A fluorescent sensor for detecting L-lactic acid and a construction method and application thereof

Abstract

The present application belongs to the field of genetic engineering and biological detection technology, and particularly relates to a fluorescence sensor for detecting L-lactic acid and a construction method and application thereof. The present application develops the fluorescence sensor for detecting L-lactic acid by using the fluorescence resonance energy transfer technology and the specific transcriptional regulator LldR, and the fluorescence sensor is specifically composed of a cyan fluorescent protein mTFP, a specific transcriptional regulator LldR derived from Salmonella typhimurium and a yellow fluorescent protein Venus. The fluorescence sensor has the advantages of high sensitivity, good specificity, simple preparation, low cost, simple composition, easy operation, high-throughput detection and the like, and can be widely applied to many fields related to L-lactic acid in food, medicine and chemical industry, and thus has good practical application value.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering and biological detection technology, and particularly relates to a fluorescent sensor for detecting L-lactic acid and a construction method and application thereof. BACKGROUND

[0002] The information disclosed in this Background section is only for the purpose of increasing the understanding of the general background of the application and does not necessarily constitute an admission or a recognition that the information forms part of the prior art that is already known in any country in the world.

[0003] Lactic acid has two stereoisomers: L-lactic acid and D-lactic acid. The lactic acid produced in the human body is mainly L-lactic acid. Studies have shown that high L-lactic acid levels are associated with severe clinical conditions such as sepsis, cardiac arrest and liver failure. L-lactic acid levels are also an important parameter affecting the flavor or quality of various foods, such as wine, dairy products, flavored beverages, yogurt, etc. In addition, optically pure L-lactic acid has been widely used in the synthesis of biodegradable bio-plastics polylactic acid, and currently L-lactic acid is mainly produced by microbial fermentation pathways. Therefore, continuous monitoring of L-lactic acid is crucial for human dynamic health assessment, food industry and fermentation production.

[0004] Traditional detection methods for L-lactic acid include colorimetric method, spectrophotometry, fluorescence method, high performance liquid chromatography and liquid chromatography-mass spectrometry, etc. However, some of these methods such as liquid chromatography-mass spectrometry have limitations such as high detection cost, long time consumption, complex operation, and inability to achieve high throughput. Biosensors, as a promising analytical tool, have attracted much attention due to their high sensitivity and specificity in compound quantification, portability, low cost, etc. At present, a variety of electrochemical biosensors have been developed for the quantitative detection of L-lactic acid.

[0005] In addition to electrochemical transduction signals, methods of optical transduction signals are also widely used in the construction of biosensors. For example, Laconic, GEM-IL, Green Lindoblum, eLACCO1.1, LARS, LiLac, etc. A variety of fluorescent sensors have been developed for the quantitative detection of lactic acid. These fluorescent sensors use bacterial allosteric transcription factors, periplasmic binding proteins, G protein-coupled receptors or chemotactic proteins as recognition elements to detect lactic acid. However, the recognition elements of the reported lactic acid fluorescent sensors do not have stereoselectivity and detect L-lactic acid and D-lactic acid. Therefore, there is an urgent need for a highly stereoselective L-lactic acid fluorescent sensor to meet the needs of quantitative detection of L-lactic acid. SUMMARY

[0006] In order to overcome the above technical problems, the present application provides a fluorescent sensor for detecting L-lactic acid and a construction method and application thereof. Specifically, the present application develops a fluorescent sensor for detecting L-lactic acid based on the fluorescence energy resonance transfer technology and the specific transcriptional regulator LldR derived from Salmonella typhimurium, which has the advantages of high sensitivity, good specificity, simple preparation, low cost, simple composition, easy operation and high-throughput detection, etc. Based on the above research results, the present application is completed.

[0007] In order to achieve the above technical purposes, the technical solutions adopted by the present application are as follows:

[0008] In a first aspect of the present application, a fusion protein is provided, which comprises at least one L-lactic acid-specific transcriptional regulator and at least two fluorescent proteins respectively connected to both ends of the L-lactic acid-specific transcriptional regulator.

[0009] The L-lactic acid-specific transcriptional regulator is a specific transcriptional regulator LldR derived from Salmonella enterica serovar Typhimurium LT2 ATCC 14028, which is a transcriptional regulator capable of specifically responding to L-lactic acid discovered by the inventors.

[0010] The fusion protein is selected from:

[0011] (a1) a protein consisting of the amino acid sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2;

[0012] (a2) a protein having the same function obtained by substituting, deleting and / or adding one or more amino acid residues in the amino acid sequence shown in (a1);

[0013] (a3) a protein having an identity of 50% or more to the amino acid sequence shown in (a1) or (a2) and having the same function as the protein shown in (a1) or (a2).

[0014] In a second aspect of the present application, a nucleic acid molecule capable of encoding the above-mentioned fusion protein is provided.

[0015] In a third aspect of the present application, a recombinant expression vector containing the above-mentioned nucleic acid molecule is provided.

[0016] In a fourth aspect of the present application, a transformed cell containing the above-mentioned nucleic acid molecule, containing the above-mentioned recombinant expression vector or capable of expressing the above-mentioned fusion protein is provided.

[0017] In a fifth aspect of the present application, the fusion protein, the nucleic acid molecule, the recombinant expression vector and / or the transformed cell are used for preparing a fluorescent sensor for detecting L-lactic acid.

