Enhanced electrode for the determination of dopamine and methods of making and using the same
By modifying carbon fiber electrodes with chitosan and brain cell membranes and using specific aptamers, especially cholesterol amphiphilic aptamers, the problems of anti-contamination and stability of carbon fiber electrodes in dopamine detection have been solved, achieving highly selective and sensitive dopamine detection, which is suitable for neurotransmitter dynamics and brain disease research.
Patent Information
- Application Number
- CN202211698498.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-28
- Publication Date
- 2025-11-11
- Estimated Expiration
- 2042-12-28
AI Technical Summary
Existing carbon fiber electrodes face issues of contamination resistance and selectivity when detecting dopamine, leading to decreased detection performance and insufficient stability in living brain tissue, which affects the research and treatment of dopaminergic neurological diseases.
Chitosan and brain cell membranes were used to modify carbon fiber electrodes, and specific aptamers, especially cholesterol amphiphilic aptamers, were combined to enhance the biocompatibility and stability of the electrodes. High selectivity and high sensitivity of dopamine detection were achieved through electrochemical methods.
It enables long-term, stable, in-situ detection of dopamine in living brain tissue, with high selectivity and sensitivity, and can effectively resist protein contamination, making it suitable for research on neurotransmitter dynamics and brain diseases.
Smart Images

Figure CN116106380B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biodetection technology, and in particular to an enhanced electrode for determining dopamine, its preparation method, and its usage method. Background Technology
[0002] Neurotransmitter dynamics in the central nervous system of living animals are crucial tools for understanding the molecular basis of brain development and disease diagnosis. Promising results have been achieved in the detection of relevant neuromarkers in living brain cells. Dopamine (DA), a catecholamine neurotransmitter playing a vital role in the dopaminergic system, is involved in motivational mechanisms, addiction mechanisms, and reinforcement learning mechanisms. Damage to the dopaminergic system leads to abnormal dopamine levels and neuropathological changes, which are associated with neurological diseases such as Parkinson's disease and schizophrenia. Lipopolysaccharide (LPS) activates microglia and astrocytes in the brain, causing neuroinflammation and damaging dopaminergic neurons. The stable, real-time, and specific detection of DA fluctuations in response to LPS-induced neuroinflammation and dopaminergic neuronal damage will have significant clinical and scientific value for the research and treatment of dopaminergic neurological diseases.
[0003] Accurate and stable dopamine (DA) monitoring is crucial for studying the chemical basis of brain function and pathology. Tissue-implantable carbon fiber electrodes (CFEs) show great potential on the sub-second timescale due to their electrochemical principles, but they face significant challenges in terms of contamination resistance, selectivity, and stability. Summary of the Invention
[0004] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:
[0005] According to a first aspect of the present invention, an enhanced electrode for determining dopamine is provided, comprising a carbon fiber electrode on which chitosan, a brain cell membrane, and a specific aptamer are sequentially modified.
[0006] Furthermore, the specific aptamer is a cholesterol amphiphilic aptamer.
[0007] According to a second aspect of the present invention, a method for preparing an enhanced electrode for determining dopamine as described above is provided, the method comprising:
[0008] Fabrication of carbon fiber electrodes;
[0009] The carbon fiber electrode was immersed in a chitosan solution, and a negative potential relative to the counter electrode in the solution was applied to the electrode for a preset time to obtain a carbon fiber electrode modified with chitosan.
[0010] Brain cell membranes were coated onto the chitosan-modified carbon fiber electrodes.
[0011] A specific aptamer was added to a carbon fiber electrode coated with the brain cell membrane to obtain an enhanced electrode for measuring dopamine.
[0012] Further, the preparation of the carbon fiber electrode includes:
[0013] A glass capillary is pulled into two thin capillaries to serve as a sheath for the carbon fiber electrode.
[0014] A carbon fiber is attached to a copper wire coated with silver conductive paste, and the copper wire is inserted into the sheath.
[0015] The ends of the carbon fiber microstructures were sealed with molten paraffin and cured in air at room temperature.
[0016] The length of the fiber extending from the glass is fixed at the glass seal.
[0017] Furthermore, the carbon fiber electrode is immersed in a chitosan solution, and a voltage of -0.5V is applied to the electrode within 300-500s to increase the anti-AA interference effect.
[0018] Furthermore, the chitosan-modified carbon fiber electrode is coated with a brain cell membrane, comprising:
[0019] Before coating, the vesicle solution was homogenized by ultrasound, and any time between 0.5 and 3.0 h was selected as the modification time for the cell membrane. Finally, the carbon fiber electrode coated with the brain cell membrane was dried.
