A crRNA target point and crisper-cas13a system for detecting monkeypox virus
By using the CRISPR-Cas13a system to bind to monkeypox virus-specific crRNA, the problems of antigen cross-reactivity and long detection cycle in existing monkeypox virus detection methods have been solved, achieving rapid detection with high sensitivity and high specificity, and reducing laboratory safety requirements.
Patent Information
- Application Number
- CN202211197584.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-29
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2042-09-29
AI Technical Summary
Existing methods for detecting monkeypox virus suffer from problems such as antigen cross-reactivity, long detection cycles, high laboratory safety requirements, and high instrument requirements. Furthermore, there are few reports on these methods in China, making it difficult to achieve rapid, sensitive, and highly specific detection.
Using the CRISPR-Cas13a system, combined with crRNA and LwCas13a protein, monkeypox virus-specific target sequences and crRNA were designed. High-sensitivity and high-specificity monkeypox virus nucleic acid detection was achieved through RAA amplification and fluorescence quantitative PCR or test strip detection.
It achieves highly sensitive detection of monkeypox virus nucleic acid, with a sensitivity of 10 copies/μL, high specificity, short detection time, and reduced dependence on instruments and laboratory safety requirements.
Smart Images

Figure BDA0003871006660000051 
Figure BDA0003871006660000061 
Figure BDA0003871006660000062
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular diagnosis, and relates to a crRNA target point for detecting monkeypox virus and a CRISPR-Cas13a system. BACKGROUND
[0002] Monkeypox is an animal-transmitted skin rash characteristic febrile viral disease, which can be transmitted from animals to humans and from person to person through direct close contact, and belongs to zoonotic infectious disease. The detection methods of monkeypox virus include serological methods, but there is antigen cross between monkeypox virus and pox virus, and the specificity is not enough, so that the monkeypox virus cannot be accurately detected. In addition, there is a pathogen isolation method, but the detection cycle is too long, and the monkeypox virus is classified as a biological safety level III biological factor, and the laboratory biological safety requirement is extremely high. Therefore, the two methods have certain limitations in practical application. The PCR method is used for detecting the nucleic acid of monkeypox virus, and has high sensitivity, and the result can be obtained only in a few hours, and there are related reports abroad, but there are still few reports in this aspect in China. At present, the main detection technology is the fluorescent quantitative PCR method, which is stable, reliable and has certain sensitivity, but the sample processing is complex, and the instrument requirement is high.
[0003] In April 2017, American researchers established a nucleic acid detection technology with a sensitivity of an em level (single copy) and a specificity of a single base, that is, a nucleic acid detection platform SHERLOCK (Specific High Sensitivity Enzymatic Reporter UnLOCKing) based on CRISPR-Cas13a, which utilizes the non-specific cleavage activity of Leptotrichia wadei Cas13a protein (LwCas13a) and combines with the recombinase polymerase amplification technology (Recombinase Polymerase Amplification, RPA) to realize the rapid, inexpensive and high-sensitivity detection of trace nucleic acid. SUMMARY
[0004] A first object of the application is to provide a CRISPR-Cas13a system for detecting monkeypox virus.
[0005] The CRISPR-Cas13a system for detecting monkeypox virus provided by the application comprises a Cas13a protein and a crRNA, or a complex formed by the two;
[0006] The crRNA comprises an anchor sequence for binding with the Cas13a protein and a guide sequence for targeting a monkeypox virus target sequence;
[0007] The target sequence of the monkeypox virus is located at positions 46456-46483 of the monkeypox virus genome (Gene ID: 9289998).
[0008] In the CRISPR-Cas13a system, the target sequence of the monkeypox virus is sequence 1.
[0009] In the CRISPR-Cas13a system, the crRNA sequence is sequence 2. The first to 38th positions of sequence 2 are an anchoring sequence for binding with the Cas13a protein; the 39th to 66th positions of sequence 2 are a guide sequence for targeting the target sequence of the monkeypox virus.
[0010] In the CRISPR-Cas13a system, the Cas13a protein is an LwCas13a protein.
[0011] A second object of the present application is to provide a kit for detecting monkeypox virus.
[0012] The kit for detecting monkeypox virus provided by the present application comprises the CRISPR-Cas13a system for detecting monkeypox virus.
[0013] Further, the kit further comprises a primer pair for specifically amplifying the target sequence of the monkeypox virus; the primer pair consists of a single-stranded DNA molecule shown in sequence 4 and a single-stranded DNA molecule shown in sequence 5.
[0014] Still further, the kit further comprises other reagents for specifically amplifying the target sequence of the monkeypox virus and other reagents for detecting the amplification product. The other reagents for specifically amplifying the target sequence of the monkeypox virus comprise buffer and / or ddH2O; the other reagents for detecting the amplification product comprise all or part of the following reagents: LwCas13a protein, NTP (such as NTP Mix), T7 RNA polymerase, RNAse inhibitor, reporter RNA (fluorescent reporter RNA with signal reporting function or reporter RNA for test paper detection), RNase free water.