[0018] In a sixth aspect of the present application, a fluorescent sensor for detecting L-lactic acid is provided, which comprises the fusion protein, the nucleic acid molecule, the recombinant expression vector and / or the transformed cell.

[0019] In a seventh aspect of the present application, a method for constructing the fluorescent sensor for detecting L-lactic acid is provided, which comprises at least constructing the fusion protein, and the specific steps are as follows:

[0020] The coding gene lldR of the specific transcriptional regulatory factor LldR is inserted into a plasmid to obtain a recombinant plasmid, and the recombinant plasmid is transformed into the transformed cell for expression.

[0021] In an eighth aspect of the present application, a method for detecting L-lactic acid is provided, which comprises: co-incubating a sample to be detected with the fusion protein or the fluorescent sensor, and detecting and analyzing the concentration or presence or absence of L-lactic acid according to the change in the fluorescence emission intensity ratio of the fluorescent proteins.

[0022] In a ninth aspect of the present application, the fusion protein, the fluorescent sensor and / or the detection method are applied in the fields of food, medicine, chemical industry and the like.

[0023] The above one or more technical solutions have the following beneficial technical effects:

[0024] (1) The L-lactic acid fluorescent sensor provided by the above technical solution uses the specific transcriptional regulatory factor LldR derived from Salmonella typhimurium ATCC 14028 as a recognition element, utilizes the feature that the conformation of LldR changes after binding with L-lactic acid, and combines the fluorescence energy resonance transfer technology, so that the concentration of L-lactic acid can be converted into the fluorescence emission intensity ratio for output, and the fluorescence emission intensity ratio of the two fluorescent proteins is related to the concentration of L-lactic acid in the sample;

[0025] (2) The L-lactic acid fluorescent sensor provided by the above technical solution inserts the specific transcriptional regulatory factor LldR into the fusion protein composed of the cyan fluorescent protein mTFP and the yellow fluorescent protein Venus, and the detection system only comprises the L-lactic acid fluorescent sensor and the buffer, so that the sensitivity is high, the specificity is good, the preparation is simple, the components are simple, the cost is low, the operation is easy, and high-throughput detection can be realized;

[0026] (3) The L-lactic acid fluorescent sensor provided by the technical scheme has high consistency with the theoretical concentration in quantifying the concentration of L-lactic acid in microbial fermentation liquor, food such as enzyme and yogurt and other biological samples, and has a wide application prospect in L-lactic acid detection of various biological samples. BRIEF DESCRIPTION OF DRAWINGS

[0027] The drawings constituting a part of this specification provide further understanding of the present application, the illustrative embodiments of the present application and their descriptions serve the purpose of explaining the present application, and do not constitute an improper limitation to the present application.

[0028] Figure 1 SDS-PAGE verification of LldR expression and purification in Example 1 of the present application. Lane M, Marker molecular weight; Lane 1, crude extract of LldR expression; Lane 2, purified LldR.

[0029] Figure 2 FILLac 0N0C Dose-response curve of L-lactic acid.

[0030] Figure 3 FILLac 10N0C Dose-response curve of L-lactic acid.

[0031] Figure 4 FILLac 10N0C pH stability analysis.

[0032] Figure 5 FILLac 10N0C Spectroscopic property analysis.

[0033] Figure 6 FILLac 10N0C Specificity analysis.

[0034] Figure 7 FILLac 10N0C Temperature sensitivity analysis.

[0035] Figure 8 FILLac 10N0C Consistency analysis with high performance liquid chromatography detection of L-lactic acid results.

[0036] Figure 9 FILLac 10N0C Consistency analysis with SBA-40D type biological sensor automatic analyzer detection of L-lactic acid results.

[0037] Figure 10 FILLac for Example 5 of the present application 10N0C Quantitative results of L-lactic acid in microbial fermentation broth.

[0038] Figure 11 FILLac for Example 6 of the present application 10N0C Quantitative results of L-lactic acid in enzyme and yogurt; the sample to be tested in A is enzyme, and the sample to be tested in B is yogurt. DETAILED DESCRIPTION

[0039] It should be noted that the following detailed description is illustrative only, and is intended to provide further description of the application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0040] It is also important to note that the terms "comprises", "comprising", "includes", "including", "contains", "containing" or variations thereof herein, do not specify an exhaustive or complete list of components or features as used by those skilled in the art. Unless otherwise expressly specified, it is in context for the term "comprising" to allow for elements, features or components not specifically listed. Unless otherwise expressly stated, the term "or" as used herein, is intended to mean an inclusive "or" rather than an exclusive "or". That is, unless specified otherwise, or clear from the context, the phrase "X employs A or B" is intended to mean that the process of X at least employs A, or B.

[0041] As mentioned above, the existing lactic acid biosensors such as Laconic, eLACCO1.1, LiLac, etc. can be used to monitor intracellular lactic acid metabolism, but these sensors do not have stereoselectivity and cannot achieve selective detection of L-lactic acid.

