; the negative control is HEK293 cells that test negative for all HPV subtypes.

[0057] In this application, the principle of detecting human papillomavirus nucleic acid typing using the above-mentioned kit belongs to the nucleic acid extraction-amplification-reverse dot blot hybridization method. Specifically, the target nucleic acid is obtained from the sample using a nucleic acid extraction reagent; the target sequence is amplified using an amplification reagent; and the amplified product is bound to the probe on the hybridization membrane through hybridization. Since the primers are modified with biotin, the product bound to the hybridization membrane also carries biotin modification. Through the interaction of biotin and avidin, the amplified product can bind to HRP modified with streptavidin. Then, the colorimetric reaction of hydrogen peroxide and TMB catalyzed by HRP is used to achieve visual detection results. If the sample contains a target, the product enriched and amplified after extraction and amplification will bind to the hybridization membrane containing the specific probe, and then, through the colorimetric effect of HRP-TMB, a blue spot will appear at the probe position.

[0058] The kit described in this application immobilizes HPV subtype-specific probes and internal standard probes on a hybridization membrane using nanometer-scale dot membrane technology. Therefore, this kit allows for the detection of 28 HPV subtypes in a single test. The presence of target sequences in the sample is determined by the color development of each probe position on the hybridization membrane. Simultaneously, the kit combines... Figure 2-3 The equipment shown, such as Figure 4-5 When used with the chip shown, it can automate the entire testing process, transforming the current manual step-by-step operation in the market into an automated process, reducing errors caused by human intervention and the risk of contamination introduced by manual opening of the cover.

[0059] The third aspect of this application provides a method for detecting human papillomavirus nucleic acid typing using a kit as described in the second aspect of this application.

[0060] In some embodiments, the method includes the following steps:

[0061] S1, The target nucleic acid in the sample to be tested is obtained using the nucleic acid extraction reagent;

[0062] S2, the target nucleic acid is mixed with the amplification reagent and then subjected to multiplex PCR amplification to obtain the amplification product;

[0063] S3, the amplification product is hybridized and chromogenic using the hybridization chromogenic reagent, and the chromogenic result is interpreted.

[0064] In this application, the target nucleic acid in the sample to be tested in step S1 is obtained by magnetic bead method. After the sample is lysed by lysis buffer, the released nucleic acid is captured by magnetic beads. After washing and elution, the purified target nucleic acid is obtained.

[0065] In some implementations, in step S2, the multiplex PCR amplification is performed in a single tube.

[0066] In some specific embodiments, the conditions for the multiplex PCR amplification are as follows:

[0067] 37℃ for 10 minutes;

[0068] 95℃ for 2 minutes;

[0069] 95℃ for 15 seconds, 55℃ for 20 seconds, 72℃ for 20 seconds, 45 cycles;

[0070] 72℃ for 3 minutes.

[0071] In some specific embodiments, step S3 is specifically performed as follows: the amplification product is hybridized with the hybridization membrane at 30℃~50℃ for 10~15min, the hybridization membrane is washed with hybridization rinsing solution, enzyme conjugation solution is added, and the reaction is carried out at 30~37℃ for 10~15min. Then, colorimetric solution (urea peroxide + TMB) is added, and the reaction is carried out for 5~10min to develop color, and the colorimetric results are interpreted.

[0072] In some implementations, the method is performed automatically by fully automated equipment.

[0073] The method described in this application can be completed automatically by fully automated equipment, achieving a process without human intervention, thereby avoiding operational errors or contamination introduced by human intervention. It has good repeatability and high stability, and is suitable for screening and testing in grassroots institutions.

[0074] Specifically, the characteristics of the detection method described in this application compared with other methods are shown in Table 1.

[0075] Table 1

[0076]

[0077] As shown in Table 1, compared with existing products, the method described in this application has significant comprehensive advantages in terms of classification capability, detection time and automation, and avoids missed detections due to design limitations through the design of the E6 / E7 area.

[0078] This application includes at least one of the following beneficial technical effects:

[0079] (1) Sensitivity: The primer and probe composition of this application is designed using the E6 / E7 region with a lower risk of missed detection, which reduces the feasibility of missed detection at the design level; and after optimization, the primer and probe composition of this application still maintains a high level of sensitivity.