[0015] The kit can further comprise a carrier with the following determination standard A or determination standard B:
[0016] CRISPR-Cas13a fluorescent detection system judgment standard A: if the fluorescence intensity value of the detection system of the sample to be tested is 3 times higher than that of the negative control (ddH2O) at the same detection time (including the case where the fluorescence intensity value of the detection system of the sample to be tested is 3 times higher than that of the negative control), or the fluorescence intensity value of the detection system of the sample to be tested is greater than or equal to 0.2 a.u. at any time, then the sample to be tested contains or is suspected to contain monkeypox virus, otherwise the sample to be tested does not contain or is suspected not to contain monkeypox virus.
[0017] CRISPR-Cas13a test paper system judgment standard B: the system after the reaction is dropped on the test paper, and the judgment is made after 2-5 minutes, if the test paper does not show the "T" line and shows the "C" line, then the sample to be tested contains or is suspected to contain monkeypox virus; if the test paper shows the "T" line and the "C" line, then the sample to be tested does not contain or is suspected not to contain monkeypox virus; if the test paper does not show the "C" line, then the test paper is invalid and needs to be replaced for retesting.
[0018] A third object of the present application is to provide any of the following substances:
[0019] A1) the above-mentioned crRNA;
[0020] A2) the above-mentioned Cas13a protein and crRNA, or a complex formed by the two;
[0021] A3) the above-mentioned primer pair.
[0022] A third object of the present application is to provide any of the following applications:
[0023] B1) the above-mentioned system or the above-mentioned kit or the above-mentioned substance for detecting or assisting in detecting monkeypox virus;
[0024] B2) the above-mentioned system or the above-mentioned kit or the above-mentioned substance for preparing a product for detecting or assisting in detecting monkeypox virus;
[0025] B3) the above-mentioned system or the above-mentioned kit or the above-mentioned substance for detecting or assisting in detecting whether the sample to be tested contains monkeypox virus;
[0026] B4) the above-mentioned system or the above-mentioned kit or the above-mentioned substance for preparing a product for detecting or assisting in detecting whether the sample to be tested contains monkeypox virus;
[0027] B5) the above-mentioned system or the above-mentioned kit or the above-mentioned substance for screening or assisting in screening monkeypox virus prevention and treatment drugs;
[0028] B6) the above-mentioned system or the above-mentioned kit or the above-mentioned substance for preparing a product for screening or assisting in screening monkeypox virus prevention and treatment drugs;
[0029] B7) Use of the above-mentioned substances for the preparation of the above-mentioned kits.
[0030] A last object of the present application is to provide a method for detecting or aiding in the detection of monkeypox virus.
[0031] The method for detecting or aiding in the detection of monkeypox virus provided by the present application comprises the following steps:
[0032] C1) performing RAA amplification with the nucleic acid of the sample to be tested as a template and a primer pair consisting of a single-stranded DNA molecule shown in sequence 4 and a single-stranded DNA molecule shown in sequence 5 to obtain a RAA product;
[0033] C2) preparing a CRISPR-Cas13a detection system containing the following components: the RAA product, Cas13a protein, the above-mentioned crRNA, reporter RNA, NTP, T7 RNA polymerase, RNAse inhibitor; at the same time, replacing the PCR product with water (ddH2O) as a negative control; and reacting;
[0034] C3) reacting the CRISPR-Cas13a detection system, detecting the reaction product, and thereby determining whether the sample to be tested contains monkeypox virus.
[0035] The above-mentioned reaction is a fluorescent system reaction C3)-1 or a test strip system reaction C3)-2:
[0036] C3)-1: the CRISPR-Cas13a detection system, and the RNA in the CRISPR-Cas13a detection system is a fluorescent reporter RNA, the CRISPR-Cas13a detection system is placed in a fluorescent quantitative PCR instrument for reaction, the fluorescence intensity is detected, and whether the sample to be tested contains monkeypox virus is determined according to the size of the fluorescence intensity: if the fluorescence intensity value of the sample to be tested is more than 3 times (including the case where the fluorescence intensity value of the sample to be tested is 3 times the fluorescence intensity value of the negative control) the fluorescence intensity value of the negative control (ddH2O) within the same detection time, or the fluorescence intensity value of the sample to be tested is greater than or equal to 0.2 a.u. at any time, then the sample to be tested contains or is suspected to contain monkeypox virus, otherwise the sample to be tested does not contain or is suspected not to contain monkeypox virus;
[0037] C3)-2: the CRISPR-Cas13a detection system is reacted, and the RNA in the CRISPR-Cas13a detection system is a reporter RNA for test paper detection, the reaction product is detected by test paper, and whether the sample to be tested contains monkeypox virus is determined according to whether the "T" line disappears and the "C" line appears: if the "T" line of the sample to be tested disappears and the "C" line appears within the same detection time, then the sample to be tested contains or is suspected to contain monkeypox virus, otherwise the sample to be tested does not contain or is suspected not to contain monkeypox virus.
[0038] Further, in step C1), the reaction condition of the RAA amplification is: 39℃ for 20-40 minutes;
[0039] In step C3)-1 above, the reaction condition is: 37℃, reading the fluorescence intensity value every 2 minutes, for 40 times.
[0040] In step C3)-2 above, the reaction condition is: 37℃, for 30 minutes.
[0041] Further, the sample to be detected can be a blood sample, an organ (such as liver, spleen, kidney, etc.) tissue sample, cells, etc.
[0042] The method for detecting or assisting in detecting monkeypox virus provided by the application can be a non-disease diagnosis and treatment method, or a disease diagnosis and treatment method. The non-disease diagnosis and treatment method can be used to detect whether monkeypox virus is contained in cells before and after drug administration when screening monkeypox virus prevention and treatment drugs at the cellular level.
