A class of deletion mutants, cell slides, kits, and applications for the detection of GFAP autoantibodies

By constructing GFAP recombinant mutant cell slides with specific nucleotide deletions, the problem of background signal ambiguity in GFAP autoantibody detection was solved, improving the accuracy and reliability of the detection.

CN116082487BActive Publication Date: 2026-05-26SHAANXI MYBIOTECH CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-13
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

In existing methods for detecting GFAP autoantibodies, the presence of background signals can cause blurred staining images, which can easily lead to false positive or false negative results.

Method used

Recombinant mutants were constructed by deleting nucleotides at any multiple of 3 from the 1st nucleotide at the 5' end of the GFAP nucleotide sequence to positions 186-309. Cell slides were prepared by transfecting the mutants into expression cells, and a kit was made using labeled antibodies and washing buffer for detection.

Benefits of technology

It effectively solves the problem of long protrusion signals during the detection process, improves the reliability of GFAP autoantibody diagnosis, especially the specificity of detection, and reduces false positive or false negative results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116082487B_ABST
    Figure CN116082487B_ABST
Patent Text Reader

Abstract

This invention discloses a class of deletion mutants, cell slides, kits, and applications for the detection of GFAP autoantibodies. The invention constructs multiple GFAP recombinant mutants. Experiments show that when any nucleotide at a multiple of 3 from the 5' end of the GFAP nucleotide sequence to positions 186-309 is deleted, these deletion mutants are transformed into expression cells to prepare GFAP mutant cell slides. Using these GFAP mutant cell slides to detect serum and cerebrospinal fluid from patients, the long protrusion signal disappears, thus solving the problem of long protrusion signals in the detection of GFAP autoantibodies. This effectively solves the background signal problem encountered during detection, thereby improving the reliability of GFAP autoantibody diagnosis, especially the specificity of detection. It effectively solves the technical problem in existing GFAP autoantibody detection methods where the presence of background signals leads to blurred staining images, resulting in false positives or false negatives.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of antibody detection technology, specifically relating to a class of deletion mutants, cell slides, kits, and applications for the detection of GFAP autoantibodies. Background Technology

[0002] Autoimmune glial fibrillary acidic protein astrocytopathy is a treatable autoimmune inflammatory disease of the central nervous system, first named in 2016 by Flanagan et al. of the Mayo Clinic in the United States. The disease primarily affects the meninges, brain, spinal cord, and optic nerve. Major clinical manifestations include fever, headache, involuntary movements, myelitis, optic nerve abnormalities, ataxia, mental and emotional disturbances, epilepsy, autonomic dysfunction, and other meningoencephalopathy symptoms and signs. The disease is sensitive to corticosteroid therapy. Antibodies against glial fibrillary acidic protein (GFAP) of astrocytes, also known as GFAP immunoglobulin G (GFAP-IgG), are considered to be specific biomarkers for this disease (Flanagan E, Hinson S, Lennon V, et al. GFAP-IgG as biomarker of autoimmune astrocytopathy: analysis of 102 patients: autoimmune GFAP astrocytopathy[J]. Ann Neurol, 2017, 81).

[0003] For the detection of GFAP autoantibodies, the currently recommended methods are cell-based assay (CBA) and / or tissue-based assay (TBA). GFAP has at least eight isoforms, with the GFAPα isoform being the most common in adult astrocytes. Previous studies have also found that GFAPα isoform antibodies are more prevalent in patients with this disease. Therefore, the CBA method primarily detects GFAPα isoform antibodies (Zhang Yinxi et al. Autoimmune glial fibrillary acidic protein astrocyte disease [J]. Chinese Journal of Neurology, 2020, 53: 317-320). However, during experiments, researchers discovered that cells overexpressing GFAPα protein exhibit long protrusions during serum staining. These long protrusions blur the images of positively stained cells or may be confused with cells positive for GFAP autoantibodies, leading to misinterpretation and false positive or false negative results. Summary of the Invention

[0004] In order to overcome the shortcomings of the prior art, the present invention aims to provide a class of deletion mutants, cell slides, kits and applications for the detection of GFAP autoantibodies, so as to solve the technical problem in the existing GFAP autoantibody detection methods that the staining image is blurred due to the presence of background signals, resulting in false positives or false negatives in the detection results.