[0020] Furthermore, adding a specific aptamer to a carbon fiber electrode coated with the brain cell membrane yields an enhanced electrode for dopamine measurement, comprising:
[0021] Based on the affinity of cholesterol for cell membranes, cholesterol amphiphilic aptamers are added to the carbon fiber electrodes coated with the brain cell membrane.
[0022] An aptamer modified with cholesterol groups at its three ends was dissolved in Mg. 2+ in solution;
[0023] Then immerse in the aptamer solution;
[0024] The electrode was rinsed and stored in phosphate buffer to prepare an enhanced electrode for dopamine determination.
[0025] Furthermore, the aptamer modified with cholesterol groups at its 3-terminus was dissolved in 5 mM Mg 2+ in solution.
[0026] Further, it was immersed in a 1 μM aptamer solution for 12 hours.
[0027] According to a third aspect of the present invention, a method of using an enhancement electrode for determining dopamine as described above is provided, the method comprising: inserting the enhancement electrode into the substantia nigra striatum (SNc) and adding an appropriate amount of potassium chloride, and determining the dopamine concentration or determining whether dopamine is present based on the current response detected by the enhancement electrode.
[0028] According to a fourth aspect of the present invention, a method of using an enhancement electrode for determining dopamine as described above is provided, characterized in that the method comprises: immersing the enhancement electrode in a PC12 cell population, depolarizing the cells using K+, and determining the dopamine concentration or determining whether dopamine is present based on the current response detected by the enhancement electrode.
[0029] Compared with the prior art, the present invention has at least the following beneficial effects:
[0030] This invention proposes a novel strategy to enhance the biocompatibility and stability of an electrode by modifying chitosan (CS) membranes and autologous brain cell membranes (M) with aptamer cholesterol amphiphilic molecules (DNA-cho). The surface morphology was studied using scanning electron microscopy, fluorescence microscopy, zeta potential analysis, and a water contact angle meter. Results showed that the CFE modification was successful and the electrode was uniformly covered by the cicada membrane. Electrochemical characterization indicated that the DNA-cho-M-CS-CFE electrode exhibited a wide linear range for DA concentration, high sensitivity, specificity, and stability. The electrode also demonstrated good antifouling properties and biocompatibility. Furthermore, this biosensor can be used to detect DA in potassium-treated (K+) brain slices and nerve cells, exhibiting good stability and sensitivity. In addition, the detection of DA in lipopolysaccharide (LPS)-treated brain slices and PC12 cells further demonstrated the electrode's value in practical applications, proving that LPS-induced delayed and reduced DA release. Aptamer-functionalized cell membrane-modified DNA-cho-M-CS-CFE not only possesses excellent electrochemical properties, but also offers essential advantages in long-term sensing in vivo and in living cells, providing a new and feasible approach for studying neurochemical dynamics and brain diseases. Attached Figure Description
[0031] Figure 1 This is a schematic diagram illustrating the preparation principle of DNA-cho-M-CS-CFE and the measurement of micromorphic dopamine on the electrode surface in this embodiment of the invention.
[0032] Figure 2The proportion of amperometric response intensity for 200 μM A and 10 μM DA (n=3), the proportion of different CS deposition times (0, 50, 200, 300, 400, 500 s) (A); the proportion of different cell membrane incubation times (M) (0, 0.5, 1.0, 2.0, 3.0 h) (B); the effect of different drying times (C);
[0033] Figure 3 The zeta potential of CS carbon cloth, M-CS carbon cloth and DNA-cho-M-CS carbon cloth films (n=3);
[0034] Figure 4 Scanning electron microscopy images of naked-CFE (A&E), CS-CFE (B&F), M-CS-CF (C&G), and DNA-cho-M-CS-CF (D&H);
[0035] Figure 5 EIS Nyquist plots of bare carbon fiber, CS-modified carbon fiber, and cell membrane-CS-modified carbon fiber;
[0036] Figure 6 To detect electrochemical properties using cyclic voltammetry (CV) and amperometric methods (n=3), CV curves for the DNA-cho-M-CS-CFE were obtained at 0, 10, 20, and 50 μM DA (A). Potential optimization was performed on the DNA-cho-M-CS-CFE at +0.08 V, +0.12 V, +0.16 V, and +0.18 V vs. Ag / AgCl (B). CV values for 200 μMAA on CS, cell membrane-modified glassy carbon electrode (GCE), and bare GCE were obtained (C). Typical amperometric responses were observed on the DNA-cho-M-CS-CFE (D) at 10 μM DA, 10 μM DOPAC, 100 μMAA, 10 μM UA, 10 μM NE, and 10 μM DA, respectively. All detections were performed in aCSF at pH 7.4. DNA-cho-M-CS-CFE responded to amperometric currents of continuously added DA from 5 nM to 100 nM (E) and 0.2 μM to 10.0 μM (G). All assays were performed in aCSF (pH = 7.4). Corresponding calibration curves (F). Application potential: +0.16 V (against Ag / AgCl);
[0037] Figure 7Schematic diagram for studying the stability, antifouling properties, and mechanical stability of DNA-cho-M-CS-CFE: Water contact angles of bare carbon cloth (A) and CS with cell membrane modified carbon cloth (B). The amperometric response of aCSF to 10 μM DA was recorded using DNA-cho-M-CS-CFE (C). Typical amperometric responses of aCSF to 10 μM DA were recorded using bare CFE (black) and DNA-cho-M-CS-CFE (red) after the addition of 10 mg mL-1 BSA (D). I0 and I represent the current values at the start and given times, respectively. The amperometric response of DNA-cho-M-CS-CFE to DA before (black) and after (red) immersion in DMEM for 1 h (pH = 7.40) (E). The amperometric response of DNA-cho-M-CS-CFE to DA in aCSF with continuous DA addition before (black) and after (red) brain slice implantation (F).