[0043] Based on the CRISPR-Cas13a nucleic acid detection technology, a target sequence for detecting monkeypox virus and a specific crRNA capable of targeting the target sequence are finally provided by designing, constructing and screening. The crRNA can activate Cas13a to realize high-sensitivity and high-specificity detection of monkeypox virus nucleic acid, and the sensitivity reaches 10 copies (10 copy / μL). BRIEF DESCRIPTION OF DRAWINGS
[0044] Figure 1 It is an agarose gel electrophoresis result diagram for screening candidate RAA primers.
[0045] Figure 2 It is a time-fluorescence curve for optimizing crRNA for detecting MPXV.
[0046] Figure 3 It is a time-fluorescence curve for screening candidate RAA primers.
[0047] Figure 4 It is a result of CRISPR-Cas13a containing crRNA-4 for detecting MPXV (30 min).
[0048] Figure 5 It is a time-fluorescence curve of CRISPR-Cas13a containing crRNA-4 for detecting MPXV.
[0049] Figure 6 It is a result of CRISPR-Cas13a containing crRNA-4 for detecting MPXV (10 min).
[0050] Figure 7 MPXV detection results for CRISPR-Cas13a containing crRNA-4 (test strip image).
[0051] Figure 8 The CRISPR-Cas13a targeting MPXV did not show cross-reactivity when detecting other pathogens (fluorescence image).
[0052] Figure 9 The CRISPR-Cas13a assay targeting MPXV showed no cross-reactivity when detecting other pathogens (30 minutes after the start of the assay).
[0053] Figure 10 The CRISPR-Cas13a assay targeting MPXV showed no cross-reactivity when detecting other pathogens (test strip image). Detailed Implementation
[0054] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.
[0055] The reagents used in the following examples and their sources are as follows: NTP mix (NEB, N0466S), 2*Super pfxMasterMix (Kangwei 07984 / 30425), LwCas13a protein (GenScript Z03486-100), agarose gel electrophoresis DNA purification and recovery kit (Tiangen Biotech, DP219-03), T7 transcription kit (T7 Quick High Yield RNASynthesis kit, NEB, E2050S), RNase inhibitor (Murine RNase inhibitor, NEB, M0314L), T7 RNA polymerase (NEB, M0251S), RNA purification magnetic beads (Agencourt RNAClean XP, Beckman Coulter, A63987), ExTaq Mix (TaKaRa, RR001Q), Tris-balanced phenol (Haoyang Biotechnology, TBD0001HY), RAA amplification kit (Hangzhou Zhongce, S001ZC), fluorescent reporter RNA (RNaseAlert) TMQC System v2, Thermo, 4479769), test paper report RNA (Tianyi Hui Yuan, 203130347), HEPES buffer (Solebao, YZ-B-HEPES250), MgCl2solution (Tiangen Biochemical, RP107), CRISPR detection test paper (Hangzhou Zhongce, 211108004).
[0056] Monkeypox virus (MPXV, GenBank ID:9289998), Benan Cossackie (Cb, GenBank ID: NZ - CP040059.1), Ebola virus (EBOV, GenBank ID:AF086833.2), Junning virus (JV, GenBank ID:2943089), Yellow fever virus (YFV, GenBank ID:NC_002031) and hepatitis B virus (HBV, GenBank ID:NC - 003977.2) respectively.
[0057] Example 1, monkeypox virus nucleic acid detection kit and detection method based on CRISPR-Cas13a system
[0058] (I) Monkeypox virus nucleic acid detection kit based on CRISPR-Cas13a system
[0059] I. Preparation of crRNA
[0060] In the monkeypox virus MPXV conserved sequence (sequence 3), 8 crRNAs were designed: MPXV-crRNA-1, MPXV-crRNA-2, MPXV-crRNA-3, MPXV-crRNA-4, MPXV-crRNA-5, MPXV-crRNA-6, MPXV-crRNA-7, MPXV-crRNA-8. The target sequence corresponding to each MPXV-crRNA sequence is as follows:
[0061] MPXV-crRNA-1 target sequence is as follows: GTCTTTTGATGATGTTATTCCGGTTAAA, located at 46491-46581 of MPXV genome (GeneID: 9289998); MPXV-crRNA-2 target sequence is as follows: TTATTTATTGGAAAGGTGTTAACCCTGT, located at 46459-46486 of MPXV genome (GeneID: 9289998); MPXV-crRNA-3 target sequence is as follows: AAATTATTTATTGGAAAGGTGTTAACCC, located at 46462-46489 of MPXV genome (GeneID: 928999); MPXV-crRNA-4 target sequence is as follows: TTTATTGGAAAGGTGTTAACCCTGTCAC (Sequence 1), located at 46456-46483 of MPXV genome (GeneID: 9289998); MPXV-crRNA-5 target sequence is as follows: GGAAAGGTGTTAACCCTGTCACCGTTAT, located at 46450-46477 of MPXV genome (GeneID: 9289998); MPXV-crRNA-6 target sequence is as follows: TGTTATTCCGGTTAAAAAAATTATTTAT, located at 46479-46506 of MPXV genome (GeneID: 9289998); MPXV-crRNA-7 target sequence is as follows: AACTAGGAGAGATTGGTCTTTTCGTATT, located at 46404-46431 of MPXV genome (GeneID: 9289998); MPXV-crRNA-8 target sequence is as follows: TAGGAGAGATTGGTCTTTTCGTATTGAA, located at 46401-46428 of MPXV genome (GeneID: 9289998).
