Transcription factor pbbzip4 affecting anthracnose susceptibility of plants, protein and application thereof

Abstract

The application provides a transcription factor PbbZIP4 affecting the sensitivity of plants to anthracnose, a protein and application thereof, and belongs to the field of functional gene technology.The transcription factor PbbZIP4 affecting the sensitivity of plants to anthracnose provided by the application has an amino acid sequence as shown in SEQ ID NO:1.The application can improve the sensitivity of plants to anthracnose by overexpressing the transcription factor PbbZIP4, and can effectively improve the resistance of plants to anthracnose stress by reducing the expression of the transcription factor PbbZIP4 through gene silencing.Therefore, the transcription factor PbbZIP4 can be used as a target to reduce or improve the sensitivity of plants to anthracnose.

Description

Technical Field

[0001] This invention belongs to the field of functional gene technology, specifically relating to a transcription factor PbbZIP4, a protein that affects the susceptibility of plants to anthracnose, and its application. Background Technology

[0002] Pears are widely cultivated globally, and in China, they are the third largest fruit crop after apples and citrus. The planting area is vast, forming a "three-region, four-point" production area layout pattern from Northeast China to Guangxi, Yunnan, and Shandong. Although the pear planting area is extensive and most pear orchards are rationally planned, differences in environmental factors across regions, the impact of various natural disasters, and long-term unreasonable development and utilization by humans pose significant threats to agricultural production, food security, and the cultivation of various fruits, vegetables, and ornamental plants. The pear industry also faces the challenges of salinity, drought, frost damage, and flooding. Stressful environments are one of the main factors limiting plant growth, and stress is divided into non-anthracnose and anthracnose-related stresses. Among anthracnose diseases, fungal infection is a highly damaging stress, as fungal hyphae can infect the roots, stems, leaves, and fruits of plants, causing huge economic losses. For pear crops, pear anthracnose caused by *Colletotrichum candida* is one of the most widespread fungal diseases, causing significant damage to pear yields. Therefore, there is an urgent need to obtain drought-resistant and disease-resistant pear varieties through breeding.

[0003] Unlike animals, plants cannot actively avoid adverse environmental stresses. Therefore, plants have evolved a series of systematic response mechanisms to cope with various adverse environmental stresses. This systematic response mechanism involves the gene regulatory network rapidly inducing the expression of stress-related genes in the body when subjected to external stress signals, thereby responding to various stressful environments.

[0004] The bZIP transcription factor is a conserved bZIP domain composed of 40–80 amino acids, possessing two structural features. The basic DNA-binding region (N-X7-R / K-X9) is used for binding to specific DNA sequences, while the bZIP motif, composed of multiple heptamer repeats of leucine or other hydrophobic amino acids (such as Ile, Val, Phe, or Met), is used for dimer-specific binding. Multiple studies have shown that the bZIP transcription factor has diverse functions, including biological processes, seed maturation, senescence, and adaptive biological and non-anthrax responses. However, there are currently no reports on the function of the bZIP transcription factor in regulating different susceptibility levels in plants to anthracnose. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide a transcription factor PbbZIP4, the expression of which can directly affect the sensitivity of plants to anthracnose, providing a new approach for breeding new anthracnose-resistant plant varieties.

[0006] This invention provides a transcription factor PbbZIP4 that affects the susceptibility of plants to anthracnose, the amino acid sequence of which is shown in SEQ ID NO: 1.

[0007] The present invention provides the encoding gene of the transcription factor PbbZIP4, the nucleotide sequence of which is shown in SEQ ID NO: 2.

[0008] The present invention provides a primer pair for amplifying the coding gene, comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO: 3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 4.

[0009] This invention provides the application of the transcription factor PbbZIP4, which affects the susceptibility of plants to anthracnose, or the gene encoding it, as a target in reducing or increasing the susceptibility of plants to anthracnose.

[0010] This invention provides the application of reagents that inhibit the function of the transcription factor PbbZIP4 or knock out or silence the expression of the encoding gene in the cultivation of anthrax virus resistant plant varieties.

[0011] Preferably, the reagent that inhibits the function of transcription factor PbbZIP4 includes a transcription factor PbbZIP4 inhibitor.

[0012] Preferably, the reagent for knocking out or silencing gene expression includes the recombinant viral silencing vector pTRV2-PbbZIP4.