[0038] Figure 8 Biocompatibility of the materials (n=3). CCK-8 assay was used to detect the L929 control group, bare carbon cloth, and DNA-cho-M-CS modified carbon cloth (A). Fluorescence of Hela-RFP cells cultured on bare carbon cloth and modified carbon cloth (B);
[0039] Figure 9 The results of monitoring the addition of 0.04M K+ and 50nM DA sequentially using a bare-CFE.
[0040] Figure 10 Current monitoring and application of DNA-cho-M-CS-CFE in brain slices and PC12 cells (n=3 each). Ampere responses of DNA-cho-M-CS-CFE to brain slices with (red) and without (black) stimulation at a high concentration of 0.04 M K+ (A). Monitoring of DNA-cho-M-CS-CFE with three consecutive additions of 0.04 M K+ (B). Monitoring with DNA-cho-M-CS-CFE after adding 0.04 M K+ before (black) and after (red) LPS soaking (C). Ampere responses of DNA-cho-M-CS-CFE to PC12 cells stimulated with 0.4 M K+ (red), 0.4 M K+ LPS pretreatment (blue), and culture medium (black) (D). Detailed Implementation
[0041] The following examples are merely illustrative of the invention, and the scope of the invention is not limited to the embodiments described. Therefore, any non-essential modifications and adjustments made by those skilled in the art based on the above description to other embodiments are still within the scope of protection of this invention.
[0042] Example 1: Enhanced electrode for measuring dopamine
[0043] This invention provides an enhanced electrode for measuring dopamine, comprising a carbon fiber electrode on which chitosan, brain cell membrane and specific aptamers are sequentially modified.
[0044] It should be noted that carbon fiber electrodes (CFEs) are a highly biocompatible, non-toxic, and highly sensitive electrochemical substrate material that has been widely used in the field of electrochemical dopamine detection for decades. CFEs with a diameter of less than 10 μm can be implanted into living brain tissue or single cells for local tissue monitoring or single-cell detection. However, due to the molecular similarity of dopamine (DA) with ascorbic acid (AA) and uric acid (UA), the electrochemical detection of DA is often interfered with. Simultaneously, when CFEs detect living brain tissue, dopamine often non-specifically adsorbs proteins, causing contamination and reducing the electrode's detection performance. Modifying the electrode with anti-fouling materials is a common solution, but repeated modifications reduce the electrode's sensitivity and spatiotemporal resolution. Mixing modified materials increases the risk of adverse reactions such as inflammation in vivo, leading to biosafety risks. Therefore, there is an urgent need to develop a biocompatible strategy that, while ensuring excellent electrochemical performance such as specificity and sensitivity, endows the electrode with anti-fouling properties.
[0045] Chitosan has been widely used in medicine and biomedical materials due to its bioactivity. Chitosan possesses a unique molecular structure and physicochemical properties, and can be decomposed into easily absorbed and safe compounds such as amino sugars, exhibiting good biodegradability. Furthermore, chitosan provides positively charged amino groups that can repel amino acids (AAs). Its non-toxicity, simple modification, and good biocompatibility have made it an ideal biosafety matrix. Researchers have solved the problem of protein contamination by covering electrodes with brain cell membranes (M). Due to the hydrophilic portion of the phospholipid bilayer, a hydrophilic film can be formed on the electrode surface. It can bind to water molecules through hydrogen bonds or ionic interactions, forming a hydrated layer with high resistance to non-specific protein adsorption, achieving the purpose of preventing contamination. Finally, specific aptamers were introduced to improve the selectivity and sensitivity to dopamine. A single-stranded DNA or RNA containing cholesterol has a high affinity for dopamine (DA). It can bind to the electrode surface through cholesterol, rather than electrostatic interaction, increasing the stability of the electrode. By applying a voltage, DA is oxidized, and electrons pass through the cell membrane and chitosan, which is then detected by CFE. This enables the high selectivity, high sensitivity, and high biocompatibility of DA detection targets, thereby improving the overall performance of the electrode.