[0080] (2) Accuracy: In testing mixed samples, this application detected all samples that were positive as indicated by the comparison reagent. In addition to detecting subtypes not included in the comparison reagent, this application also found one HPV18 positive sample. This result was confirmed by first-generation sequencing, confirming the accuracy of the test results and demonstrating the higher accuracy of this method. Furthermore, the primer-probe composition or kit of this application can simultaneously detect 28 HPV subtypes. Due to the increased subtype coverage, this product can benefit more users.

[0081] (3) Specificity: The kit of this application was used to detect subtypes not included in the kit, such as HPV67, 69, 70, 71 and 72, and the results were all negative. The kit was also used to detect Neisseria gonorrhoeae, Chlamydia trachomatis, Ureaplasma urealyticum and Candida albicans, and the results were all negative, which further confirmed that the application has high specificity for the subtypes included in the kit.

[0082] (4) Ease of Operation: During the testing process, the only operation involved in this application is adding the sample to the sample pool corresponding to the detection chip; all other operations are completed by the equipment, thereby reducing contamination caused by human intervention and further improving accuracy. Compared with non-automated products involving a large number of operations, this product has better user-friendliness. Attached Figure Description

[0083] Figure 1 This is a dot matrix distribution diagram of the detection probes and quality control probes for each subtype and internal reference gene in Example 2 on the hybridization membrane; the meanings of the labels in the diagram are as follows:

[0084] SP: Chromogenic control probe; GB: Internal reference gene control probe; 16, 18, and other numbers: HPV specific probes corresponding to each subtype;

[0085] The rules for interpreting each label are as follows: (1) Positive control in the kit must show positive spots at positions 16, GB, and SP; otherwise, the experiment will fail. (2) Negative control in the kit must show positive spots at positions GB and SP; positive spots must not appear at other positions. Otherwise, the experiment will fail or be contaminated.

[0086] Figure 2 This is an external view of the automated equipment used in Example 3.

[0087] Figure 3This is an internal structure diagram of the automated equipment used in Example 3.

[0088] Figure 4 This is a front view of the chip installed in the device described in Example 3.

[0089] Figure 5 This is a reverse view of the chip installed in the device described in Example 3. Detailed Implementation

[0090] To make this application easier to understand, the following detailed description is provided in conjunction with embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of application of this application. Unless otherwise specified, the raw materials or components used in this application can be obtained commercially or by conventional methods. Unless otherwise indicated, the nucleic acid sequences in this application are written from left to right in a 5' to 3' direction.

[0091] Example 1: Design of primer-probe composition

[0092] The genomic sequences of HPV6, 11, 16, 18, 26, 31, 33, 35, 39, 40, 42, 43, 44, 45, 51, 52, 53, 54, 56, 58, 59, 61, 66, 68, 73, 81, 82, and 83 were downloaded from the NCBI database and sequenced. Primers and probes were designed at positions in the E6 / E7 region that maintained both inter-subtype specificity and intra-subtype conservation. After analyzing the interactions between the designed primers and probes, primers with no 5 or more base matches at their 3' ends and probes with no 8 or more consecutive base matches were selected.

[0093] Furthermore, the sequences of HPV67, 69, 70, 71, and 72 were downloaded, and the designed primers and probes were compared and analyzed with these sequences to confirm that there was no non-specific cross-interaction with the above types.

[0094] To control competition and interference between different primers in the multiplex system and to inhibit primer dimer formation, a novel universal tag primer (Tag) was designed in this application. Its base sequence is ATACGACTCACTCTTGCGA (SEQ ID NO: 59). This sequence does not bind to the genomic sequences of human genomes, HPV, Neisseria gonorrhoeae, or Chlamydia, and compared to previously reported universal tag primers, it is less likely to form dimers, thus being more conducive to multiplex system amplification. This sequence was ligated to the 5' end of the designed forward and reverse specific primers to form labeled specific primers. The Tag-labeled specific primers were purified by PAGE, and the 5' end of the Tag was labeled with biotin and purified by HPLC.

[0095] In this application, the housekeeping gene β-globin is selected as the internal reference gene (internal standard) for detection, used to monitor the sampling status and the entire detection process.

[0096] After theoretical analysis and experimental verification, the base sequences of the primers and probes finally selected in this application are shown in Table 2.

[0097] Table 2: Base sequences of primers and probes in the primer-probe composition described in this application

[0098]

[0099]

[0100]

[0101] Example 2: Design of a Multiple Detection System

[0102] 1. Conditions for nucleic acid extraction

[0103] In this application, nucleic acid extraction is achieved by magnetic bead method. After the sample is lysed by lysis buffer, the released nucleic acid is captured by magnetic beads. After washing and elution, purified nucleic acid is obtained.