[0013] Preferably, the plant includes dicotyledonous plants.

[0014] Preferably, the dicotyledonous plant includes the pear.

[0015] This invention provides a method for cultivating plant varieties resistant to anthracnose, wherein the expression of transcription factor PbbZIP4 in the plant is knocked out or inhibited, and the amino acid sequence of transcription factor PbbZIP4 is shown in SEQ ID NO.1.

[0016] This invention provides a transcription factor, PbbZIP4, that influences plant susceptibility to anthracnose. The amino acid sequence of PbbZIP4 is shown in SEQ ID NO: I. Experimental results show that the transcription level of PbbZIP4 gradually decreases after plants are treated with anthracnose fungus, indicating that the PbbZIP4 transcription factor provided by this invention plays an important role in plant resistance to anthracnose. This invention transforms the transcription factor PbbZIP4 into pear callus tissue. The resulting overexpressed transgenic plants exhibit anthracnose susceptibility and can serve as indicator plants for anthracnose, providing early warning of fungal infection in plants. Simultaneously, this invention also conducted experiments knocking out or silencing the PbbZIP4 gene in plants, and the results showed that the modified plants exhibited anthracnose resistance. The PbbZIP4 transcription factor provided by this invention is of great significance for breeding new anthracnose-resistant varieties and for research on anthracnose tolerance. Attached Figure Description

[0017] Figure 1 This is a schematic diagram of the technical process of the present invention;

[0018] Figure 2 The expression pattern of PbbZIP4 under anthrax treatment;

[0019] Figure 3 Figure 1 shows the subcellular localization of the PbbZIP4 encoding gene, where A is the imaging of the GFP gene under GFP field, bright field, and fusion field; Figure B is the imaging of the PbbZIP4-GFP encoding gene under GFP field, bright field, DAPI field, and fusion field.

[0020] Figure 4 Identification of callus tissue overexpressing PbbZIP4;

[0021] Figure 5 Phenotypic and physiological data for anthrax treatment of callus tissue overexpressing PbbZIP4;

[0022] Figure 6 Identification of PbbZIP4 silent plants;

[0023] Figure 7 Phenotypic and physiological data for anthracnose treatment in PbbZIP4 silent plants. Detailed Implementation

[0024] This invention provides a transcription factor PbbZIP4 that affects the susceptibility of plants to anthracnose. The amino acid sequence of the transcription factor PbbZIP4 is shown in SEQ ID NO: 1 (MSVPIRAGDGEAKNPMLSISSSSSSLEQLQQVQQPSGSSSLRPPHPSLLLHSNTKNSNKLDVPWFWSLDDDDDDGDNVPEESDEDMFTVPDVEALPPSNNNINNAASTIANATSNNNNPDAQSGFPAKRRRGRNPVDKEYRRLKRLLRNRVSAQQARERKKVYVNDLESRAKELDDRNSKLEEKISTLVNENTMLRKVLMNTRPKVDESIEQKQGSVK*).

[0025] The present invention provides the encoding gene of the transcription factor PbbZIP4, the nucleotide sequence of which is shown in SEQ ID NO: 2().

[0026] This invention provides a primer pair for amplifying the coding gene, comprising a forward primer with the nucleotide sequence shown in SEQ ID NO: 3 and a reverse primer with the nucleotide sequence shown in SEQ ID NO: 4. The preferred amplification reaction program for the primer pair is: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 90 s, 72℃ extension for 90 s, for 35 cycles, followed by a final extension at 72℃ for 10 min after each cycle. The primer pair exhibits good specificity for the amplification of PbbZIP4.

[0027] This invention provides the application of the transcription factor PbbZIP4, which affects the susceptibility of plants to anthracnose, or the gene encoding it, as a target in reducing or increasing the susceptibility of plants to anthracnose.

[0028] In this embodiment of the invention, the transcription level of the transcription factor PbbZIP4 gradually decreased after the plant was treated with anthracnose, indicating that the transcription factor PbbZIP4 responds to anthracnose stress. Simultaneously, this invention transferred the transcription factor PbbZIP4 into pear callus tissue, resulting in transgenic plants with overexpression of PbbZIP4. Compared with wild callus tissue, the transgenic callus tissue effectively weakened the transgenic plants' resistance to anthracnose, exhibiting greater cell damage. Furthermore, gene silencing of the transcription factor PbbZIP4 resulted in transgenic plants with significantly enhanced anthracnose resistance and less cell damage compared to wild-type plants.