[0042] The fluorescence sensor based on fluorescence energy resonance transfer technology is composed of a biological recognition element and a pair of donor and acceptor fluorescent protein pairs. This type of fluorescence biosensor has been widely used to detect various small molecule metabolites and to study various physiological activities in single cells or subcellular compartments. The allosteric transcription factor of bacteria is composed of a DNA binding domain that binds to specific DNA operator sequences and a ligand binding domain that senses ligands. A variety of allosteric transcription factors have been used as recognition elements for the construction of fluorescence sensors. The binding of the test substance to the biological recognition element causes a change in its conformation, affecting the relative distance and spatial orientation of the donor and acceptor fluorescent proteins fused at both ends of the biological recognition element, resulting in a change in the fluorescence emission intensity ratio between the fluorescent proteins. This change can be used as a quantitative indicator for the detection of related metabolites.

[0043] In view of this, the present application develops a fluorescent sensor capable of detecting L-lactic acid by using the fluorescent resonance energy transfer technology and the specific transcriptional regulator LldR derived from Salmonella typhimurium.

[0044] Specifically, in one typical embodiment of the present application, a fusion protein is provided, which comprises at least one L-lactic acid specific transcriptional regulator and at least two fluorescent proteins respectively connected to both ends of the L-lactic acid specific transcriptional regulator.

[0045] In the present application, the L-lactic acid specific transcriptional regulator is the specific transcriptional regulator LldR derived from Salmonella enterica serovar Typhimurium LT2 ATCC 14028, and the nucleotide sequence of the LldR is shown in SEQ ID NO. 3. The LldR is a transcriptional regulator capable of specifically responding to L-lactic acid discovered by the inventors.

[0046] In one or more embodiments of the present application, the fusion protein is selected from:

[0047] (a1) a protein consisting of the amino acid sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2;

[0048] (a2) a protein having the same function as (a1) by substitution, deletion and / or addition of one or more amino acid residues to the amino acid sequence shown in (a1);

[0049] (a3) a protein having an identity of 50% or more to the amino acid sequence shown in (a1) or (a2) and having the same function as the protein shown in (a1) or (a2).

[0050] In (a2), the substitution, deletion and / or addition of one or more amino acid residues is generally substitution and / or deletion and / or addition of no more than 15 amino acid residues.

[0051] The proteins shown in (a1) - (a3) above can be artificially synthesized, or the encoding genes thereof can be synthesized first and then expressed biologically to obtain.

[0052] In one or more embodiments of the present application, the fluorescent protein is a class of visualized reporter gene encoding proteins, including but not limited to cyan fluorescent protein and yellow fluorescent protein; in the present application, the first fluorescent protein can be cyan fluorescent protein (such as cyan fluorescent protein mTFP), and the second fluorescent protein can be yellow fluorescent protein (such as yellow fluorescent protein Venus). When L-lactic acid is present, L-lactic acid binds to the transcriptional regulator LldR to induce a conformational change of LldR, which in turn changes the fluorescence emission intensity ratio of the two fluorescent proteins connected at both ends, thereby realizing the detection of L-lactic acid.

[0053] In one or more embodiments of the present application, a nucleic acid molecule is provided, which can encode the fusion protein described above.

[0054] Specifically, the nucleic acid molecule has any one of the nucleotide sequences described in (b1) to (b4):

[0055] (b1) the nucleotide sequence as shown in SEQ ID NO. 4 or SEQ ID NO. 5;

[0056] (b2) a sequence formed by substitution, deletion and / or addition of one or more nucleotides of the nucleotide sequence as shown in (b1);

[0057] (b3) a nucleotide sequence having 50% or more identity with the nucleotide sequence defined in (b1) or (b2), and encoding the fusion protein;

[0058] (b4) a nucleotide sequence capable of hybridizing to the nucleotide sequence as described in any one of (b1) to (b3) under stringent conditions and encoding the same functional fusion protein.

[0059] It should be noted that the term "identity" refers to sequence similarity with the natural amino acid or nucleotide sequence. The identity can be evaluated by naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed in percentage (%), which can be used to evaluate the identity between related sequences.

[0060] The above 50% or more identity can be 50%, 60%, 70%, 80%, 85%, 90%, 95% or 99% or more identity.

[0061] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA.

[0062] In one or more embodiments of the present application, a recombinant expression vector is provided, which contains the nucleic acid molecule described above.

[0063] The recombinant expression vector is obtained by effectively connecting the above-mentioned nucleic acid molecule to an expression vector, which includes a viral vector (including an adenovirus vector, a retrovirus vector, or an adeno-associated virus vector), a plasmid, a bacteriophage, a cosmid, or an artificial chromosome (including a bacterial artificial chromosome BAC, a bacteriophage P1-derived vector PAC, a yeast artificial chromosome YAC, or a mammalian artificial chromosome MAC); as a preferred embodiment, the expression vector is a plasmid; and more preferably, the plasmid is pETDuet-1.

[0064] In one or more specific embodiments of the present application, a transformed cell is provided, which contains the above-mentioned nucleic acid molecule, contains the above-mentioned recombinant expression vector, or is capable of expressing the above-mentioned fusion protein.

[0065] The cell includes a bacterial cell or a fungal cell.

[0066] The bacteria can be Escherichia, Agrobacterium, Bacillus, Streptomyces, Pseudomonas, or Staphylococcus.

[0067] In one or more specific embodiments of the present application, the bacteria are Escherichia coli (such as BL21 (DE3)), Agrobacterium tumefaciens (such as GV3101), A. rhizogenes, Lactococcus lactis, Bacillus subtilis, B. cereus, or Pseudomonas fluorescens.