[0046] like Figure 1As shown, this invention proposes a strategy of sequentially modifying a CFE with chitosan, M, and a specific aptamer, successfully developing a highly biosafety electrode (DNA-cho-M-CS-CFE) composed of multiple biomaterials. We constructed potassium-induced PC12 cells and LPS-induced adult rats as Parkinson's disease models. The DNA-cho-M-CS-CFE was implanted into cell populations or brain slices. Results showed that both K+ stimulation and LPS inhibition of DA release produced significant DA signals, indicating that this composite modification strategy has detection stability. The performance of the DNA-cho-M-CS-CFE in nerve cells and brain slices demonstrates its feasibility for long-term, stable, in-situ electrochemical monitoring and sensitive response in various biological environments. It provides a new sensing method for revealing the roles and interactions of biomolecules in brain neural processes. Furthermore, it provides a new, stable, and sensitive analytical method for neurotransmitter dynamics and neuropathology, contributing to the Human Brain Project.
[0047] Example 2: Electrode Preparation
[0048] Reagent and solution instructions:
[0049] Chitosan, Tris, EDTA, a microprotease inhibitor tablet without EDTA, a cell membrane red fluorescent probe (DiI), and trypsin were purchased from BBI Life since (Shanghai). The cholesterol amphiphilic aptamer (DNA-cho,5'-ggacgacgccagtttgaaggttcgttcgcaggtgggagtgacgtcgtccttttttt-teg-cho-3') was synthesized from BBI Life since (Shanghai, China). Dopamine hydrochloride (DA) was purchased from Mackin (Shanghai, China). Ascorbic acid (AA), dihydroxyphenylacetic acid (DOPAC), norepinephrine (NE), uric acid (UA), and bovine serum albumin (BSA) were obtained from Sigma-Aldrich (St. Louis, MO, USA). All other chemicals were for analytical purposes. Artificial cerebrospinal fluid (aCSF) was prepared by mixing NaCl (126 mM), KCl (2.4 mM), KH₂PO₄ (0.50 mM), MgCl₂ (0.85 mM), NaHCO₃ (27.5 mM), Na₂SO₄ (0.50 mM), and CaCl₂ (1.10 mM) in milliq water and adjusting the pH to 7.4. Alternatively, phosphate-buffered saline (PBS) was prepared by mixing NaH₂PO₄ (0.1 M) and Na₂HPO₄ (0.1 M) and adjusting the pH to 7.4.
[0050] Preparation of brain cell membranes:
[0051] In short, the brain was dissected with a scalpel and washed with 2 mM EDTA in phosphate-buffered saline (PBS, pH 7.4). Subsequently, 500 μL of trypsin was injected into the brain to dissolve it into fragments, and digestion was carried out for 10 minutes. To stop digestion, 2 mM EDTA was used in PBS. The cell suspension was stirred, filtered, and collected. The cell suspension was centrifuged three times at 500 × g, and the particles were collected and then resuspended in hypotonic rehydration buffer (pH 7.5), with each 10 mL solution containing 20 mM Tris-HCl, 10 mM KCl, 2 mM MgCl2, and one EDTA-free miniature protease inhibitor tablet. To prepare vesicle solutions, the cell suspension was centrifuged at 10000 × g and stored at 4°C for later use.
[0052] Electrode manufacturing:
[0053] In simple terms, a glass capillary (1.5 mm in diameter, 1.0 cm in length) is drawn into two fine capillaries using a microelectrode drawing tool (RWD MP-500 micro-motor drawing machine, Shenzhen, China) to serve as a sheath for the CFEs. A 7 μm diameter carbon fiber (Shenzhen Dongli Electronics Co., Ltd., Shenzhen, China) is attached to a copper wire coated with silver conductive paste. The copper wire is then carefully inserted into the capillary. Both ends of the carbon fiber microelectrode are sealed with molten paraffin and cured at room temperature in air. The length of the fiber extending from the glass is fixed with a scalpel at approximately 0.5 mm from the glass seal.