[0062] The synthesis method of the above crRNA is as follows:
[0063] 1. Synthesis of primer sequence
[0064] Each sequence in Table 1 is synthesized.
[0065] Table 1, primer sequence
[0066]
[0067]
[0068] 2. PCR amplification
[0069] The sequence synthesized in step 1 above was diluted with ddH2O to 10 μM to prepare a PCR reaction system. The PCR reaction system was prepared as shown in Table 2.
[0070] Table 2, PCR amplification system
[0071]
[0072]
[0073] PCR reaction conditions: 95°C for 5 min for thermal denaturation; 95°C for 30 s, 55°C for 30 s, 72°C for 15 s, for a total of 38 cycles; 72°C for automatic extension for 10 min; 4°C for storing the PCR product. Eight PCR products amplified by the gRNA-MPXV primer pairs shown in Table 1 were obtained.
[0074] 3, PCR product purification
[0075] The eight PCR products obtained in step 2 were purified using Tris-balanced phenol, and the specific steps were as follows: 500 μL of Tris-balanced phenol (Cantabio) was taken, an equal volume of chloroform was added, and after oscillation and mixing, a short centrifugation was performed, and the supernatant was discarded; 150 μL of the phenol-chloroform mixture was added to the PCR product, mixed, and centrifuged at 12,000 rpm for 1 min; the supernatant was taken into a new 1.5 mL centrifuge tube, anhydrous ethanol was added to make the ratio of supernatant to ethanol 3:7, and centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded; 200 μL of 75% ethanol was added, and centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded (this step was performed three times). The obtained precipitate was air-dried at room temperature (about 10 min) to obtain eight purified PCR products.
[0076] The above eight purified PCR products were added to 50 μL of RNase-free water, and the concentration was detected by Nanodrop, and stored at -80°C.
[0077] 4, transcription
[0078] 1 μg of the eight purified PCR product aqueous solutions obtained in step 3 was taken, and a T7 transcription kit (NEB) was used to transcribe crRNA. The crRNA transcription system is shown in Table 3.
[0079] Table 3, crRNA transcription system
[0080] Name Volume NTP Mix 10 μL (final concentration of each NTP is 6.7 mM) Purified PCR product (step 3) Final concentration is 1 μg T7 RNA polymerase Final concentration is 2 μL Nuclease-free water X μL (the rest is water) Total volume 20 μL
[0081] After mixing the above crRNA transcription system, transcription was performed at 37°C overnight, and DNase I was used to remove excess DNA: the transcription product obtained in the above step was added to 20 μL of RNase-free water, 2 μL of DNase I was added, mixed, and incubated at 37°C for 15 min.
[0082] The obtained crRNA sequences were named MPXV-crRNA-1, MPXV-crRNA-2, MPXV-crRNA-3, MPXV-crRNA-4, MPXV-crRNA-5, MPXV-crRNA-6, MPXV-crRNA-7, MPXV-crRNA-8, wherein the MPXV-crRNA-4 sequence is as follows: GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGUGACAGGGUUAACACCUUUCCAAUAAA (sequence 2), wherein the 1st-38th of sequence 2 is an anchor sequence for binding with the Cas13a protein; the 39th-66th of sequence 2 is a guide sequence targeting the MPXV target sequence.
[0083] The MPXV-crRNA-4 target sequence is as follows: TTTATTGGAAAGGTGTTAACCCTGTCAC (sequence 1), located at the 46456-46483th of the MPXV genome (Gene ID: 9289998). The prepared MPXV-crRNA-4 is used for subsequent CRISPR-Cas13a detection.
[0084] 5. crRNA purification
[0085] The crRNA obtained by transcription in step 4 was purified according to the Agencourt RNA Clean XP instructions (Beckman Coulter), and the specific steps were as follows: magnetic bead oscillation mixing, 1.8 times the volume of magnetic beads was added to the transcription product, and the magnetic beads and transcription system were mixed by blowing 10 times or vortexing 30 s, and then the reaction system was placed in a magnetic stand and incubated at room temperature for 5-10 min to separate the magnetic beads. The liquid in the system was gently sucked out to avoid the magnetic beads being sucked out, 200 μL of 70% ethanol (prepared with RNase-free water) was added to the magnetic beads, and the system was incubated at room temperature for 30 s, and then the ethanol was sucked out; the magnetic beads were washed by repeating the above process for 3 times. The system was air-dried at room temperature to remove the ethanol, about 10 min. 50 μL of RNase-free water was added, vortexed for 30 s or blown for 10 times with a pipette, and then the supernatant was sucked out and placed in an RNase-free 1.5 mL centrifuge tube. The concentration of the purified crRNA was determined by Nanodrop and diluted to 100 ng / μL, and then stored at -80°C.
[0086] The above crRNA sequence is used for the following CRISPR-Cas13a detection of monkeypox virus.