[0005] To achieve the above objectives, the present invention employs the following technical solution:

[0006] This invention discloses a class of deletion mutants for the detection of GFAP autoantibodies. The deletion mutant is a recombinant mutant that omits any nucleotide at a multiple of 3 from the first nucleotide at the 5' end of the GFAP nucleotide sequence to positions 186-309.

[0007] Preferably, the deletion mutant is able to recognize the autoantibody of GFAP and the sample staining shows no long protrusion signal.

[0008] Preferably, the deletion mutant is selected from any one of the following mutants:

[0009] The following mutants are found to be missing positions 1-186 of the nucleotide sequence shown in SEQ ID NO:1 (sequence shown in SEQ ID NO:2); missing positions 1-210 of the nucleotide sequence shown in SEQ ID NO:1 (sequence shown in SEQ ID NO:3); missing positions 1-240 of the nucleotide sequence shown in SEQ ID NO:1 (sequence shown in SEQ ID NO:4); missing positions 1-270 of the nucleotide sequence shown in SEQ ID NO:1 (sequence shown in SEQ ID NO:5); and missing positions 1-309 of the nucleotide sequence shown in SEQ ID NO:1 (sequence shown in SEQ ID NO:6).

[0010] The present invention also discloses a cell spreader for detecting GFAP autoantibodies, which is prepared by transfecting the above-mentioned deletion mutant for GFAP autoantibody detection into expression cells.

[0011] Preferably, the deletion mutant for GFAP autoantibody detection is transfected onto a cell-coated slide using a transfection reagent, and after 36–72 h of transfection, the cells are fixed to obtain a cell slide.

[0012] More preferably, the transfection reagent is PEI, lipofectamin2000, lipofectamin3000, lipo6000 or lipo8000; and the cells are fixed with formaldehyde, acetone, methanol, ethanol or paraformaldehyde.

[0013] The present invention also discloses a kit for detecting GFAP autoantibodies, which is made by using the above-mentioned cell smear for detecting GFAP autoantibodies, labeling antibodies, and adding washing solution.

[0014] Preferably, the labeled antibody is a FITC-labeled antibody or an Alexa Fluor-labeled antibody; the washing solution is PBS or PBST.

[0015] The present invention also discloses the application of the above-mentioned deletion mutant for GFAP autoantibody detection in the preparation of reagents for diagnosing autoimmune diseases.

[0016] Preferably, the autoimmune disease is glioma or meningoencephalitis.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] This invention constructs multiple GFAP recombinant mutant vectors using genetic engineering methods. Experiments show that when any nucleotide at a multiple of 3 position from the 5' end of the GFAP nucleotide sequence to positions 186-309 is deleted, these deletion mutants are transformed into expression cells to prepare GFAP mutant cell slides. Using these GFAP mutant cell slides to detect serum and cerebrospinal fluid from patients, the long protrusion signal disappears, thus solving the problem of long protrusion signals in the detection of GFAP autoantibodies. This effectively addresses the background signal problem encountered during detection, thereby improving the reliability of GFAP autoantibody diagnosis, especially enhancing the specificity of detection. It effectively solves the technical problem in existing GFAP autoantibody detection methods where the presence of background signals leads to blurred staining images, resulting in false positives or false negatives. Attached Figure Description

[0019] Figure 1 The images show the staining results of the full-length GFAP nucleic acid sequence and mutants that can recognize GFAP autoantibodies but have long protrusion signals; where AF represents the full-length GFAP nucleic acid sequence and the staining results of GFAP with nucleotides missing from positions 1-30, 1-60, 1-90, 1-120, and 1-150.

[0020] Figure 2 The image shows the staining results of a mutant that can recognize autoantibodies and has no long protrusions; where AE represents the staining results of GFAP's full-length nucleic acid sequence with deletions of nucleotides 1-186, 1-210, 1-240, 1-270, and 1-309, respectively.

[0021] Figure 3The image shows the staining results of mutants that do not recognize autoantibodies and do not have long protrusions. AI represents the staining results of the full-length nucleotide sequence of GFAP, specifically the deletions of nucleotides 1-345, 1-360, 1-390, 1-420, 1-864, 435-1296, 1-432 & 867-1296, 1-768 & 1134-1296, and 1-768 & 1134-1296, respectively. G represents the co-transformation results of the two GFAP deletion mutants, GFAP△1-345 & 645-1296 and GFAP△1-768 & 1134-1296. Staining results; K represents the staining results after co-transformation of three GFAP deletion mutants: GFAP△435-1296, GFAP△1-432&867-1296, and GFAP△1-864; L represents the staining results after co-transformation of six GFAP deletion mutants: GFAP△435-1296, GFAP△1-432&867-1296, GFAP△1-864, and GFAP△1-345&645-1296, GFAP△1-768, and 1134-1296, which contain three nucleotide sequences at the linker sites.