[0054] In short, CS was dissolved in 0.1M HCl solution before use. Then, CFE was immersed in the chitosan solution, and a negative potential was applied to its electrodes relative to the counter electrode in the solution. To establish a tight connection between the chitosan thickness and the cell membrane, the deposition conditions were optimized. Therefore, to obtain the best anti-AA interference effect, we tried a voltage of -0.5V, applied for 0, 50, 200, 300, 400, and 500 seconds. Finally, 400 seconds was selected as the chitosan electrodeposition time.
[0055] Brain cell membranes (BCMs) were coated using an immersion method. Before immersion, the vesicle solution was homogenized by sonication for 15 min. Incubation times of 0, 0.5, 1.0, 2.0, and 3.0 h were evaluated at 50 °C to obtain the optimal incubation time. We selected 1 h as the modification time for the cell membrane. The coated CS-CFEs were dried at 35 °C for 0, 3, 24, and 36 h to find the optimal drying time. We ultimately allowed the electrodes to dry completely overnight. We named the cell membrane-coated CS-CFEs M-CS-CFEs. Then, based on the affinity of cholesterol for the cell membrane, this aptamer was added to the M-CS-CFEs. The aptamer with the cholesterol group modified at the 3' end was dissolved in 5 mM Mg2+ solution. Then, the M-CS-CFEs were immersed in 1 μM aptamer solution for 12 h. The electrodes were then rinsed with milliq water and stored in phosphate buffer. DNA-cho-M-CS-CFEs were successfully prepared.
[0056] Example 3: Electrode Optimization
[0057] The brain contains various small molecules that interfere with the detection of dopamine (DA), with ascorbic acid (AA) being the main interfering agent. Therefore, 200 μM AA and 10 μM DA were sequentially added to the system, and the electrodes were optimized using amperometric analysis (per n = 3). The ratio of reaction intensities represents the degree of interference of AA on DA under different optimization conditions.
[0058] The proportion of CFE at different CS deposition times and after 1 hour of soaking in cell membrane ligation is as follows: Figure 2 As shown in Figure A. Compared to the control group, the DA ratio in the CS group increased, but the deposition time showed no significant difference. Then, different M incubation times exhibited different effects, such as... Figure 2 As shown in Figure B, unincubated CS exhibited a higher AA response. This is presumably because the positive charge of the CS membrane attracts negatively charged AA. The superior resistance to AA interference by the cell membrane can be explained as follows: a) the cell membrane has a negative charge, manifested as electrostatic repulsion of AA and electrostatic adsorption of DA; b) water-soluble vitamin AA has difficulty penetrating the cell membrane, while DA easily permeates. Preliminary experiments demonstrate that the drying time of M significantly affects the results. The results are shown in... Figure 2 In the C-mode, as time progressed, the electrode dried completely, resulting in more uniform coverage and higher performance. After CS and M optimizations, aptamers were modified on the electrode surface for subsequent experiments.
[0059] Example 4: Surface Features
[0060] Scanning electron microscopy (SEM) images of Bare-CFE, CS-CFE, and M-CS-CFE were obtained using a SEM SU8010 (Hitachi, Tokyo, Japan). The carbon cloth was modified in the same manner as our treatment of CFE. The water contact angle of bare and modified carbon cloth was measured using a ThetaFlex static water contact angle analyzer (Biolin, Gothenburg, Sweden). Zeta potential was then measured on the carbon cloth using a zeta potential analyzer (Brookhaven Instruments, USA). Simultaneously, BCM was labeled with a DiI lipophilic film dye. CFE was then labeled with hexlorofluorescein (HEX) and cholesterol-modified aptamers. Specific fluorescence was observed using a fluorescence microscope (Nikon, Japan). Results are as follows: Figure 3 and Figure 4 As shown.
[0061] SEM images of naked CFE, CS-CFE, M-CS-CFE and DNA-cho-M-CS-CFE are shown below. Figure 4 As shown. In Figure 4 A smooth surface and some lines are clearly visible in A. An inconspicuous thin film covering the CS-CFE is shown. Figure 4 In section B, on the CFE, some hill-shaped sediments are deposited, and the striations become shallower. Numerous CS-CFE intersection surfaces are shown... Figure 4 As shown in Figure F, the CS membrane can be observed more clearly in the gap between the two CFs, uniformly covering the CFs. However, the intersection of the bare-CFE is not covered, as shown in Figure F. Figure 4 As shown in E. The hill-like sediments disappeared after being modified by brain cell membranes. Figure 4 (C). The sample was then cut and cross-sectional images were taken to see the composite membrane more clearly. The cross-section of the M-CS-CF electrode showed a cicada-like membrane completely encapsulating the CF. SEM images of DNA-cho-M-CS-CFE were shown. Figure 4 In D and H. After modification with aptamers, the electrode surface becomes rougher, indicating aptamer adhesion.