[0068] The fungus includes a yeast (such as Yarrowia lipolytica).

[0069] In one or more specific embodiments of the present application, the above-mentioned fusion protein, nucleic acid molecule, recombinant expression vector, and / or transformed cell is used in the preparation of a fluorescent sensor for detecting L-lactic acid.

[0070] In one or more specific embodiments of the present application, a fluorescent sensor for detecting L-lactic acid is provided, which contains the above-mentioned fusion protein, nucleic acid molecule, recombinant expression vector, and / or transformed cell.

[0071] The fluorescent sensor can further contain other reagents, devices, and / or equipment for detecting L-lactic acid, which can be selected and used by a person skilled in the art according to actual conditions.

[0072] In one or more specific embodiments of the present application, the reagent can contain a reaction buffer (such as a fluorescence assay buffer: 50 mM Tris-HCl, pH 7.4).

[0073] In actual application, the fluorescent sensor can be packaged as a kit product for use. As an example, the kit can contain the above-mentioned fusion protein, reaction buffer, and instructions for use, etc.

[0074] In one or more specific embodiments of the present application, a construction method of the above-mentioned fluorescent sensor for detecting L-lactic acid is provided, and the construction method at least comprises construction of a fusion protein, and the specific steps are as follows:

[0075] The coding gene lldR of the specific transcriptional regulatory factor LldR is inserted into a plasmid to obtain a recombinant plasmid, and the recombinant plasmid is transformed into a transformation cell for expression.

[0076] The plasmid is a plasmid into which a coding gene of a fluorescent protein is transformed, and specifically, the coding genes of the cyan fluorescent protein mTFP and the yellow fluorescent protein Venus are synthesized by whole gene synthesis, and the coding genes are sequentially inserted into the plasmid pETDuet-1 to obtain the plasmid pETDuet-mTFP-Venus.

[0077] In one or more specific embodiments of the present application, the method comprises:

[0078] The coding gene lldR of the specific transcriptional regulatory factor LldR derived from Salmonella typhimurium ATCC 14028 is amplified by PCR and inserted into the plasmid pETDuet-mTFP-Venus to obtain a recombinant plasmid; the recombinant plasmid is transformed into Escherichia coli, induced for expression, and purified to obtain the fusion protein.

[0079] The Escherichia coli can be Escherichia coli BL21 (DE3), the induced expression can be performed by using IPTG, and the purification can be performed by affinity chromatography using a nickel column.

[0080] In the present application, the fusion protein (the amino acid sequence is shown as SEQ ID NO. 1, and the nucleotide sequence is shown as SEQ ID NO. 4) obtained by the above-mentioned method is further constructed to obtain a fluorescent sensor named L-lactic acid fluorescent sensor FILLac 0N0C ;

[0081] In order to further improve the response amplitude of the fluorescent sensor to L-lactic acid, the N-terminal and / or C-terminal amino acid of the specific transcriptional regulatory factor LldR is subjected to truncation treatment, preferably, the LldR truncated variant is an LldR truncated variant with 10 amino acids truncated from the N-terminal, and at this time, the recombinant plasmid obtained is pETDuet-mTFP-lldR 10N0C -Venus, and the fusion protein (the amino acid sequence is shown as SEQ ID NO. 2, and the nucleotide sequence is shown as SEQ ID NO. 5) purified by using the recombinant plasmid is further constructed to obtain a fluorescent sensor named L-lactic acid fluorescent sensor FILLac 10N0C .

[0082] In one or more embodiments of the present application, a method for detecting L-lactic acid is provided, which comprises: co-incubating a sample to be tested with the fusion protein or the fluorescent sensor, and detecting the concentration of L-lactic acid or the presence or absence of L-lactic acid according to the change in the fluorescence emission intensity ratio of the fluorescent protein.

[0083] In one or more embodiments of the present application, the sample to be tested can be any biological sample or environmental sample containing L-lactic acid or suspected to contain L-lactic acid, and the biological sample includes but is not limited to microbial fermentation broth; the microorganism can be a natural lactic acid-producing strain or an artificially modified lactic acid-producing engineering bacterium.

[0084] In one or more embodiments of the present application, the above-mentioned fusion protein, fluorescent sensor and / or the above-mentioned detection method are provided for use in the fields of food (such as enzymes and yogurt, etc.), medicine, chemical industry and the like. In particular, the technical solutions of the present application can play a role in the fields where L-lactic acid is applied or contained and needs to be detected, and therefore have a wide application prospect.

[0085] The present application will be further described below in conjunction with specific examples. The following examples are only intended to explain the present application and do not limit the content thereof. In the following examples, Salmonella enterica serovar Typhimurium LT2 ATCC 14028 was purchased from the American Type Culture Collection (ATCC); the expression vector pETDuet-1 was purchased from Novagen company; and other materials and reagents used were obtained from commercial channels unless otherwise specified. The experimental methods used are conventional methods and are not specifically described.

[0086] Example 1: L-lactic acid fluorescent sensor FILLac 0N0C Construction

[0087] The culture medium and reagents used in this example are as follows:

[0088] LB medium: 0.5% yeast extract, 1% peptone, 1% NaCl;

[0089] Binding buffer: 20 mM Na2HPO4, 20 mM imidazole, 500 mM NaCl, pH 7.4;

[0090] Elution buffer: 20 mM Na2HPO4, 500 mM imidazole, 500 mM NaCl, pH 7.4;

[0091] Fluorescence assay buffer: 50 mM Tris-HCl, pH 7.4.