[0022] Figure 4 The results show the effects of different vectors on long protrusion signaling; where A is the cell slice of Example 1 (pCDNA3.1 vector); B is the GFAP gene expressed by the 17-T2A vector in Comparative Example 1.

[0023] Figure 5 The results show the effects of different cell types on long process signaling; where A is the cell slice (293T cells) from Example 1; and B is the control 2F6 cells overexpressing GFAP protein.

[0024] Figure 6 The results show the effects of different fixation methods on the signal of long protrusions; where A is the cell slide (acetone fixation) of Example 1; B is the cell slide fixed with formaldehyde in Comparative Example 3.

[0025] Figure 7 The results show the effects of different fixation methods on the signal of long protrusions; where A is the cell spread sheet (transient transfection) of Example 1; B is the cell spread sheet prepared by stable transfection in Comparative Example 4;

[0026] Figure 8 The results show the effects of different fixation methods on the signal of the long protrusion; where A is the cell slide of Example 1 (overexpressing the human GFAP gene); B is the cell slide prepared from the GFAP gene of the mouse in Comparative Example 5. Detailed Implementation

[0027] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0028] It should be noted that the terms "first," "second," etc., in the specification, claims, and accompanying drawings of this invention are used to distinguish similar objects and are not necessarily used to describe a specific order or sequence. It should be understood that such data can be interchanged where appropriate so that the embodiments of the invention described herein can be implemented in orders other than those illustrated or described herein. Furthermore, the terms "comprising" and "having," and any variations thereof, are intended to cover a non-exclusive inclusion; for example, a process, method, system, product, or apparatus that comprises a series of steps or units is not necessarily limited to those steps or units explicitly listed, but may include other steps or units not explicitly listed or inherent to such processes, methods, products, or apparatus.

[0029] The present invention will now be described in further detail with reference to the accompanying drawings:

[0030] The technical solution approach adopted in this invention is as follows:

[0031] (1) Using genetic engineering methods, recombinant full-length vectors and recombinant mutant vectors of GFAP were constructed;

[0032] The GFAP full-length gene sequence has the NCBI accession number NM_002055.5;

[0033] The full-length nucleic acid sequence of GFAP is as follows (1299bp):

[0034]

[0035] The recombinant mutant vectors are 19 deletion mutants with partial deletions of nucleic acid sequences based on the full-length nucleic acid sequence. These deletions are: positions 1-30 (named GFAP△1-30), 1-60 (named GFAP△1-60), 1-90 (named GFAP△1-90), 1-120 (named GFAP△1-120), 1-150 (named GFAP△1-150), 1-186 (named GFAP△1-186), 1-210 (named GFAP△1-210), 1-240 (named GFAP△1-240), 1-270 (named GFAP△1-270), 1-309 (named GFAP△1-309), and 1-345 (named GFAP△1-309). Mutants containing the following nucleic acids: GFAP△1-345, positions 1-360 (named GFAP△1-360), 1-390 (named GFAP△1-390), 1-420 (named GFAP△1-420), 1-864 (named GFAP△1-864), 435-1296 (named GFAP△435-1296), simultaneously deleting positions 1-432 and 867-1296 (named GFAP△1-432&867-1296), simultaneously deleting positions 1-345 and 645-1296 (named GFAP△1-345&645-1296), and simultaneously deleting positions 1-768 and 1134-1296 (named GFAP△1-768&1134-1296);

[0036] (2) The recombinant mutant vector constructed above was transfected into the 293T cell smears using transfection reagents. After 36-72 h of transfection, the cells were fixed and prepared into cell smears for detection.

[0037] The transfection reagents mentioned are PEI, lipofectamin 2000, lipofectamin 3000, lipo6000, lipo8000, etc.;

[0038] The transfection method described is either transient transfection or stable transfection;

[0039] The cell-coated slides mentioned above are those with a cell density of 30% to 40%.

[0040] The fixative is formaldehyde, acetone, methanol, ethanol, paraformaldehyde, etc.