[0087] II. Preparation of plasmid standard
[0088] 1. Plasmid sequence
[0089] Plasmid-MPXV is a recombinant plasmid obtained by inserting the sequence from monkeypox virus genome: ATGGAGAAGCGAGAAGTTAATAAAGCTCTGTATGATCTTCAACGTAGTACTATGGTGTACAGTTCCGACGATACTCCTCCTCGTTGGTCTACGACAATGGATGCTGATACACGGCCTACAGATTCTGATGCTGATGCTATAATAGATGATGTATCCCGCGAAAAATCAATGAGAGAGGATAATAAGTCTTTTGATGATGTTATTCCGGTTAAAAAAATTATTTATTGGAAAGGTGTTAACCCTGTCACCGTTATTAATGAGTACTGCCAAATAACTAGGAGAGATTGGTCTTTTCGTATTGAATCAGTGGGGCCTAGTAACTCTCCTACATTTTATGCCTGTGTAGACATTGACGGAAGAGTATTCGATAAGGCAGATGGAAAATCTAAACGAGATGCTAAAAATAATGCAGCTAAATTGGCTGTAGATAAACTTCTTAGTTATGTCATCATTAGATTCTGA (Sequence 3) into pUC57 vector (Beijing Tianyi Huiyuan Company).
[0090] The Plasmid-MPXV was transformed into E. coli TOP10 bacteria to obtain a recombinant bacteria, which is the glycerol bacteria used below.
[0091] 2, Plasmid extraction (full gold)
[0092] The glycerol bacteria (1:500) obtained in the above 1 was added with Amp +LB (10 μL glycerol bacteria + 5 ml LB), 37℃, 200 rpm overnight inoculation, take the overnight culture of bacteria, 10000 g centrifugal 1 min, remove supernatant (as much as possible to suck). If the amount of bacteria is too large, can be collected by centrifugation several times. Add colorless solution RB (containing RNase A) 250 μL, shake the bacterial precipitate, should not leave small bacteria. Add blue solution LB 250 μL, gently up and down turn 4-6 times, so that the bacteria are fully lysed, forming a blue transparent solution, the color from translucent to bright blue, indicating complete lysis (not more than 5 min). Add yellow solution NB 350 μL, gently mix 5-6 times (the color from blue to yellow completely, indicating uniform mixing, complete neutralization), until a tight yellow agglomeration is formed, room temperature for 2 min. 12000 g centrifugal 5 min, carefully suck the supernatant into the centrifugal column. 12000 g centrifugal 1 min, discard the effluent. If the volume of supernatant is greater than 800 μL, can be added to the column several times, and centrifuged, discard the effluent. Add 650 μL solution WB, 12000 g centrifugal 1 min, discard the effluent. 12000 g centrifugal 1-2 min, thoroughly remove the residual WB. The centrifugal column is placed in a clean centrifugal tube, 30-50 μL EB or deionized water (PH>7.0) is added to the center of the column, and room temperature is kept for 1 min. 10000 g centrifugal 1 min, elute the DNA, measure the concentration, and store at -20℃.
[0093] 3. Plasmid concentration determination
[0094] The concentration of the plasmid Plasmid-MPXV extracted above was determined by Thermo ultramicro spectrophotometer to be 40 ng / μL.
[0095] The length of the plasmid Plasmid-MPXV was 3172 bp.
[0096] Formula: copies / μL = 6.02 × 10 23 × (ng / μL) × 10 -9 / DNA Length × 660.
[0097] The copy number of the plasmid Plasmid-MPXV was 1 × 10 10 copies / μL.
[0098] 4. Dilution
[0099] Take 10 μL of plasmid Plasmid-MPXV into 90 μL of water to obtain a concentration of 1 × 10 9 copies / μL plasmid standard.
[0100] III. Design of RAA amplification primer and obtaining of RAA amplification product
[0101] 1. Design of RAA amplification primers
[0102] The RPA primer design according to the reference (PMID: 27246147) is intended to be used for MPXV virus-specific RAA primers for CRISPR detection, and has a T7 transcription sequence at the 5' end of the primer, so that the double-stranded DNA (dsDNA) obtained by RAA amplification can be recognized by T7 RNA polymerase and transcribed. The primer sequence is shown in Table 4, which is synthesized by Beijing Tianyihuiyuan Company.
[0103] Table 4, MPXV-RAA amplification primers
[0104]
[0105]
[0106] 2. Obtaining of RAA amplification product
[0107] Using the plasmid standard as a template, the primers designed in step 1 are used for RAA amplification to obtain the RAA amplification product. The RAA amplification system is shown in Table 5.
[0108] Table 5, RAA amplification system
[0109] Name Volume Plasmid-MPXV 5 μL MPXV-F (10 μM) 2 μL MPXV-R (10 μM) 2 μL A Buffer (component in RAA amplification kit) 25 μL ddH2O 13.5 μL Total volume 47.5 μL
[0110] Add 47.5 μL of the mixed solution to the base reaction unit containing the lyophilized powder, and fully resuspend and evenly distribute the lyophilized powder. Add 2.5 μL of magnesium acetate aqueous solution (B Buffer) to the cap of each reaction tube, close the tube cap, collect and mix evenly. Place the above reaction tube in a 39°C condition for 30 minutes to obtain the RAA amplification product.