[0029] This invention also provides a recombinant vector overexpressing the transcription factor PbbZIP4 encoding gene. This recombinant vector, when transformed into plants under Agrobacterium-mediated transformation, can enhance the plant's susceptibility to anthracnose and can be used as an indicator plant for environmental anthracnose. The recombinant vector is preferably p1300-PbbZIP4. The preferred method for constructing the recombinant vector is to amplify the transcription factor PbbZIP4 encoding gene, clone it into the XbaI and BamHI sites in the p1300 vector, and then screen to obtain a positive recombinant vector. The primer pair for amplifying the transcription factor PbbZIP4 encoding gene includes a forward primer with the nucleotide sequence as described in SEQ ID NO: 9 (acgggggactctagaATGTCAGTCCCAATCAGAGCAGG) and a reverse primer with the nucleotide sequence as described in SEQ ID NO: 10 (aaggttaccgaattctctagaCCACCAGTAACAACAACAATCCA). The preferred annealing temperature for amplification is 58°C. The plant material preferably includes callus tissue. This invention does not impose any special limitations on the method of transformation into the plant; any transformation method well known in the art can be used.

[0030] This invention also provides a recombinant vector for expressing the gene encoding the silencing transcription factor PbbZIP4. This recombinant vector is transformed into plants under the mediation of Agrobacterium, resulting in transgenic plants with reduced expression of the transcription factor PbbZIP4 and increased resistance to anthracnose. Therefore, the transgenic plants exhibit good resistance to anthracnose stress and can be used for the breeding of new anthracnose-resistant plant varieties. The recombinant vector is preferably the recombinant viral silencing vector pTRV2-PbbZIP4. The preferred method for constructing the recombinant viral silencing vector pTRV2-PbbZIP4 involves amplifying the DNA sequence of PbbZIP4, cloning it into the XbaI and SmaI molecules of pTRV2, and then screening and identifying to obtain the positive recombinant viral silencing vector pTRV2-PbbZIP4. The primers for amplifying the PbbZIP4 DNA sequence preferably include a forward primer with the nucleotide sequence shown in SEQ ID NO: 11 and a reverse primer with the nucleotide sequence shown in SEQ ID NO: 12. The preferred annealing temperature for amplifying the PbbZIP4 DNA sequence is 58°C.

[0031] The present invention also provides the application of reagents for inhibiting the function of the transcription factor PbbZIP4 or for knocking out or silencing the expression of the encoding gene in the cultivation of anthrax virus resistant plant varieties.

[0032] In this invention, the reagent that inhibits the function of transcription factor PbbZIP4 includes a PbbZIP4 inhibitor. The plant preferably includes a dicotyledonous plant. The dicotyledonous plant preferably includes the pear.

[0033] This invention provides a method for cultivating anthracnose-resistant plant varieties, wherein the expression of transcription factor PbbZIP4 in the plant is knocked out or inhibited, and the amino acid sequence of transcription factor PbbZIP4 is shown in SEQ ID NO.1.

[0034] In this invention, the method for knocking out or inhibiting the expression of transcription factor PbbZIP4 in plants is the same as above, and will not be repeated here.

[0035] The following detailed description, in conjunction with embodiments, illustrates the transcription factor PbbZIP4, protein, and applications of this invention that influence plant susceptibility to anthracnose. However, these descriptions should not be construed as limiting the scope of protection of this invention.

[0036] Example 1

[0037] Cloning of the full-length cDNA of the PbbZIP4 transcription factor gene from *Pyrus pyrifolia*

[0038] A transcription factor gene, PbbZIP4, was screened from *Pyrus pyrifolia*. Primers were designed using Primer Premier 5.0 based on the PbbZIP4 gene sequence, and its full length was amplified from *Pyrus pyrifolia* using RT-PCR. Detailed steps are as follows: First-strand cDNA synthesis was performed according to the instructions of the TIANGEN reverse transcription kit. The obtained first-strand cDNA was used for amplification of the PbbZIP4 gene. The total PCR reaction volume was 50 μl, including 1 μl of *Pyrus pyrifolia* cDNA, 2.5 μl each of forward and reverse primers (SEQ ID NO3: ATGTCAGTCCCAATCAGAGCAGG and SEQ ID NO4: CTTAACTGATCCTTGCTTTTGCTCA), 1 μl of enzyme, 25 μl of buffer, and 18 μl of sterile dd water. PCR was performed according to the following program: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 90 s, 72℃ extension for 90 s, 35 cycles, followed by a 10 min extension at 72℃ after each cycle. After amplification, a single-band PCR product is generated. After electrophoresis on a 1% agarose gel, the target band is excised and recovered according to the instructions of the gel recovery kit.