[0041] The cell slides used for detection are 2.5mm × 2.5mm in size or can be cut to a suitable size as needed;

[0042] (3) Use the prepared cell smears to test the samples and obtain mutant cell smears that can recognize GFAP autoantibodies and have no long protrusion signal.

[0043] The samples mentioned are serum and cerebrospinal fluid;

[0044] The detection steps include: a) taking the cell smear prepared in step 2 and incubating the sample to be tested; b) washing with washing solution; c) continuing to incubate the cell smear prepared in step a with labeled antibody; d) washing with washing solution; e) observing the results.

[0045] The recombinant mutants that can recognize GFAP autoantibodies and have no long spike signal are GFAP△1-186 (sequence shown in SEQ ID NO:2), GFAP△1-210 (sequence shown in SEQ ID NO:3), GFAP△1-240 (sequence shown in SEQ ID NO:4), GFAP△1-270 (sequence shown in SEQ ID NO:5), and GFAP△1-309 (sequence shown in SEQ ID NO:6). That is, when the deletion position is any multiple of 3 from the first nucleotide at the 5' end of the GFAP nucleic acid sequence to any position from 186 to 309, the resulting recombinant mutants will not produce a long spike signal after expression staining.

[0046] The specific sequences of the recombinant mutants that can recognize GFAP autoantibodies and have no long protrusion signal are as follows:

[0047] 1) GFAP△1-186 nucleic acid sequence (1113bp), as shown in SEQ ID NO:2;

[0048]

[0049] 2) GFAP△1-210 nucleic acid sequence (1089), the sequence is shown in SEQ ID NO:3;

[0050]

[0051] 3) GFAP△1-240 nucleic acid sequence (1059bp), as shown in SEQ ID NO:4;

[0052]

[0053] 4) GFAP△1-270 nucleic acid sequence (1029bp), as shown in SEQ ID NO:5;

[0054]

[0055] 5) GFAP△1-309 nucleic acid sequence (990bp), as shown in SEQ ID NO:6;

[0056] ctgcgggccaaggagcccaccaagctggcagacgtctaccaggctgagctgcgagagctgcggctgcggctcgatcaactcaccgccaacagcgcccggctggaggttgagagggacaatctggcacaggacctggccactgtgaggcagaagctccaggatgaaaccaacctgaggctggaagccgagaacaacctggctgcctatagacaggaagcagatgaagccaccctggcccgtctggatctggagaggaagattgagtcgctggaggaggagatccggttcttgaggaagatccacgaggaggaggttcgggaactccaggagcagctggcccgacagcaggtccatgtggagcttgacgtggccaagccagacctcaccgcagccctgaaagagatccgcacgcagtatgaggcaatggcgtccagcaacatgcatgaagccgaagagtggtaccgctccaagtttgcagacctgacagacgctgctgcccgcaacgcggagctgctccgccaggccaagcacgaagccaacgactaccggcgccagttgcagtccttgacctgcgacctggagtctctgcgcggcacgaacgagtccctggagaggcagatgcgcgagcaggaggagcggcacgtgcgggaggcggccagttatcaggaggcgctggcgcggctggaggaagaggggcagagcctcaaggacgagatggcccgccacttgcaggagtaccaggacctgctcaatgtcaagctggccctggacatcgagatcgccacctacaggaagctgctagagggcgaggagaaccggatcaccattcccgtgcagaccttctccaacctgcagattcgagaaaccagcctggacaccaagtctgtgtcagaaggccacctcaagaggaacatcgtggtgaagaccgtggagatgcgggatggagaggtcattaaggagtccaagcaggagcacaaggatgtgatgtga.

[0057] (4) The mutant cell smears obtained in step 3 are labeled with antibodies and washing solution and assembled into a kit for the detection of GFAP autoantibodies, thereby assisting in the diagnosis of the disease;

[0058] The labeled antibody is either a FITC-labeled antibody or an antibody labeled with Alexa Fluor dye;

[0059] The washing solution is PBS or PBST;

[0060] The diseases mentioned include gliomas, meningoencephalitis, and other autoimmune diseases.

[0061] Example 1: Preparation of GFAP mutant cells to solve the problem of long protrusion signaling in cells overexpressing full-length GFAP.