[0111] (II) Method for detecting monkeypox virus nucleic acid based on CRISPR-Cas13a system
[0112] I. Preparation of CRISPR-Cas13a fluorescence detection system
[0113] Extract the nucleic acid of the sample to be tested, and use the primers MPXV-RAA-F5 and MPXV-RAA-R1 in 1 of the above (I) to perform RAA amplification on the nucleic acid of the sample to be tested to obtain the RAA amplification product;
[0114] Take 5 μL of the above obtained RAA amplification product as a template, and prepare the CRISPR-Cas13a detection system as shown in Table 6 below.
[0115] The RAA product in Table 6 is replaced with ddH2O, and the other reagent components remain unchanged, which is the negative control.
[0116] Table 6, CRISPR-Cas13a fluorescence detection system
[0117]
[0118]
[0119] The PCR tube containing the reaction system shown in Table 6 above is placed in a fluorescence quantitative PCR instrument, the channel excitation wavelength is set to 490 nm, the emission wavelength is set to 520 nm, 37°C, and the value is read once every 2 min, a total of 40 times, for 80 min, and the fluorescence intensity change in the detection system is detected.
[0120] Result determination: In the same detection time, if the fluorescence intensity value of the experimental group is more than 3 times higher than that of the negative control (ddH2O), it is determined to be a positive result, or at any time, the fluorescence intensity is greater than or equal to 0.2 a.u. (3 times the highest value that the fluorescence intensity of the negative control can reach), it is determined to be a positive result, that is, the sample to be tested contains or is suspected to contain monkeypox virus or monkeypox virus nucleic acid; otherwise, it is a negative result, that is, the sample to be tested does not contain or is suspected to not contain monkeypox virus or monkeypox virus nucleic acid.
[0121] II. Preparation of CRISPR-Cas13a test paper detection system
[0122] Extract the nucleic acid of the sample to be tested, and use the primers MPXV-RAA-F5 and MPXV-RAA-R1 in (I) 3 (1) above to perform RAA amplification on the nucleic acid of the sample to be tested, to obtain RAA amplification product;
[0123] Take 5 μL of the RAA amplification product obtained above as a template, and prepare a CRISPR-Cas13a detection system according to Table 7 below.
[0124] The RAA product in Table 7 is replaced with ddH2O, and the other reagent components remain unchanged, which is the negative control.
[0125] Table 7, CRISPR-Cas13a test paper detection system
[0126]
[0127]
[0128] The reaction tube containing the reaction system shown in Table 7 was capped, mixed for 5-6 times upside down, and centrifuged at low speed for 10 seconds. The above reaction tube was placed at 37°C for 30 minutes. After the reaction was completed, the entire reaction system (50 μL) was added to the sample addition hole of the CRISPR detection test paper.
[0129] Result determination: The reaction system was dropped on the test paper 2-5 minutes after the detection reaction, and the interpretation was carried out. If the test paper did not show the "T" line and showed the "C" line, the sample contained or candidate contained monkeypox virus; if the test paper showed the "T" line and the "C" line, the sample did not contain or candidate did not contain monkeypox virus; if the test paper did not show the "C" line, the test paper was invalid and needed to be replaced for retesting.
[0130] (Three) Condition optimization of the method for detecting monkeypox virus nucleic acid based on the CRISPR-Cas13a system
[0131] I. Screening of optimal primers
[0132] The dilution concentration of 1×10 9 copies / μL plasmid standard prepared in (I) was used as a template, and RAA amplification was carried out by the method of 2 in (I) (3) above, and the primers were the combinations of each primer shown in Table 4 (combination form as shown in Table 4). Figure 1
[0133] The amplification product with water as a template was set as a negative control.
[0134] 20 μL of the amplification product was taken, 20 μL of chloroform:Tris balanced phenol=1:1 (volume ratio) was added, and the reaction product was mixed, shaken, and centrifuged for 10 min. The supernatant mixture was discarded, shaken, and centrifuged at 10000 rpm for 10 min. 10 μL of the supernatant was taken, 3 μL of 6*Loading Buffer was added, mixed, and then agarose gel electrophoresis was carried out.
[0135] 1.5% agarose gel was configured, the voltage U=150V, the current I=150mA, the time T=30min, electrophoresis detection, and the electrophoresis band was observed.
[0136] As shown in Table 5, compared with other cross-combined primer pairs, F4&R1, F5&R1, F6&R1, F6&R2, F6&R3, F6&R5, and F6&R6 had higher amplification efficiency, and had obvious bands. Figure 1
[0137] Then, CRISPR fluorescence screening was performed: the method in Example 1(II)1 was used, wherein the RAA amplification primers were F4&R1, F5&R1, F6&R1, F6&R2, F6&R3, F6&R5, and F6&R6, and the crRNA was MPXV-crRNA-4.
[0138] The results are as follows Figure 3 As shown, F4R1-5 indicates that the RAA amplification primers are F4 & R1 and the crRNA is MPXV-crRNA-4, with a template of 10. 5 copies / μL; and so on, F4R1-0 indicates that the RAA amplification primers are F4&R1 and the crRNA is MPXV-crRNA-4, with a template of 10 copies / μL; 0 copies / μL, F4R1-(-1) indicates that the RAA amplification primers are F4&R1 and the crRNA is MPXV-crRNA-4, with a template of 10 -1 copies / μL, F4R1-(NC) indicates that the RAA amplification primers are F4&R1 and the crRNA is MPXV-crRNA-4, and the template is water; the F5&R1 primers have higher fluorescence values and higher sensitivity. Therefore, the combination of MPXV-RAA-F5 and MPXV-RAA-R1 is the best amplification primer for RAA amplification against MPXV virus.