[0092] (1) Construction of the expression plasmid for the L-lactic acid fluorescent sensor FILLac

[0093] Using the genome of *Salmonella Typhimurium* ATCC 14028 as a template, the encoding gene *lldR* was amplified by PCR using the *lldR* forward and reverse primers. The pET28a plasmid was linearized by double digestion with restriction endonucleases BamHI and HindIII. The *lldR* gene fragment was then inserted into the plasmid using the T5 exonuclease assembly method to obtain the recombinant plasmid pET28a-lldR. The primer sequences for amplifying the *lldR* gene fragment are as follows:

[0094] lldR-forward primer

[0095] CAAATGGGTCGCGGATCCATGATTGTGATGCCAAAACGCC (SEQ ID NO. 6);

[0096] lldR-reverse primer

[0097] CTCGAGTGCGGCCGCAAGCTTTCATGATTTATTCTCCCTGG (SEQ ID NO. 7).

[0098] Using recombinant plasmid pET28a-lldR as a template, lldR was used 0N0C Forward primers and lldR 0N0C Reverse primers amplify LldR via PCR 0N0C The encoding gene lldR 0N0C The previously constructed pETDuet-mTFP-Venus plasmid was linearized by double digestion with restriction endonucleases SacI and SalI, and lldR was assembled using the T5 exonuclease method. 0N0C The gene fragment was inserted into the above plasmid to obtain the recombinant plasmid pETDuet-mTFP-lldR 0N0C -Venus. Wherein, the amplification of lldR 0N0C The primer sequences for the gene fragment are:

[0099] lldR 0N0C - Forward primer

[0100] TTCGCCTTTACTCACCATGTCGACTGATTTATTCTCCCTGGTCAT(SEQ ID NO.8);

[0101] lldR 0N0C -Reverse primer

[0102] GGACGAGCTGTACAAGGAGCTCATGATTGTGATGCCAAAACGCC (SEQ ID NO. 9).

[0103] (2) Optimization of expression conditions for L-lactic acid fluorescence sensor

[0104] The recombinant plasmids pET28a-lldR and pETDuet-mTFP-lldR were used. 0N0C -Venus was transformed into Escherichia coli BL21(DE3) by heat shock transformation. After adding an appropriate amount of LB medium and reviving at 37°C for 1 hour, it was spread on LB solid medium containing 50 μg / mL kanamycin or 100 μg / mL ampicillin resistance. After culturing at 37°C for 12 hours, single clones were picked for culture PCR verification.

[0105] After activating the verified single clones in LB medium for two generations, they were inoculated at a 2% inoculum into 500 mL of LB medium containing ampicillin resistance (100 μg / mL) and cultured at 37°C with shaking at 180 rpm until OD. 600nm When the pH is 0.6–0.8, add 1 mM IPTG to the culture medium and induce at 23°C and 160 rpm for 12 hours; collect the bacterial cells by centrifugation at 6000 rpm for 10 minutes, wash the bacterial cells twice with binding buffer, and resuspend at OD. 600nm The concentration was 20, and 1 mM PMSF and 10% glycerol were added simultaneously. The bacterial cells were disrupted four times using a high-pressure homogenizer at 800 Pa. The disruption solution was centrifuged at 4°C and 12,000 rpm for 50 minutes to remove cell debris. The supernatant was filtered through a 0.22 μm filter and purified using a 5 mL nickel column. The purified LldR was obtained by elution with different concentrations of elution buffer. Its gene sequence length is 777 bases, and the nucleotide sequence is shown in SEQ ID NO.3. The purity of LldR was detected by SDS-PAGE, and the results are attached. Figure 1 L-lactic acid fluorescence sensor FILLac 0N0C The expression and purification method is as described above. The gene sequence length is 2214 bases, and the nucleotide sequence is shown in SEQ ID NO.4.

[0106] (3) Measurement of fluorescence emission intensity ratio

[0107] The purified fillac was diluted with fluorescence assay buffer. 0N0C To 4 / 3 μM, add FILLac 0N0CThe sample and test sample were mixed at a volume ratio of 3:1 in a black 96-well microplate, with a total volume of 100 μL. Three replicates were prepared for each sample. After incubation for 20 minutes, the fluorescence intensity at 485 nm (mTFP) and 528 nm (Venus) was measured using an EnSight multi-functional microplate reader (PerkinElmer, USA) upon excitation at 430 nm. The fluorescence intensity at 528 nm was divided by the fluorescence intensity at 485 nm to obtain the filler value. 0N0C The ratio of fluorescence emission intensity.

[0108] (4) L-lactic acid fluorescence sensor FILLac 0N0C Response to L-lactic acid

[0109] Prepare L-lactic acid standard solutions of varying concentrations using fluorescence assay buffer. Then, according to the fluorescence emission intensity ratio determination method described in (3) above, prepare the FILLac... 0N0C After incubation with standard solutions containing different concentrations of L-lactic acid, the fluorescence emission intensity ratio of each well was measured. The fluorescence emission intensity ratio was then correlated with the concentration of L-lactic acid to obtain the FILLac. 0N0C The dose-response curves are shown in the attached figure. Figure 2 As shown, FILLac 0N0C The fluorescence emission intensity ratio responds in a concentration-dependent manner to the amount of added L-lactic acid; the higher the concentration of L-lactic acid, the lower the fluorescence emission intensity ratio. (L-lactic acid fluorescence sensor FILLac) 0N0C Maximum fluorescence ratio change ΔR max The affinity constant K is 19.10 ± 2.47%. d The value was 7.74 ± 2.30 μM.