[0104] In this embodiment, the preferred nucleic acid extraction conditions are as follows: 0.2 mL of sample is added, and lysis is performed at 56 °C for 10 min with 0.2 mL of lysis buffer containing 10% Tween 20, 6 M guanidine hydrochloride, and 100 mM MOPS; then 0.2 mL of isopropanol and 0.2 mg of silanol magnetic beads are added, and binding is performed for 10 min; the magnetic beads are then adsorbed and washed with 70 v / v% ethanol containing 10 mM MOPS; then purified water is added, and the nucleic acid is eluted by heating at 56 °C for 5 min.

[0105] 2. Amplification System

[0106] In this application, the reduction of competitive interference and primer dimer formation in the multiplex amplification system is achieved primarily by reducing the amount of specific primers and increasing the amount of tag used. Therefore, in designing the multiplex amplification system in this embodiment, the amount of each specific primer is 0.01 μM, the amount of tag is 1 μM, the amount of Taq enzyme is 1.5 U, the amount of dNTPS is 0.3 mM, and the amount of UNG enzyme is 0.1 U.

[0107] Using the primers designed in Example 1, the amplification system was prepared according to the amount of each component of the amplification system in this example, and the extracted nucleic acid was used for single-tube PCR amplification.

[0108] The amplification conditions were: 37℃ for 10 min; 95℃ for 2 min; (95℃ for 15 s, 55℃ for 20 s, 72℃ for 20 s), 45 cycles; 72℃ for 3 min.

[0109] 3. Hybridization system

[0110] In this application, the probes for the subtypes to be detected are spotted onto the hybridization membrane using nanometer spotting technology. The dot matrix distribution of the detection probes and quality control probes for each subtype and the internal reference gene on the hybridization membrane is shown in the figure below. Figure 1 As shown, multiple products amplified by a single tube are hybridized with a hybridization membrane covering the detected subtypes, enabling simultaneous detection of multiple subtypes in a single tube.

[0111] In this embodiment, the preferred hybridization system is as follows: the concentration of each target probe on the hybridization membrane is 20 μM; the concentration of SDS in the hybridization washing solution is 10 wt%, and the buffer salt is phosphate with a concentration of 10 mM; the concentration of HPR in the enzyme conjugate solution is 0.4 μg / mL; the concentration of urea peroxide in the colorimetric solution is 0.03 wt%; the buffer salt is citrate with a concentration of 5 mM; the concentration of TMB is 0.015%, and the buffer salt is citrate with a concentration of 5 mM.

[0112] After amplification, the amplification product was hybridized with the hybridization membrane at 37°C for 15 min. Then, enzyme conjugation buffer was added, and the reaction was carried out at 37°C for 10 min. Finally, chromogenic solution (urea peroxide + TMB) was added, and the reaction was carried out for 5 min. Depending on the template added, chromogenic spots could be observed at different locations on the hybridization membrane.

[0113] Example 3: Detection of HPV subtypes

[0114] Artificially synthesized plasmids of each subtype were formulated into simulated samples of each subtype using Hek293 cells. Nucleic acid extraction, amplification, and hybridization were performed on the simulated samples according to the conditions of Example 2. The detection results are shown in Table 3.

[0115] The above-mentioned testing process was carried out automatically using automated equipment. The automated equipment used was a nucleic acid chip detector manufactured by Beijing Bohui Innovation Biotechnology Group Co., Ltd., and its appearance and internal structure diagrams are shown below. Figure 2 and 3 As shown; front and back views of the chip installed inside the device are shown below. Figure 4 and 5 As shown. The chip used in this embodiment has been granted patents (CN201110235199.2, CN201110235234.0, CN201210121023.9, CN201220175387.0).

[0116] Table 3: Detection results of HPV subtypes

[0117]

[0118] As shown in Table 3, this application can reliably detect all subtypes.

[0119] Example 4: Performance Evaluation

[0120] The automated equipment used in this embodiment is the same as that in Embodiment 3.