[0139] II. Optimal crRNA Screening
[0140] 1) Synthesis of crRNA primer sequences
[0141] Eight MPXV-crRNAs were synthesized and prepared using the method described in Example 1(a).
[0142] 2) The diluted concentration obtained by the method in step 2 of Example 1(a) is 1×10⁻⁶. 9 Using copies / μL of plasmid standard as a template, RAA amplification was performed according to the method in step 2 of section 3 of Example 1, with F5R1 (the optimal primer) as the primer, to obtain the RAA amplification product.
[0143] 3) Take 5 μL of the LRAA amplification product and detect different crRNA monkeypox virus nucleic acids according to the method in (II) of Example 1. At the same time, set up the amplification product with water as a template as a negative control. The crRNAs in the above (II) method are the above 8 MPXV-crRNAs.
[0144] Test results as follows Figure 2As shown, when using the same concentration of MPXV as a template, the fluorescence value detected by MPXV-crRNA-4 is higher than that detected by the other 7 crRNAs. Therefore, MPXV-crRNA-4 is the optimal crRNA.
[0145] Example 2: Sensitivity detection of monkeypox virus nucleic acid based on CRISPR-Cas13a system
[0146] Using serially diluted plasmid standards as templates, plasmids containing different concentrations of the MPXV gene fragment were detected according to the method in Example 1 to test the sensitivity of the method of the present invention. The specific steps are as follows:
[0147] 1. The plasmid standard obtained in step (a) of Example 1 was serially diluted with water to obtain plasmid solutions containing different concentrations of MPXV gene fragments: 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 10 -1 copies / μL.
[0148] 2. Perform RAA amplification according to the method in step (I) of Example 1, using MPXV-RAA-F5 and MPXV-RAA-R1 (optimal primers) to obtain RAA amplification products.
[0149] 3. CRISPR fluorescence detection:
[0150] Take 5 μL of the LRAA amplification product and detect monkeypox virus nucleic acid using the CRISPR-Cas13a fluorescence system according to the method in step (II) of Example 1. Simultaneously, use the amplification product with water as a template as a negative control. The crRNA is MPXV-crRNA-4.
[0151] CRISPR-Cas13a detection results are as follows: Figure 4 and Figure 5 As shown, 10 -1 -10 5 The fluorescence signal of the plasmid amplification product at copies / μL began to increase after the reaction started, while the fluorescence intensity in the negative control group (ddH2O) did not increase over time. The fluorescence value of the experimental group containing monkeypox virus nucleic acid was significantly higher than that of the negative control. Figure 4 ).
[0152] From the 10th minute after the start of the test, 105 copies / μL to 10 -1 copies / μL template correspond to the fluorescence signal of 0.56±0.17 a.u., 0.59±0.16 a.u., 0.57±0.05 a.u., 0.66±0.39 a.u., 0.22±0.09 a.u., 0.04±0.05 a.u., 0.05±0.05 a.u., and the fluorescence signal of the negative control was 0.02±0.002 a.u. Figure 6 Compared with the negative control, the fluorescence intensity had statistical difference (T test, P<0.001), and the results showed that the CRISPR-Cas13a detection system involved in the present application could detect MPXV nucleic acid in the shortest 2 minutes, and the sensitivity reached ten copies (10 copy / μL).
[0153] 4. CRISPR test paper detection
[0154] After completing the above step 2, 5 μL of RAA amplification product was taken to detect MPXV nucleic acid based on the RAA-CRISPR / Cas13a system according to the method of the second method in step (two) in Example 1, and the amplification product of ddH2O as template was set as the negative control. The crRNA was MPXV-crRNA4, and the primers were MPXV-RAA-F5 and MPXV-RAA-R1.
[0155] The RAA-CRISPR test paper detection results are shown in Figure 7 , when MPXV-crRNA4 was used to detect MPXV template, the "T" line disappeared and the "C" line appeared in the 10 5 -10 1 copies / μL group, the "T" line and the "C" line appeared in the 10 0 copies / μL group, the 10 -1 copies / μL group, and the negative control group, so MPXV-crRNA4 could be used to detect MPXV site, and the sensitivity reached ten copies (10 copy / μL), and it was determined that the 10 5 -10 1 copy / μL group was positive, and the 10 0 copy / μL group, the 10 -1 copy / μL group and the negative control group were negative, indicating that the sensitivity of the method was 10 copy / μL Figure 7 .
[0156] Example 3, Specific detection of monkeypox virus nucleic acid based on CRISPR-Cas13a system
[0157] The specificity of the method of the application was verified by detecting different viral nucleic acids using the method in Example 1 (ii) with C. burnetii (Cb), Ebola virus (EBOV), Junin virus (JV), Monkeypox virus (YFV) and Hepatitis B virus (HBV) pathogen nucleic acids as templates, respectively. The specific steps are as follows:
[0158] 1. C. burnetii (Cb), Ebola virus (EBOV), Junin virus (JV), Monkeypox virus (YFV) and Hepatitis B virus (HBV) pathogen nucleic acids were used as detection templates, and the method in step (i) of Example 1 was used for RAA amplification to obtain RAA amplification products. Primers MPXV-RAA-F5 and MPXV-RAA-R1 were used.