[0062] Step 1: Construct the full-length recombinant GFAP and the recombinant GFAP mutant vector using genetic engineering methods;

[0063] The DNA sequence of GFAP protein (SEQ ID NO.1) was synthesized into pCDNA3.1 using artificial synthesis methods, with NheI and NotI restriction enzyme sites inserted. The recombinant vector was named pCDNA3.1-GFAP. At the same time, a total of 19 recombinant GFAP mutant vectors were constructed using genetic engineering methods.

[0064] Step 2: Transfect the constructed recombinant full-length and mutant vectors into the cell-coated slides using transfection reagents. After 24–48 h, fix the cells and prepare cell slides for detection.

[0065] The preparation method of the cell smears used is as follows:

[0066] (1) 293T cell culture (purchased from ATCC): DMEM high glucose medium and FBS were mixed at a ratio of 9:1 to prepare 10% FBS-DMEM high glucose medium. When the cells were fully covered, they were passaged into 10cm cell culture dishes at a ratio of 1:5 to 1:6 and cultured overnight in a cell culture incubator at 37℃ and 5% CO2. The next day, the cell density was 30% to 40%.

[0067] Using PEI transfection reagent (purchased from Thermo Biotech, transfection procedure performed according to the instructions), the recombinant mutant vectors shown in Table 1 were transfected into 293T cells grown on cell spreads (the transfection plasmid mass was 6 μg, and the PEI mass was 12 μg; if multiple plasmids were co-transfected, the transfection mass of each plasmid was equal, and the total mass was 6 μg). After 48 h of transfection, the cells were washed twice with PBS, fixed with acetone for 30 min, washed twice with PBS, dried in an oven, and then cut into 2.5 mm × 2.5 mm cell spreads for later use.

[0068] Table 1. Various mutants used for transfection (including single and multiple transfections of recombinant mutants).

[0069]

[0070] Step 3: Use the prepared cell smears to test the samples and obtain mutant cell smears that can recognize GFAP autoantibodies and have no long protrusions.

[0071] a. Primary antibody incubation: Take the cell smears prepared in step 2 and incubate them with the patient's serum for 1 hour;

[0072] b. Wash three times with PBST, 5 minutes each time;

[0073] c. Continue incubation of the cell slides with FITC-labeled secondary antibody for 30 min;

[0074] d. Wash three times with PBST, 5 minutes each time;

[0075] e. Observation results.

[0076] The experimental results are as follows:

[0077] The following table shows the status of each mutant in recognizing autoantibodies in patient samples and whether they produce a long, protruding background:

[0078] a. Although overexpression of GFAP on 293T cells can recognize autoantibodies, the signal with long protrusions is as follows: Figure 1 The stained images of the samples shown are, in order, the full-length GFAP and the following mutants: GFAP△1-30, GFAP△1-60, GFAP△1-90, GFAP△1-120, and GFAP△1-150;

[0079] b. The mutant that, after overexpression on 293T cells, can recognize autoantibodies that recognize GFAP and does not exhibit long protrusion signals is... Figure 2 The stained images of the samples shown are: GFAP△1-186, GFAP△1-210, GFAP△1-240, GFAP△1-270, and GFAP△1-309.

[0080] c. The mutants that, after overexpression on 293T cells, cannot recognize GFAP autoantibodies and show no long protrusion signal are: GFAP△1-345, GFAP△1-360, GFAP△1-390, GFAP△1-420, GFAP△1-864, GFAP△435-1296, GFAP△1-432 & 867-1296, GFAP△1-768 and 1134-1296, and GFAP△1-768 and 1134-1296. Co-transfection with multiple mutants resulted in neither recognition of GFAP autoantibodies nor long protrusion signal. The following mutants were co-transfected: GFAP△1-345 & 645-1296 and GFAP△1-768 & 1134-1296; GFAP△435-1296, GFAP△1-432 & 867-1296 and GFAP△1-864; GFAP△435-1296, GFAP△1-432 & 867-1296, GFAP△1-864, GFAP△1-345 & 645-1296 and GFAP△1-768 & 1134-1296; staining images of samples co-transfected with each mutant and mutant combinations are shown in the following figures. Figure 3 As shown;

[0081] in conclusion:

[0082] When nucleotides 1-30, 1-60, 1-90, 1-120, and 1-150 of the full-length GFAP nucleic acid sequence are deleted, significant long protrusion signals are still observed after expression and sample staining (in order of length). Figure 1 As indicated by the arrow AF in the middle, it can be seen that the deletion of the first 150 nucleotides does not improve or solve the problem of long protrusion signal.