[0039] The purified product was ligated into the pEASY-BluntZero vector at a gene-to-vector molar ratio of 3:1. The total reaction volume was 5 μl, consisting of 4.5 μl of the purified PCR product and 0.5 μl of the vector. Ligation was performed at 25°C for 30 min, followed by transformation into competent *E. coli* DH5α cells using a heat shock method. PCR verification and sequencing were performed using primers for the target gene sequence (conducted by Shanghai Sangon Biotech Co., Ltd.). The sequencing results are shown in SEQ ID NO: 2.

[0040] Example 2

[0041] qRT-PCR Analysis of Transcription Factor PbbZIP4 under Biological Stress Conditions: To analyze the response pattern of the PbbZIP4 gene in *Pyrus pyrifolia* to anthracnose treatment, real-time PCR was used to analyze the expression pattern of the PbbZIP4 gene. RNA was extracted using the Plant Total RNA Isolation Kit Plus from Chengdu Fujie Biotechnology Co., Ltd., and the synthesis of the first strand of DNA was performed according to the TANGEN reverse transcription kit manual. The 10 μl reaction mixture contained: 5 μl 2×SYBR Premix ExTaq, 0.1 μl cDNA, and 0.4 μl primers (SEQ ID NO: 5). ,TATGTTCACGGTTCCGGACG and SEQ ID NO: 6 ATTGGCGATGGTAGAGGCTG), 4.5 μl water. Tubulin is the internal reference gene, and the corresponding primer is SEQ ID NO: 7 (TGGGCTTTGCTCCTCTTAC) and SEQ ID NO: 8 (CCTTCGTGCTCATCTTACC) The procedure for real-time quantitative PCR is shown in Table 1:

[0042] Table 1 Real-time quantitative PCR program

[0043]

[0044] See results Figure 2 Pyrus pyrifolia seedlings were treated with anthracnose spore suspension, and samples were taken at corresponding time points. Real-time quantitative PCR was used to analyze the relative expression levels of the encoded genes. It can be seen that PbbZIP4 has a very strong response to anthracnose, and its expression level shows a downward trend.

[0045] Example 3

[0046] Subcellular localization of the gene encoding PbbZIP4

[0047] Based on the nucleotide sequence of the PbbZIP4 encoding gene and the pJIT166-GFP vector diagram, Xba I and BamHI restriction sites were added before and after the gene sequence, respectively. The target gene with correct sequencing results was extracted and used as a template. Amplification was performed using primers with added restriction sites (SEQ ID NO: 9 and SEQ ID NO: 10). The PCR program was: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 60 s, 72℃ extension for 90 s, 35 cycles; 72℃ extension for 10 min. The stop codon TAG was removed from the 3′ gene to allow for gene fusion with GFP. After 1% agarose gel electrophoresis, the target band was recovered using a gel electrophoresis kit. The pJIT166-GFP vector plasmid was digested with Xba I and BamHI restriction endonucleases at 37℃ for 4 hours, and then purified and recovered. The enzyme-digested pJIT166-GFP vector and the gel-recovered PbbZIP4 fragment were ligated using recombinant ligase at 37°C for 30 min, and then transformed into competent E. coli DH5α cells. The transformed bacterial cultures were tested by PCR. Cultures showing positive PCR results were sent to the company for sequencing. Plasmids from cultures with correct sequencing results were extracted, and the resulting recombinant vector was named GFP-PbbZIP4.

[0048] Agrobacterium-mediated transient transformation of tobacco cells: The recombinant GFP-PbbZIP4 vector plasmid was transformed into Agrobacterium competent cells GV3101. The activated Agrobacterium cells containing the recombinant plasmid were then propagated in LB broth containing 505 mg / mL kanamycin and 50 mg / mL rifampin in a shaker at 250 rpm and 28 °C. After centrifugation at 6000 rpm for 10 min, the cells were resuspended in infection buffer (100 mL: 10 mL 100 mM MgCl2, 10 mL 100 mM MES, 75 μL 200 mM AS, 80 mL ddH2O) to OD200. 600 The concentration was 0.8. After incubation at room temperature for 3–4 hours, the inoculum was used to infect tobacco leaf cells. The infected tobacco cells were then cultured in the dark for 24 hours, followed by DAPI staining to label cell nuclei and slide preparation. Images were taken using an inverted laser scanning confocal microscope (Zeiss LSM 780).