[0159] 2. 5 μL of the RAA amplification product was used to detect each viral nucleic acid based on the CRISPR-Cas13a fluorescence system according to the method in (i) of step (ii) of Example 1, and the amplification product with water as the template was set as the negative control. The crRNA was MPXV-crRNA4.
[0160] The CRISPR-Cas13a detection results are shown in Figure 8 and Figure 9 The fluorescence signal of the experimental group containing MPXV began to rise after the start of the reaction, while the fluorescence intensity of the negative control group (ddH2O) and the experimental group containing other viral nucleic acids did not increase over time, and the fluorescence intensity of the experimental group containing the MPXV gene was significantly higher than that of the negative control and other viral groups ( Figure 8 ). The fluorescence intensity of the experimental group containing the MPXV gene was 150 times that of the negative control and other viral groups at 30 minutes after the start of the detection ( Figure 9 ). This indicates that the method for detecting Monkeypox virus nucleic acid based on the CRISPR-Cas13a system of the application has high specificity, and there is no cross-reaction during the detection process.
[0161] 3. After step 1 was completed, 5 μL of the RAA amplification product was used to detect each viral nucleic acid based on the CRISPR-Cas13a system test paper according to the method in (ii) of Example 1, and the amplification product with water as the template was set as the negative control. The crRNA was MPXV-crRNA4.
[0162] The results showed that the "T" line disappeared and the "C" line appeared in the experimental group containing the MPXV gene, while the "T" line and the "C" line appeared in the negative control group (ddH2O) and the experimental group with nucleic acids ( Figure 10 ).
[0163] The method for detecting the monkeypox virus site based on the CRISPR-Cas13a system of the present application has high specificity, and there is no cross reaction in the detection process.
[0164] The above only describes the preferred embodiments of the present application, and it should be pointed out that for ordinary skilled persons in the art, several improvements and refinements can be made without departing from the technical principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. A CRISPR-Cas13a system for detecting monkeypox virus, comprising a Cas13a protein and a crRNA, or a complex formed by both; the crRNA comprises an anchor sequence for binding with the Cas13a protein and a guide sequence targeting a monkeypox virus target sequence; the monkeypox virus target sequence is sequence 1; the crRNA sequence is sequence 2. The Cas13a protein is a LwCas13a protein.
2. The CRISPR-Casl3a system of claim 1, wherein:
3. A kit for detecting monkeypox virus, comprising the CRISPR-Cas13a system for detecting monkeypox virus according to claim 1 or 2. The kit further comprises RAA amplification primers for specifically amplifying the monkeypox virus target sequence; the RAA amplification primers consist of a single-stranded DNA molecule represented by sequence 4 and a single-stranded DNA molecule represented by sequence 5.
4. The kit of claim 3, wherein:
5. Any of the following: A1) the crRNA according to claim 1 or 2; A2) the Cas13a protein and the crRNA according to claim 1 or 2, or a complex formed by both.
6. Any of the following applications: B1) the system according to claim 1 or 2 or the kit according to claim 3 or 4 or the substance according to claim 5 for non-disease diagnosis and treatment purposes in detecting or assisting in detecting monkeypox virus or its nucleic acid; B2) the system according to claim 1 or 2 or the kit according to claim 3 or 4 or the substance according to claim 5 for use in the preparation of a product for detecting or assisting in detecting monkeypox virus or its nucleic acid; B3) the system according to claim 1 or 2 or the kit according to claim 3 or 4 or the substance according to claim 5 for non-disease diagnosis and treatment purposes in detecting or assisting in detecting whether the test sample contains monkeypox virus or its nucleic acid; B4) the system according to claim 1 or 2 or the kit according to claim 3 or 4 or the substance according to claim 5 for use in the preparation of a product for detecting or assisting in detecting whether the test sample contains monkeypox virus or its nucleic acid; B5) the system according to claim 1 or 2 or the kit according to claim 3 or 4 or the substance according to claim 5 for use in screening or assisting in screening monkeypox virus prevention and treatment drugs; B6) the system according to claim 1 or 2 or the kit according to claim 3 or 4 or the substance according to claim 5 for use in the preparation of a product for screening or assisting in screening monkeypox virus prevention and treatment drugs; B7) the substance according to claim 5 for use in the preparation of the kit according to claim 3 or 4. 7. A method for detecting or assisting in detecting monkeypox virus for non-disease diagnosis and treatment purposes, comprising the following steps: C1) using a nucleic acid of a sample to be tested as a template, performing RAA amplification with a primer pair consisting of a single-stranded DNA molecule shown in sequence 4 and a single-stranded DNA molecule shown in sequence 5, to obtain a RAA product; C2) preparing a CRISPR-Cas13a detection system containing the following components: the RAA product, the Cas13a protein described in claim 1 or 2, the crRNA described in claim 1 or 2, the reporter RNA, NTP, T7 RNA polymerase, RNAse inhibitor; at the same time, using water instead of the PCR product as a negative control; C3) reacting the CRISPR-Cas13a detection system, detecting the reaction product, and thereby determining whether the sample to be tested contains monkeypox virus.
8. The method of claim 7, wherein: In step C1), the reaction conditions for the RAA amplification are: 39°C for 30 minutes.
Citation Information
Patent Citations
crRNA target point and CRISPR-Cas13a system for detecting Ebola virus
CN110628955A
Crispr effector system based diagnostics
US20200254443A1