[0083] When nucleotides 1-186, 1-210, 1-240, 1-270, and 1-309 of the full-length GFAP nucleic acid sequence are deleted, no long protrusion signal is observed after expression and sample staining (in order of length). Figure 2 The AE (anti-inflammatory signal) in the GFAP nucleic acid sequence is consistent and easily identifiable, thus resolving the background issue of long protrusions. Therefore, when the deletion position is any multiple of 3 from the first nucleotide at the 5' end of the GFAP nucleic acid sequence to any position between 186 and 309, the resulting recombinant mutants, after expression staining, are all mutants that do not produce long protrusion signals.

[0084] When the full-length nucleotide sequence of GFAP is deleted at positions 1-345, 1-360, 1-390, 1-420, 1-864, 435-1296, 1-432 & 867-1296, 1-768 & 1134-1296, and 1-768 & 1134-1296, no signal can be detected in positive samples after expression (in descending order). Figure 3 AI in the middle);

[0085] Cotransformation of the two domains of GFAP, namely GFAPΔ1-345&645-1296 and GFAPΔ1-768 and 1134-1296, yielded no positive signal. Figure 3 (G in the text); Co-transformation of the three deletion mutants that together form the full-length GFAP, namely GFAP△435-1296, GFAP△1-432&867-1296 and GFAP△1-864, still did not detect a positive signal. Figure 3 The three deletion mutants that together form the full-length GFAP, namely GFAP△435-1296, GFAP△1-432&867-1296, and GFAP△1-864, along with the deletion mutants containing three nucleotide sequences at the linker, namely GFAP△1-345&645-1296 and GFAP△1-768 and 1134-1296, were co-transformed, but no positive signal was detected. Figure 3 Based on this, we infer that when detecting GFAP autoantibodies using the CBA method, the recognition epitopes of GFAP autoantibodies are located at positions 309 to 1296, and the recognition sites are conformationally related.

[0086] Comparative Example 1 used a vector change to address the problem of long protrusions in GFAP-overexpressing cells.

[0087] The DNA sequence of the GFAP protein (SEQ ID NO.1) was synthesized into 17-T2A-GFAP using genetic engineering methods (the sequence of this vector has been disclosed by the applicant in patent application No. ZL201910738547.4), with NheI and NotI restriction enzyme sites inserted. Then, cell smears were prepared according to the method described in Example 1 for detecting autoantibodies in the cerebrospinal fluid of patients. Figure 4 It can be seen that the background signal of the long protrusion still exists, and the background problem of the long protrusion has not been solved after changing the carrier.

[0088] Comparative Example 2 used cell replacement to address the issue of long protrusions in GFAP-overexpressing cells.

[0089] Comparative Example 2 used the full-length pCDNA3.1-GFAP recombinant vector for transfection. The cells used for transfection were F6 cells isolated in our laboratory that lacked filamentous background signals. F6 cells are monoclonal cells that stably express antigens without filamentous background signals. These monoclonal cells were derived from HEK293 cells and prepared using a serial dilution method. Cell slides were prepared as follows: monoclonal cells that stably express antigens without filamentous background signals were isolated and screened using a serial dilution method; the screened monoclonal cells were cultured and, after reaching a suitable density, were transfected; the transfected cells were fixed using a fixative to prepare cell slides. The fixative used was formaldehyde or paraformaldehyde. Positive signals were enhanced by adding Tris-HCl buffer (pH 8.0) to the prepared cell slides. (This cell line and the specific preparation method have been disclosed in application No. 202111022980.1.)

[0090] Comparative Example 2: Cell crawling slides for detection were prepared according to the method described in Example 1 for detecting autoantibodies in the cerebrospinal fluid of patients. Figure 5 The results showed that the background of the long protrusions still existed, and the problem of the background of the long protrusions was not resolved after changing the transfected cells.

[0091] Comparative Example 3 used a method of replacing fixation to address the problem of long protrusions in GFAP-overexpressing cells.

[0092] Comparative Example 3 used full-length pCDNA3.1-GFAP as the recombinant vector and 2% formaldehyde as the fixative. Comparative Example 3 prepared cell slides for detection according to the method described in Example 1 (with the fixative replaced by 2% formaldehyde) for detecting autoantibodies in the cerebrospinal fluid of patients. Figure 6 The results showed that the background of the long protrusions still existed, and the background problem of the long protrusions was not solved after changing the fixing method.