[0110] Example 2: L-Lactic Acid Fluorescent Sensor FILLac 10N0C Construction

[0111] The culture medium and reagents used in this embodiment are as follows:

[0112] LB medium: 0.5% yeast extract, 1% peptone, 1% NaCl;

[0113] Binding buffer: 20mM Na2HPO4, 20mM imidazole, 500mM NaCl, pH 7.4;

[0114] Elution buffer: 20 mM Na2HPO4, 500 mM imidazole, 500 mM NaCl, pH 7.4;

[0115] Fluorescence assay buffer: 50 mM Tris-HCl, pH 7.4.

[0116] (1) L-lactate fluorescent sensor FILLac 10N0C Construction of expression plasmid

[0117] The N-terminal and / or C-terminal amino acids of the specific transcriptional regulator LldR were truncated to improve the response amplitude of the fluorescent sensor to L-lactate. The gene fragment of the LldR truncated variant was amplified by PCR and inserted into the restriction sites SacI and SalI of plasmid pETDuet-mTFP-Venus to construct the coding plasmid of different sensor variants.

[0118] The coding plasmid of different sensor variants was transformed into E. coli BL21 (DE3) according to the method in Example 1, and the sensor variants were expressed and purified, and the response of the sensor variants to L-lactate was determined. The maximum fluorescence ratio change AR max was taken as the index to screen the sensor variants. When the N-terminal of LldR was truncated by 10 amino acids, the truncated variant LldR 10N0C was used. The sensor variant constructed had the largest fluorescence ratio change, and the sensor variant was named FILLac 10N0C , the gene sequence length was 2184 bases, the nucleotide sequence was shown as SEQ ID NO. 5, and the corresponding recombinant plasmid was pETDuet-mTFP-lldR 10N0C -Venus. The primer sequence for amplifying the lldR 10N0C gene fragment was as follows:

[0119] The lldR 10N0C -forward primer was as follows:

[0120] GGACGAGCTGTACAAGGAGCTCGAGATTGCCTCTCGCGTGCGG (SEQ ID NO. 10);

[0121] The lldR 10N0C -reverse primer was as follows: 0N0C -reverse primer

[0122] GGACGAGCTGTACAAGGAGCTCATGATTGTGATGCCAAAACGCC (SEQ ID NO. 9).

[0123] The results are shown in the accompanying Figure 3 , the fluorescence emission intensity ratio of FILLac 10N0C responded to the added L-lactate in a concentration-dependent manner, the greater the concentration of L-lactate, the smaller the fluorescence emission intensity ratio, and the maximum fluorescence ratio change AR max was 33.47 ± 1.91%, and the affinity constant K dThe value was 6.33 ± 0.79 μM.

[0124] Example 3: L-Lactic Acid Fluorescent Sensor FILLac 10N0C pH stability, spectroscopic properties, specificity and temperature sensitivity

[0125] The culture medium and reagents used in this embodiment are as follows:

[0126] Fluorescence assay buffer: 50 mM Tris-HCl, pH 7.4.

[0127] (1) L-lactic acid fluorescence sensor FILLac 10N0C pH stability

[0128] Prepare 50 mM Tris-HCl buffer solutions with pH values ​​of 4.0, 5.0, 6.0, 7.0, 7.5, 8.0, 9.0, and 10.0 to dilute L-lactic acid to 0 μM, 4 μM, 40 μM, and 400 μM; dilute purified filler with 50 mM Tris-HCl buffer at pH 7.4. 10N0C The fluorescence of the L-lactic acid sensor FILLac was measured to 4 / 3 μM according to the method in Example 1. 10N0C The ratio of fluorescence emission intensity of L-lactic acid at different pH values. Results are attached. Figure 4 As shown, in Tris-HCl buffer at pH 7.4, FILLac 10N0C The fluorescence ratio remained essentially unchanged when detecting 0 μM, 1 μM, 10 μM, or 100 μM L-lactic acid, indicating that FILLac 10N0C The detection of L-lactic acid is not affected by the sample pH.

[0129] (2) L-lactic acid fluorescence sensor FILLac 10N0C Spectroscopic properties

[0130] The purified fillac was diluted with fluorescence assay buffer. 10N0C Dilute L-lactic acid to 100 μM, then dilute the diluted filler to 4 / 3 μM. 10N0C The sample was incubated with 0 μM and 100 μM L-lactic acid, respectively. Fluorescence emission values ​​were continuously collected from 445–600 nm in 2 nm increments under excitation at 430 nm. The results are attached. Figure 5 As shown, the addition of L-lactic acid leads to FILLac 10N0C The fluorescence emission peak at 492 nm (mTFP) increases, while the fluorescence emission peak at 526 nm (Venus) decreases, ultimately causing FILLac 10N0C The fluorescence emission intensity ratio of Venus to mTFP decreased.