[0062] DiI and HEX labeled the cell membrane and aptamers, respectively. DiI is a special fluorescent dye used for labeling cell membranes; when excited at a wavelength of 549 nm, it exhibits only weak fluorescence after penetrating the cell membrane, while HEX exhibits strong fluorescence. Figure 4 As can be seen from the I, naked CFs soaked in DiI for 20 min showed almost no fluorescence. Furthermore, CS-CFE was not modified through the cell membrane, therefore its fluorescence was negligible. Figure 4 (J). On the other hand, DiI-labeled M-CS-CFE showed stronger and more obvious fluorescence, such as Figure 4As shown in K. The strong fluorescence of M-CS-CFE indicates successful cell membrane modification. HEX-labeled 5-terminus DNA-cho produces pink fluorescence at 539 nm. The cluster M-CS-CFE labeled with HEX-DNA-cho exhibits... Figure 4 The strong fluorescence shown by L indicates that the modification with this specific aptamer was successful. Furthermore, zeta potential analysis also confirms successful film modification during CS film deposition, as... Figure 3 As shown. The zeta potential of the thin film (n=3) was measured using a zeta potential analyzer. The CS film carries a positive charge of (6.27±2.44) mV. The M film carries a negative charge of (-3.60±0.76) mV, with no significant change before and after aptamer modification. Therefore, the wetting and detection of DA are feasible.
[0063] Example 5: Electrochemical Performance
[0064] Electrochemical experiments were conducted on a CHI630E electrochemical workstation (Shanghai Chenhua Instruments Co., Ltd.) with a coupled three-electrode system. Bare or modified CFEs and glassy carbon electrodes (GCE) were used as working electrodes, an Ag / AgCl electrode as the reference electrode, and a platinum wire electrode as the auxiliary electrode. Potential optimization was performed using the amperometric method. Therefore, amperometric detection was performed in stirred aCSF at a potential set to 0.16 V. Electrochemical impedance spectroscopy (EIS) measurements were performed in a 5.0 mM [Fe(CN)6]3- / 4- solution containing 0.1 M KCl. All electrochemical measurements were performed at room temperature.
[0065] The fabrication process of the sensor was characterized using electrochemical impedance spectroscopy (EIS) in [Fe(CN)6]3- / 4 solution. A typical Nyquist plot consists of a high-frequency semicircle and a low-frequency radial line, representing the confined charge transfer process and the diffusion process at the interface on the CFE, respectively. An increase in the semicircle diameter is associated with an increase in the charge transfer resistance (Rct). Figure 5 The Nyquist plots of different modified electrodes are shown. For example... Figure 5 As shown in Figure A, data were analyzed using the Randles equivalent circuit model, including Warburg impedance (W), charge transfer resistance (Rct), double-layer capacitance (CDL), and electrolyte ohmic resistance (Rs). Rs are 0.0021 Ω, 0.0008 Ω, and 0.005 Ω for bare-CFE, CS-CFE, and M-CS-CFE, respectively. The Rct values for bare-CFE, CS-CFE, and M-CS-CFE are 2072 Ω, 2227 Ω, and 3971 Ω, respectively. Figure 5As shown in Figure B, the semicircular portion, Rct, reflects the restricted diffusion of the redox probe in the multilayer system. The bare CFE exhibits a very small semicircular diameter, indicating a diffusion-limited step in the electrochemical process. However, after CS (red) deposition and gradual incubation within the cell membrane (blue), the semicircular diameter gradually increases, indicating increased impedance, likely due to the weakening of conductivity by the biomembrane. Furthermore, no significant changes were observed after the addition of the aptamer. These results demonstrate that successful immobilization was achieved at each step of the modification.