[0093] Comparative Example 4 used a different transfection method to address the issue of long protrusions in GFAP-overexpressing cells.

[0094] Comparative Example 4 used the full-length pCDNA3.1-GFAP recombinant vector for transfection. The pCDNA3.1-GFAP was transfected into 293T cells using a stable transfection method to obtain a cell line stably expressing GFAP protein (this transfection method means that the gene encoding human GFAP is integrated into the host genome, and the transfected cells can permanently express GFAP protein). Cell slides prepared using the stable transfection method were then used to verify the detection of autoantibodies in the cerebrospinal fluid of patients. Figure 7The results showed that the background of the long protrusions still existed, and the background problem of the long protrusions was not resolved after changing the transfection method of the recombinant vector.

[0095] Comparative Example 5 addressed the issue of long protrusions in GFAP-overexpressing cells by changing the gene species.

[0096] Comparative Example 5 used the mouse GFAP gene for transfection. The mouse GFAP protein DNA sequence (accession number: NM_010277.3) was synthesized into pCDNA3.1-GFAP using genetic engineering methods, with NheI and NotI restriction enzyme sites inserted. Then, cell smears were prepared according to the method described in Example 1 for detecting autoantibodies in patient samples. Figure 8 It can be seen that the background of the long protrusion still exists, and the background problem of the long protrusion has not been resolved after the gene was replaced in the species.

[0097] The above content is only for illustrating the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solution based on the technical concept proposed in this invention shall fall within the scope of protection of the claims of this invention.

Claims

1. A class of deletion mutants for GFAP autoantibody detection, characterized in that, The deletion mutant is selected from any of the following mutants: The following mutants are found to be missing positions 1-186 of the nucleotide sequence shown in SEQ ID NO:1: GFAP△1-186 deletion mutant; missing positions 1-210 of the nucleotide sequence shown in SEQ ID NO:1: GFAP△1-210 deletion mutant; missing positions 1-240 of the nucleotide sequence shown in SEQ ID NO:1: GFAP△1-240 deletion mutant; missing positions 1-270 of the nucleotide sequence shown in SEQ ID NO:1: GFAP△1-270 deletion mutant; missing positions 1-309 of the nucleotide sequence shown in SEQ ID NO:1: GFAP△1-309 deletion mutant.

2. The deletion mutant for detection of GFAP autoantibodies according to claim 1, characterized in that, The deletion mutant can recognize the autoantibody of GFAP and the sample staining shows no long protrusion signal.

3. A cell crawl sheet for detecting GFAP autoantibody, characterized by, Cell slides are prepared by transfecting the deletion mutant for GFAP autoantibody detection as described in claim 1 or 2 into expressing cells.

4. The cell crawl for detecting GFAP autoantibody according to claim 3, characterized in that, The deletion mutant used for GFAP autoantibody detection was transfected onto cell-coated slides using a transfection reagent. After transfection for 36–72 h, the cells were fixed to obtain cell slides.

5. The cell crawl for detecting GFAP autoantibody according to claim 4, wherein, Transfection reagents used include PEI, lipofectamin 2000, lipofectamin 3000, lipo6000, or lipo8000; cell fixation was performed using formaldehyde, acetone, methanol, ethanol, or paraformaldehyde.

6. A kit for detecting GFAP autoantibodies, characterized in that, It is prepared by using the cell smear for detecting GFAP autoantibodies as described in any one of claims 3 to 5, labeling the antibody, and adding washing solution.

7. The kit for detecting GFAP autoantibodies according to claim 6, characterized in that, The labeled antibody is a FITC-labeled antibody or an Alexa Fluor-labeled antibody; the washing solution is PBS or PBST.

8. Use of the deletion mutant for the detection of GFAP autoantibodies according to claim 1 or 2 for the manufacture of a reagent for the diagnosis of autoimmune diseases, characterized in that, The autoimmune disease mentioned is autoimmune glial fibrillary acidic protein astrocyte disease.

Citation Information

Patent Citations

  • Detection materials, preparation methods and applications of anti-GABABR autoantibodies in human body fluids

    CN110606888B

  • Cell capable for reducing fluorescence non-specific color development, detection product based on cell and application of detection product in detection of autoantibody

    CN113740531A

  • Alexander disease related gene mutation, and detection method and use thereof

    CN103966226A

  • Gene for improving GFAP protein expression quantity and soluble expression method thereof

    CN113416734A