[0131] (3) L-lactate fluorescent sensor FILLac 10N0C Specificity of

[0132] Purified FILLac was diluted with fluorescence assay buffer 10N0C to 4 / 3 μM, each compound was diluted to 200 μM, and FILLac was detected according to the method in Example 1. 10N0C The fluorescence emission intensity ratio of different compounds. The results are shown in the following table, indicating that L-lactate fluorescent sensor FILLac Figure 6 has good specificity. 10N0C

[0133] (4) L-lactate fluorescent sensor FILLac 10N0C Temperature sensitivity of

[0134] Purified FILLac was diluted with fluorescence assay buffer 10N0C to 4 / 3 μM and L-lactate standard solution of gradient concentration was prepared, and FILLac 10N0C and L-lactate standard solution containing different concentrations were mixed and incubated at different temperatures (25°C, 28°C, 31°C, 34°C, 37°C, 40°C or 45°C), and FILLac was detected according to the method in Example 1. 10N0C Dose-response curves at different temperatures. The results are shown in the following table, indicating that L-lactate fluorescent sensor FILLac Figure 7 is not sensitive to temperature changes, and its detection of L-lactate is not disturbed by temperature. 10N0C

[0135] Example 4: Performance analysis of L-lactate fluorescent sensor FILLac 10N0C for quantifying L-lactate

[0136] The culture medium and reagents used in this example are as follows:

[0137] Fluorescence assay buffer: 50 mM Tris-HCl, pH 7.4.

[0138] In this example, the L-lactate sample contained L-lactate standard solution of different concentrations (2 mM, 4 mM, 20 mM, 40 mM, 100 mM, 160 mM, 200 mM) prepared with fluorescence assay buffer.

[0139] This example relates to sample detection methods including L-lactate fluorescent sensor FILLac 10N0C , commercial L-lactate sensor SBA-40D type biosensor automatic analyzer and high performance liquid chromatography.

[0140] (1) High performance liquid chromatography for detecting L-lactate containing samples​​

[0141] The sample containing L-lactic acid was analyzed using LC-20AT liquid chromatograph (Shimadzu, Japan) equipped with RID detector and Aminex HPX-87H anion exchange column (300x7.8mm, Bio-Rad, USA). The mobile phase was 10mM dilute sulfuric acid, and the flow rate was 0.4mL / min. The column temperature was 55°C, the injection volume was 5μL, and the analysis time was 35min. The peak area of the sample containing L-lactic acid was determined, and the standard curve of L-lactic acid was prepared. The peak area of the sample containing L-lactic acid was substituted into the standard curve of L-lactic acid, and the specific L-lactic acid concentration corresponding to the peak area was obtained, which was the quantitative result of L-lactic acid in the sample containing L-lactic acid.

[0142] (2) Determination of sample containing L-lactic acid using SBA-40D biosensor automatic analyzer

[0143] SBA-40D biosensor automatic analyzer is equipped with L-lactic acid oxidase enzyme membrane, and can determine the concentration of L-lactic acid. The sample containing L-lactic acid was diluted with ultrapure water to ensure that the concentration of L-lactic acid in the sample to be tested was within the range of 0-100mg / dL, and the determination result was divided by 2 and multiplied by the dilution multiple to obtain the quantitative result of L-lactic acid in the sample containing L-lactic acid.

[0144] (3) L-lactic acid fluorescent sensor FILLac 10N0C Determination of sample containing L-lactic acid

[0145] Determination of L-lactic acid fluorescent sensor FILLac according to the method in Example 1 10N0C Fluorescence emission intensity ratio of L-lactic acid sample, and determination of L-lactic acid fluorescent sensor FILLac 10N0C Dose response curve of L-lactic acid in fluorescence assay buffer. The fluorescence emission intensity ratio of the L-lactic acid sample was substituted into the L-lactic acid fluorescent sensor FILLac 10N0C In the dose response curve of L-lactic acid in fluorescence assay buffer, the specific L-lactic acid concentration corresponding to the fluorescence emission intensity ratio was obtained, and the result was further multiplied by 4 and the dilution multiple to obtain the quantitative result of L-lactic acid in the sample containing L-lactic acid.

[0146] The consistency of the three L-lactic acid quantitative detection methods was compared. The results are shown in Figures Figure 8 and Figure 9 , and the quantitative results of L-lactic acid using FILLac 10N0C have a very high consistency with the quantitative results of high performance liquid chromatography (HPLC) and SBA-40D biosensor automatic analyzer (R 2 >0.999).

[0147] Example 5: L-lactic acid fluorescent sensor FILLac 10N0C Application in detecting L-lactic acid in microbial fermentation samples

[0148] The culture medium and reagents used in this example are as follows:

[0149] Lactic acid bacteria culture medium: MRS medium

[0150] Fluorescence assay buffer: 50 mM Tris-HCl, pH 7.4.

[0151] In this example, the preparation method of the microbial fermentation sample containing L-lactic acid is as follows:

[0152] Three lactic acid producing strains, Lactobacillus casei ATCC334, L. plantarum ATCC14917 and L. bulgaricus ATCC11842, were fermented in 100 mL shake flasks containing 50 mL MRS medium and 1% CaCO3. The fermentation was carried out at 37°C for 24 h. After the fermentation, the fermentation broth of each strain was collected. The fermentation broth of each strain was heated in a 105°C metal bath for 15 min, and then centrifuged at 14,500 rpm for 15 min. The supernatant was collected and stored at -20°C for later use.