[0049] See results Figure 3 . Figure 3 The subcellular localization of the gene encoding PbbZIP4 is shown in the cell localization map, which indicates that PbbZIP4 is located in the cell nucleus.

[0050] Example 4

[0051] Genetic transformation of callus

[0052] 1. Construction of plant transformation vectors

[0053] Based on the multiple cloning site of the PCMBIA1300 vector and the coding region sequence of the PbbZIP4 gene, restriction enzyme sites XbaI and BamHI were added. Upstream and downstream PCR primers (SEQ ID NO: 9 and SEQ ID NO: 10) were designed using Primer Primer 5.0 software according to general primer design principles. PCR amplification was performed using the PbbZIP4 gene clone as a template. The annealing temperature for PCR amplification was 58℃, and the PCR reaction system and amplification program were the same as those for the PbbZIP4 gene clone. After amplification, gel purification and recovery were performed. The double digestion reaction volume of the PCMBIA1300 vector was 40 μl, containing: 10 μl of the PCMBIA1300 vector plasmid, 4 μl of 10×M buffer, 1 μl each of XbaI and BamHI, and 24 μl of double-distilled water. After digestion at 37℃ for 3-4 h, purification and recovery were performed. The ligation reaction system was prepared by adding PbbZIP4 gene to vector PCMBIA1300 at a molar ratio of 2:1, with a total reaction volume of 10 μl. This mixture contained: 1 μl of 10× buffer, 1 μl of DNA recombinase, 4 μl of double-digested and recovered PbbZIP4 gene, 2 μl of double-digested and recovered PCMBIA1300 vector product, and 2 μl of double-distilled water. The reaction was carried out at 37℃ for 30 min to obtain the ligation product. The ligation product was transformed into *E. coli* DH5α and cultured on LB agar plates containing 50 mg / L kanamycin for 16 h. Positive clones were picked, cultured, and plasmids were extracted for PCR identification. Sequencing confirmed the absence of coding frame mutations, yielding recombinant clones containing the inserted target fragment. These clones were named p1300-PbbZIP4 recombinant vectors and introduced into *Agrobacterium* GV3101 using the freeze-thaw method.

[0054] 2. The steps of Agrobacterium-mediated callus genetic transformation are as follows:

[0055] (1) Agrobacterium culture: Take Agrobacterium tumefaciens bacterial culture stored in an ultra-low temperature freezer, streak it on LB agar plates containing 50 mg / L kanamycin and 50 mg / L rifampin, and incubate at 28℃ for 36-48 hours. Scrape off the streaks and add them to liquid MS medium (2.37 g / L MS + 50 g / L sucrose + 0.1 mg / L IBA, pH = 5.8). Incubate at 28℃ for 30 min with shaking. When the bacterial concentration reaches OD = 0.8-1.0, add 200 μl / L of surfactant sweet77 for inoculation.

[0056] (2) Inoculation: Take wild-type callus tissue in good condition, remove all seed pods, and then soak it in Agrobacterium tumefaciens solution for 1 hour and culture it in the dark for 24 hours.

[0057] 3. Screening of transgenic positive seedlings

[0058] The PbbZIP4 gene-transfected callus tissue obtained according to the above method was transferred to MS selective medium containing 50 mg / L hygromycin and 50 mg / L termethin and cultured at 22°C in the dark. After one month of growth, the fast-growing callus tissue was selected and transplanted to a new medium for subculture.

[0059] 3.1 Extraction of transgenic callus DNA

[0060] PbbZIP4 gene-transformed callus was obtained using the above method. DNA was extracted from the callus, and primers were designed for PCR amplification to identify positive callus.

[0061] (1) Take an appropriate amount of callus and grind it into powder with liquid nitrogen. Then add 500 μl of CTAB (100 mmol / L Tris-HCl pH 8.0, 1.5 mmol / L NaCl, 50 mmol / L EDTA pH 8.0, 2% w / v CTAB, fully dissolved in a 65℃ water bath) and 10 μl of β-mercaptoethanol, and mix well.