[0066] CV studies investigated the electrocatalytic response of DNA-cho-M-CS-CFE to DA concentration, such as... Figure 6 As shown in Figure A, the dopamine oxidation peak current increases with increasing dopamine concentration. To obtain better catalytic performance, the effect of voltage on catalytic performance was investigated. Current-time (it) response curves of DNA-cho-M-CS-CFE were recorded as the operating potential increased from 0.08 V to 0.18 V. Figure 6 As can be seen from B, the current response gradually increases, reaching its maximum value at 0.16V. Figure 6 The C values provide typical CVs for the redox reactions of AA on bare and M-CS-modified glassy carbon electrodes (GCE). Compared to bare GCE, the oxidation electron transfer of AA is significantly delayed on M-CS-modified GCE, which is helpful in distinguishing AA from DA. Subsequently, various physiologically relevant substances, including AA, NE, UA, and DOPAC, were sequentially added to aCSF (pH = 7.40). Figure 6 The results showed that DNA-cho-M-CS-CFE had significant selectivity for interfering substances, providing a guarantee for DA detection. Figure 6 (D). Under optimal conditions, the sensitivity of DNA-cho-M-CS-CFE using the potentiostatic amperometric current-time method was assessed in the low concentration range. Figure 6 E, F, and G in the figure show typical amperometric curves of DNA-cho-M-CS-CFE at 0.16 V with the addition of DA to aCSF at pH 7.40. This sensor exhibits good rapid response with a linear range of 5 nM to 18.7 μM (y = 0.2404x + 0.0076, R² = 0.999). The limit of detection (LOD) of DNA-cho-M-CS-CFE is the signal-to-noise ratio (S / N = 3) obtained from the peak current of 5 nM dopamine, encompassing normal dopamine levels in the striatum, ranging from 2.5 to 15 nM.
[0067] Table 1 summarizes the electroanalytical performance of the DNA-cho-M-CS-CFE and other electrodes. The DNA-cho-M-CS-CFE exhibits superior linear range and LOD. Its excellent analytical performance is likely attributed to the CFs and aptamers. The CFs achieve high selectivity and spatiotemporal resolution. Furthermore, due to the presence of the aptamers, we plotted the distance between the analyte and the electrode surface, revealing the potential of the DNA-cho-M-CS-CFE in DA sensing analysis applications.
[0068] Table 1. Comparison of electroanalytical performance of different modified electrodes for determining dopamine.
[0069]
[0070] Example 6: Stability and Fouling Resistance
[0071] Cyclic voltammetry was performed to determine the response of DNA-Cho-M-CS-CFEs to 10 μM DA before impact. A glass slide was fixed on an inverted microscope, and the electrodes were attached to an MM-500 triaxial motorized micromanipulator (RWDLifeScience Co., Shenzhen, China). The electrodes were then aligned with the edge of the slide and brought into the field of view, impacting the glass edge at a 45-degree angle. The electrodes were then removed, and the cyclic voltammetry was measured. This process was repeated three times, and the mean and standard deviation of the current at 0.16 V were calculated.
[0072] The water contact angle between the DNA-cho-M-CS-CFE electrode and the bare electrode was measured. For example... Figure 7 As shown in A and B, DNA-cho-M-CS-CFE has a small water contact angle, exhibiting strong hydrophilicity and strong resistance to nonspecific protein binding.
[0073] The stability of DNA-cho-M-CS-CFE electro-oxidation of DA was further evaluated using it. The current response was monitored for 1 h before and after the addition of 10 μM DA. As expected, the addition of DNA-cho-M-CS-CFE showed good stability, with a slight signal attenuation (0.38%). Figure 7 (C). To further investigate the antifouling properties of DNA-cho-M-CS-CFE, 10 mg mL-1 BSA was added to aCSF to simulate surface biofouling of microelectrodes in the rat brain. Figure 7 As shown in Figure D, the rapid current response induced by bsa was reduced by approximately 60% under naked CFE recording. In contrast, the current response of DNA-cho-M-CS-CFE decreased by only 3%. This result reveals an extraordinary ability to resist protein adsorption, directly confirming our previous hypothesis that this may be due to the hydrophobic interaction between the cell membrane and the nonpolar regions of proteins.
[0074] To investigate the performance of DNA-cho-M-CS-CFE in biofluids, the amperometric response of DNA-cho-M-CS-CFE before and after immersion in DMEM medium for 1 hour was compared. Figure 7 As can be seen from Figure E, the current response of DNA-cho-M-CS-CFE remained essentially unchanged after being immersed in DMEM. Similarly, the isolated DA current response was recorded 2 hours after the sensor was implanted into rat brain tissue. Figure 7 As shown in Figure F, the current response of DNA-cho-M-CS-CFE to DA changed slightly after implantation into brain tissue (red) compared to before implantation (black). In conclusion, DNA-cho-M-CS-CFE exhibits good monitoring stability and antifouling properties, meeting the requirements for long-term in vivo monitoring.
[0075] To assess the effect of significant mechanical force on the electrochemical response of electrode deformation, the electrode was struck three times at its edge, causing it to bend at approximately 45°. Changes in CV images and current at 0.16 V (relative to Ag / AgCl) were observed. Figure 8 As can be seen from I and J, after three collisions, the cyclic voltammogram of the electrode did not change significantly, with the current value decreasing by only 6.7%, demonstrating that the DNA-cho-M-CS-CFE has good mechanical stability. Therefore, the force during implantation will not significantly affect the electrode's performance.