[0153] In this example, the sample detection method involves L-lactic acid fluorescent sensor FILLac 10N0C and commercial L-lactic acid sensor SBA-40D biosensor automatic analyzer.

[0154] According to the SBA-40D biosensor automatic analyzer assay method described in Example 4 and L-lactic acid fluorescent sensor FILLac 10N0C The L-lactic acid concentration in each strain fermentation sample was determined by the assay method. The results are shown in the attached Figure 10 There was no significant difference (ns, no significant difference) between the detection results of L-lactic acid fluorescent sensor FILLac 10N0C and the SBA-40D biosensor automatic analyzer, indicating that L-lactic acid fluorescent sensor FILLac 10N0C can be used for quantitative detection of L-lactic acid in fermentation samples, just like the commercial SBA-40D biosensor automatic analyzer.

[0155] Example 6: L-lactic acid fluorescent sensor FILLac 10N0C Application in detecting L-lactic acid in food

[0156] The culture medium and reagents used in this embodiment are as follows:

[0157] Fluorescence assay buffer: 50 mM Tris-HCl, pH 7.4.

[0158] In this embodiment, the food consists of three types of enzymes and three types of yogurt. The method for preparing the food samples is as follows:

[0159] Three types of yogurt (yogurt A, yogurt B, and yogurt C) and three types of enzymes (enzyme A, enzyme B, and enzyme C) were purchased from a local supermarket. Each yogurt and enzyme was heated in a 105°C metal bath for 15 minutes, centrifuged at 14,500 rpm for 15 minutes, and the supernatant was collected to obtain the yogurt and enzyme samples, which were stored in a -20°C refrigerator for later use.

[0160] The sample detection method involved in this embodiment includes the L-lactic acid fluorescence sensor FILLac. 10N0C And the commercially available L-lactic acid sensor SBA-40D type biosensor automatic analyzer.

[0161] The measurement method of the SBA-40D biosensor automated analyzer and the L-lactic acid fluorescence sensor FILLac were used according to Example 4. 10N0C The concentration of L-lactic acid in each yogurt and enzyme sample was determined separately. Results are attached. Figure 11 As shown, the L-lactic acid fluorescence sensor FILLac 10N0C The detection results were not significantly different from those of the SBA-40D biosensor automated analyzer (ns, no significant difference), further demonstrating the effectiveness of the L-lactic acid fluorescence sensor FILLac. 10N0C It can be used for the selective detection of L-lactic acid in different samples.

[0162] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention. Although the specific embodiments of the present invention have been described above, they are not intended to limit the protection scope of the present invention. Those skilled in the art should understand that various modifications or variations that can be made by those skilled in the art without creative effort based on the technical solutions of the present invention are still within the protection scope of the present invention.

Claims

1. A fusion protein, characterized in that, The fusion protein comprises at least one L-lactate-specific transcriptional regulator and at least two fluorescent proteins respectively connected to both ends of the L-lactate-specific transcriptional regulator; the L-lactate-specific transcriptional regulator is a specific transcriptional regulator LldR derived from Salmonella typhimurium ATCC 14028; The fusion protein is a protein consisting of the amino acid sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2; The first fluorescent protein is a cyan fluorescent protein and the second fluorescent protein is a yellow fluorescent protein.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule can encode the fusion protein of claim 1. The nucleic acid molecule has the nucleotide sequence shown in SEQ ID NO. 4 or SEQ ID NO.

5.

3. A recombinant expression vector, characterized in that, The recombinant expression vector contains the nucleic acid molecule of claim 2.

4. A transformed cell, characterized in that, The transformed cell contains the nucleic acid molecule of claim 2, contains the recombinant expression vector of claim 3 or can express the fusion protein of claim 1.

5. Use of the fusion protein of claim 1, the nucleic acid molecule of claim 2, the recombinant expression vector of claim 3 and / or the transformed cell of claim 4 in the preparation of a fluorescent sensor for detecting L-lactic acid.

6. A fluorescent sensor for detecting L-lactic acid, characterized by, The fluorescent sensor contains the fusion protein of claim 1, the nucleic acid molecule of claim 2, the recombinant expression vector of claim 3 and / or the transformed cell of claim 4. The fluorescent sensor further comprises other reagents, devices and / or equipment for detecting L-lactic acid. The reagent comprises a reaction buffer.

7. The method for constructing a fluorescent sensor for detecting L-lactic acid according to claim 6, wherein, The construction method comprises at least the construction of the fusion protein, and the specific steps are as follows: Synthesis of a gene encoding a specific transcriptional regulator LldR lldR The recombinant plasmid is obtained by inserting into a plasmid, and is transformed into a transformation cell for expression.

8. A method for detecting L-lactic acid, characterized by, The method comprises: co-incubating the sample to be tested with the fusion protein of claim 1 or the fluorescent sensor of claim 6, and detecting and analyzing the concentration or presence or absence of L-lactic acid according to the change in the intensity ratio of the fluorescence emission of the fluorescent protein.

9. Use of the fusion protein of claim 1, the fluorescent sensor of claim 6 and / or the detection method of claim 8 in the fields of food, medicine and chemical industry.

Images