[0062] (2) Heat in a 65℃ water bath for 30 min, and remove and gently invert every 10 min to mix; centrifuge at room temperature for 10 min at 10000g; take the supernatant, add 500μl of chloroform-isoamyl alcohol (chloroform:isoamyl alcohol volume ratio is 24:1), and invert to mix.

[0063] (3) Centrifuge at 10000g for 10 min, take 450 μl of the supernatant into a new 1.5 ml centrifuge tube, add 450 μl of isopropanol, and mix by inverting the tube.

[0064] (4) Centrifuge at 10000g for 10 min, discard the supernatant, rinse twice with 1 mL of 75% ethanol, centrifuge at 10000g for 10 min to completely remove the ethanol, and place in a clean bench to air dry until the DNA becomes colorless and transparent.

[0065] (5) Add 50 μl of ultrapure water, place in a 65℃ incubator for 40 min to dissolve, and then perform gel detection.

[0066] 3.2 Detection of positive transgenic callus

[0067] PCR amplification was performed using gene-specific primers. The reaction procedures and systems are shown in Tables 3 and 4, respectively. PCR was performed using upstream and downstream primers (SEQ ID NO: 3, ATGTCAGTCCCAATCAGAGCAGG and SEQ ID NO: 4, CTTAACTGATCCTTGCTTTTGCTCA). Lines that amplified the expected size fragment were considered positive transgenic lines.

[0068] Table 3 PCR reaction procedure

[0069] step 94℃ 58℃ 72℃ 4℃ Cycle number Step 1 3min 1 Step 2 30s 30s 55s 35 Step 3 90s 1 Step 4 10min Step 5 30min

[0070] Table 4 PCR reaction system

[0071]

[0072]

[0073] like Figure 4 The target band could be observed in transgenic lines OE1, OE2, OE3, and OE4, but not in WT, indicating that OE1, OE2, OE3, and OE4 are transgenic positive calluses.

[0074] Example 5

[0075] Resistance identification of PbbZIP4 transgenic plants

[0076] To determine whether PbbZIP4 transgenic callus is related to anthracnose resistance, both control and transgenic lines were subjected to anthracnose stress treatment. Results showed that pear callus overexpressing PbbZIP4 was more sensitive to anthracnose than wild-type callus. This was evident in the significantly faster mycelial growth rate on PbbZIP4-overexpressing pear callus compared to the wild type. Catalase (CAT), chitinase (CHI), phenylalanine ammonia-lyase (PAL), and polyphenol oxidase (PPO) are all physiological indicators that can measure plant resistance to pathogens. After anthracnose infection, the activities of CAT, CHI, PAL, and PPO in PbbZIP4-overexpressing callus were significantly lower than those in the control, whereas there were no differences before infection. Therefore, pear callus overexpressing PbbZIP4 is more susceptible to anthracnose infection than the control. Figure 5 ).

[0077] Example 6

[0078] Instantaneous transformation of wild pear seedlings

[0079] 1. Construction of virus-induced gene silencing vector

[0080] The viral silencing vector was constructed according to the method in Example 4. The viral silencing vector pTRV2 had two restriction enzyme sites, XbaI and SmaI. Following the general principles of primer design, upstream and downstream primers (SEQ ID NO: 11 and SEQ ID NO: 12) were designed using Primer Primer 5.0 software to amplify the PbbZIP4 gene (reaction procedure as shown in Table 3) and insert it between the two restriction enzyme sites on the vector, obtaining the recombinant vector pTRV2-PbbZIP4, which was then transformed into Agrobacterium GV3101 competent cells.

[0081] 2. Virus-induced gene silencing in pear seedlings

[0082] (1) Agrobacterium culture: Agrobacterium tumefaciens culture stored in an ultra-low temperature freezer was cultured in LB liquid medium supplemented with kanamycin 50 mg / L and rifampin 50 mg / L at 28°C and 220 rpm for 12 h. The cultured bacterial culture was centrifuged at 6000g for 10 min to collect the bacterial cells. The precipitate was resuspended in infection solution (10 mM MgCl2, 10 mM MES, 200 mM acetylsyl syringone, pH 5.6) until the concentration reached OD = 0.8-1.0;

[0083] (2) Induction of bacterial culture: Place the bacterial culture with adjusted OD value in the dark and induce at room temperature for 4 hours at 100 rpm;

[0084] (3) Pear seedling injection: pTRV1 and pTRV2 bacterial solutions were mixed in a 1:1 ratio as the control group, and pTRV1 and pTRV2-PbbZIP4 bacterial solutions were mixed in a 1:1 ratio as the experimental group. The seedlings were injected with pear seedlings that were 45 days old, had the same growth status, and were in good health.