[0121] 1. Accuracy testing

[0122] Using the system determined in Example 2 combined with automated equipment, 10 mixed samples underwent fully automated detection and performance verification. The detection results were compared with those of commercially available products (manufacturer C in Table 1), and the results are shown in Table 4. The automated equipment used in this example is a nucleic acid chip detector manufactured by Beijing Bohui Innovation Biotechnology Group Co., Ltd., and its appearance and internal structure diagrams are shown below. Figure 2 and 3 As shown; front and back views of the chip installed inside the device are shown below. Figure 4 and 5 As shown. The chip used in this embodiment has been granted patents (CN201110235199.2, CN201110235234.0, CN201210121023.9, CN201220175387.0).

[0123] Table 4: Performance Comparison Results of the Reagent Kit in this Application with Similar Products

[0124]

[0125] As shown in Table 4, all samples that tested positive with the comparison reagent were detected using the detection method of the kit described in this application. In addition, besides detecting subtypes not included in the comparison reagent, this application also found one HPV18 positive sample. This result was confirmed by first-generation sequencing, confirming the correctness of the results in this embodiment and indicating that the detection method using the kit described in this application has higher accuracy.

[0126] 2. Specific detection

[0127] Using the system determined in Example 2 combined with automated equipment, subtypes (HPV67, 69, 70, 71, 72), Neisseria gonorrhoeae, Chlamydia trachomatis, Ureaplasma urealyticum, and Candida albicans not included in the kit of this application were subjected to fully automated detection after adding Hek293 cells. The results are shown in Table 5.

[0128] Table 5: Specific Detection Results

[0129]

[0130] As shown in Table 5, the detection results for HPV 67, 69, 70, 71, and 72 (subtypes not included in this kit) using the method of this application were all negative. The detection results for Neisseria gonorrhoeae, Chlamydia trachomatis, Ureaplasma urealyticum, and Candida albicans were also all negative. Furthermore, due to the addition of Hek293 cells, the internal control was detected normally, confirming that the detection process was normal. Therefore, these negative results indicate that the detection method using the kit described in this application has high specificity for the subtypes included in the kit.

[0131] It should be noted that the embodiments described above are only for explaining this application and do not constitute any limitation on this application. This application has been described with reference to typical embodiments, but it should be understood that the terms used therein are descriptive and explanatory terms, not limiting terms. Modifications can be made to this application within the scope of the claims, and revisions can be made to the invention without departing from the scope and spirit of this application. Although the application described herein relates to specific methods, materials, and embodiments, it does not mean that this application is limited to the specific examples disclosed herein; on the contrary, this application can be extended to all other methods and applications with the same function.

Claims

1. A primer and probe composition for human papillomavirus (HPV) nucleic acid typing detection, characterized in that, The primer-probe composition includes one universal tag primer, 28 sets of primer-probe sets for nucleic acid typing detection of 28 HPV subtypes, and one set of primer-probe sets targeting an internal reference gene; wherein each set of primer-probe sets includes one upstream primer, one downstream primer, and one probe, and the 5' end of both the upstream and downstream primers is connected to the base sequence of the universal tag primer; The base sequence of the universal tag primer is shown in SEQ ID NO:59; the base sequences of the 28 upstream primers in the 28 sets of primers and probes used for nucleic acid typing detection of 28 HPV subtypes are shown in SEQ ID NO:1-28, the base sequences of the 28 downstream primers are shown in SEQ ID NO:30-57, and the base sequences of the 28 probes are shown in SEQ ID NO:60-87. The 28 HPV subtypes are HPV6, HPV11, HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV40, HPV42, HPV43, HPV44, HPV45, HPV51, HPV52, HPV53, HPV54, HPV56, HPV58, HPV59, HPV61, HPV66, HPV68, HPV73, HPV81, HPV82, and HPV83.

2. The primer-probe composition according to claim 1, characterized in that, The primer-probe set targeting the internal reference gene contains the upstream primer sequence shown in SEQ ID NO: 29, the downstream primer sequence shown in SEQ ID NO: 58, and the probe sequence shown in SEQ ID NO:

88.

3. The primer-probe composition according to any one of claims 1-2, characterized in that, The 5' end of the universal tag primer is modified with biotin; the 5' end of each probe is modified with an amino group.

4. A fully automated detection kit for HPV nucleic acid typing, comprising the primer and probe composition as described in any one of claims 1-3.

5. The reagent kit according to claim 4, characterized in that, The kit includes nucleic acid extraction reagents, amplification reagents, and hybridization chromogenic reagents.