[0085] 3. Identification of virus-induced gene silencing suppression positive vaccines

[0086] After injection, pear seedlings were treated in the dark at room temperature for 12 hours, followed by 5 days of normal culture. RNA was extracted from seedlings of each line from both the control and experimental groups. The RNA structure was verified by gel electrophoresis, and its concentration was determined using Nanodrop (200-1000 ng / μl). The total RNA amount was adjusted to 3 μg and then reverse transcribed into cDNA. Tubulin from pear was then used as an internal control for amplification. The nucleotide sequence of the Tubulin primers is as follows:

[0087] Tubulin forward primer: 5'-TGGGCTTTGCTCCTCTTAC-3' (SEQ ID NO: 7)

[0088] Tubulin reverse primer: 5'-CCTTCGTGCTCATCTTACC-3' (SEQ ID NO: 8)

[0089] like Figure 6 The bands amplified by Tubulin were all of uniform brightness, indicating that the concentration of reverse-transcribed cDNA was the same. Then, qRT-PCR was performed using PbbZIP4-specific primers to analyze the expression level of the tested lines. Based on the expression level of the PbbZIP4 gene, three plants with lower expression levels were selected as virus-silencing positive lines.

[0090] See results Figure 6As shown, qRT-PCR was performed using gene-specific primers and the internal control primer Tubulin to detect gene expression levels in gene-silenced positive plants. This indicates that the PbbZIP4 gene in virus-silenced positive pear seedling lines was silenced.

[0091] Example 7

[0092] PbbZIP4 virus-silenced plant resistance identification

[0093] To investigate the function of PbbZIP4 in responding to anthracnose, detached leaves of PbbZIP4-silenced plants and controls were punctured with a sterile needle, then sprayed with anthracnose spore suspension, and the leaves were incubated in the dark at 25°C for 4 days.

[0094] The results showed that the diameter of lesions on the leaves of PbbZIP4-silenced plants was significantly smaller than that of the control, and the stomatal aperture was also smaller. After infection with anthracnose, the contents of CAT, CHI, PAL, and PPO in the leaves of PbbZIP4-silenced plants were significantly higher than those in the control, whereas only the PPO content showed a difference before infection, but this difference was more significant after treatment. In conclusion, pears that have had PbbZIP4 silenced by VIGS are more susceptible to anthracnose infection than the control.

[0095] Analysis of the above results indicates that the PbbZIP4 gene is closely related to plant resistance to anthracnose. Overexpression of the PbbZIP4 gene can effectively enhance the reactive oxygen species scavenging capacity of transgenic plants, maintain intracellular ion balance and osmotic potential homeostasis, thereby improving the plant's resistance to anthracnose.

[0096] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A transcription factor PbbZIP4 that affects the susceptibility of plants to anthracnose, characterized in that, The amino acid sequence of the transcription factor PbbZIP4 is shown in SEQ ID NO:

1.

2. The gene encoding the transcription factor PbbZIP4 according to claim 1, characterized in that, The nucleotide sequence is shown in SEQ ID NO:

2.

3. The application of suppressing the expression of the encoding gene of claim 2 in reducing the susceptibility of plants to anthracnose, wherein the plant is Pyrus pyrifolia.

4. The use of the reagent for knocking out or silencing the gene expression of claim 2 in the cultivation of anthrax virus-resistant plant varieties, wherein the plant is *Pyrus pyrifolia*.

5. The application according to claim 4, characterized in that, The reagents used to knock out or silence gene expression include the recombinant viral silencing vector pTRV2- PbbZIP4.

6. A method for cultivating plant varieties resistant to anthracnose, characterized in that, The expression of transcription factor PbbZIP4 in a plant was knocked out or inhibited. The amino acid sequence of the transcription factor PbbZIP4 is shown in SEQ ID NO.

1. The plant is Pyrus pyrifolia.

Images