6. The reagent kit according to claim 5, characterized in that, The kit also includes positive and negative controls.

7. The reagent kit according to claim 6, characterized in that, The nucleic acid extraction reagent includes lysis buffer, magnetic beads, binding buffer, rinsing buffer, and elution buffer.

8. The reagent kit according to claim 7, characterized in that, The lysis buffer includes guanidine salt, surfactant, and first buffer salt; the magnetic beads are silanol magnetic beads; the binding solution is isopropanol; the rinsing solution includes second buffer salt and organic alcohol; and the eluent is water.

9. The reagent kit according to claim 8, characterized in that, The guanidine salt is guanidine hydrochloride, and the concentration of guanidine hydrochloride in the lysis buffer is 2-8M; the surfactant is Tween 20, and the concentration of Tween 20 in the lysis buffer is 1-20wt%; the first buffer salt is MOPS, and the concentration of MOPS in the lysis buffer is 20-100mM.

10. The reagent kit according to claim 8, characterized in that, The second buffer salt is MOPS, and the concentration of MOPS in the rinsing solution is 5-20 mM; the organic alcohol is ethanol, and the volume concentration of ethanol is 40-70%.

11. The reagent kit according to claim 5, characterized in that, The amplification reagents include Taq enzyme, UNG enzyme, dNTPs, specific primers, and universal tag primers; wherein the primer-probe composition contains 29 upstream primers targeting the internal reference gene and 28 HPV subtypes, and 29 downstream primers targeting the internal reference gene and 28 HPV subtypes.

12. The reagent kit according to claim 5, characterized in that, The amplification reagent contains 0.5-1.5 U of Taq enzyme, 0.03-1 U of UNG enzyme, 0.2-0.3 mM of dNTPS, 0.005-5 μM of each specific primer, and 0.1-5 μM of the universal tag primer.

13. The reagent kit according to claim 5, characterized in that, The hybridization chromogenic reagent includes a hybridization membrane, a hybridization washing solution, an enzyme conjugate solution, and a chromogenic solution, wherein the hybridization membrane is immobilized with 29 probes from the primer-probe composition targeting the internal reference gene and 28 HPV subtypes.

14. The kit according to claim 13, characterized in that, The content of each probe on the hybridization membrane is 0.2-50 μM.

15. The reagent kit according to claim 13, characterized in that, The hybridization membrane is a nylon membrane; the hybridization rinsing solution includes sodium dodecyl sulfate and a third buffer salt; the enzyme conjugation solution includes horseradish peroxidase labeled with streptavidin; and the colorimetric solution includes urea peroxide, a fourth buffer salt, and tetramethylbenzidine.

16. The reagent kit according to claim 15, characterized in that, The concentration of sodium dodecyl sulfate in the hybridization rinsing solution is 5-15 wt%; the third buffer salt is phosphate, and the concentration of phosphate in the hybridization rinsing solution is 10-100 mM; the concentration of streptavidin-labeled horseradish peroxidase in the enzyme conjugate solution is 0.1-1 μg / mL; the concentration of urea oxychloride in the chromogenic solution is 0.01-0.1 wt%; the fourth buffer salt is citrate, and the concentration of citrate in the chromogenic solution is 5-50 mM; the concentration of tetramethylbenzidine in the chromogenic solution is 0.01-0.05 wt%.

17. The reagent kit according to claim 13, characterized in that, The hybridization membrane also has a colorimetric quality control probe immobilized on it.

18. The kit according to claim 17, characterized in that, The concentration of the colorimetric quality control probe on the hybridization membrane is 0.2-50 μM.

19. The reagent kit according to claim 6, characterized in that, The positive control is Siha cells that test positive for HPV16 subtype; the negative control is HEK293 cells that test negative for all HPV subtypes.

20. A detection method for HPV nucleic acid typing for non-disease diagnostic purposes, characterized in that, The kit described in any one of claims 5-19 was used.

21. The method according to claim 20, characterized in that, The method includes the following steps: S1, The target nucleic acid in the sample to be tested is obtained using the nucleic acid extraction reagent; S2, the target nucleic acid is mixed with the amplification reagent and then subjected to multiplex PCR amplification to obtain the amplification product; S3, the amplification product is hybridized and chromogenic using the hybridization chromogenic reagent, and the chromogenic result is interpreted.

22. The method according to claim 21, wherein in step S2, the multiplex PCR amplification is performed in a single tube.

23. The method according to any one of claims 20-22, characterized in that, The method is completed automatically by fully automated equipment.

Images