[0076] Example 7: DA Measurement in aCSF and DMEM
[0077] To verify its feasibility in practical applications, recovery tests were conducted in aCSF (A) and DMEM (B) using the standard addition method, as shown in Table 2. The recovery rate in aCSF at 4.6 μM was 92.0% (n=3), and the recovery rate in the culture medium at 5.0 μM was 100.0% (n=3), demonstrating the great potential of this novel electrode for accurate detection of DA in complex environments.
[0078] Table 2. DA detection in CSF and DMEM (n=3).
[0079]
[0080] Example 8: Biocompatibility of Materials
[0081] L929 and Hela-RFP cells were cultured in DMEM medium containing 1% penicillin-streptomycin (P / S) and 10% fetal bovine serum (FBS) at 37°C and 5% CO2. Cytotoxicity of the sensor surface was detected using the CCK-8 assay. The same synthesis procedure as for carbon fibers was performed on the carbon cloth. Modified carbon cloth and bare carbon cloth were trimmed to 0.3*0.3 cm and placed in 96-cell plates for seeding L929 cells. Simultaneously, Hela-RFP cells were seeded on the modified bare carbon cloth and cultured for 6 h for further biocompatibility studies. Fluorescence imaging was used to record the proliferation of Hela-RFP cells.
[0082] The biocompatibility of DNA-cho-M-CS-CFE was further investigated using a cytotoxicity assay (n=3). The CCK-8 assay results for L929 are as follows: Figure 8 As shown in Figure A, there was no significant difference between the control group, bare carbon cloth, and DNA-cho-M-CS modified carbon cloth, indicating that the sensor we obtained was not cytotoxic. Similarly, Hela-RFP cells were cultured on bare carbon cloth (B) and modified carbon cloth (C) for 6 h, respectively, and observed under a fluorescence microscope. See Figure A for details. Figure 8 B cells grew successfully on both bare carbon cloth and modified carbon cloth, exhibiting good growth. Overall, the results of this study demonstrate that the electrode possesses high biocompatibility and shows potential for long-term dopamine sensing in living brain tissue.
[0083] Example 9: Detection of Dopamine (DA) in rat brain slices
[0084] All animal experiments were approved by the Ethics Committee of Chongqing Medical University. Male SD rats (6–8 weeks old) were housed in a feeding room and randomly fed food and water. Rats were anesthetized with isoflurane (4% induction, 2% maintenance) using an R520 gas pump (RWD Life Sciences Co., Ltd., Shenzhen, China), and were immediately euthanized after scalp incision. Brain tissue was removed within 1 minute and immediately placed in frozen sectioning solution (0–4°C) containing (mM, pH 7.0) NaCl (11g), KCl (2.5g), NaH2PO4 (1.2g), NaHCO3 (2g), glucose (10g), and MgCl2 (7g). The brain tissue was sectioned into coronal slices containing the caudate nucleus using a KD-400 vibratory microtome (Zhejiang Jinhua Kedi Instrument Equipment Co., Ltd.). All surgeries were performed in the frozen sectioning solution. Brain slices were placed in an incubation solution at 34°C (mM, pH 7.4): NaCl (11g), KCl (2.5g), NaH₂PO₄ (1.2g), NaHCO₃ (2g), glucose (10g), MgCl₂ (2g), and CaCl₂ (2g). DA release was induced by 5 μL of 40 mM KCl solution, and the reaction was monitored using a three-electrode system. All solutions were pre-saturated with 95% oxygen to ensure sufficient oxygen content.
[0085] Due to the good stability, sensitivity, stain resistance, and high biocompatibility of DNA-cho-M-CS-CFE, we further applied it to live rat brain slices (n=3). Electrodes were inserted into the substantia nigra striatum (SNc) to monitor the current response, such as... Figure 10 As shown in Figure A, during potassium-induced dopamine exocytosis, typical current responses were recorded in SNc (red) DAergic neurons at 0.16 V. The current response was monitored using a DNA-cho-M-CS-CFE, with an incubation buffer free of brain tissue as a blank control to exclude high K+ (black) current signals. Upon addition of 0.04 M KCl, the current response steadily increased, originating from DA oxidation. K+ stimulation induces cell membrane depolarization, leading to Ca2+ influx and subsequent depolarization of DAergic neurons. This is the action potential of the DAergic neuron. This then triggers the release of DA pre-stored in vesicles. The steady increase in synaptic cleft DA oxidation was detected and quantified by integrating the current on the DNA-cho-M-CS-CFE. DA release and uptake regulated by presynaptic autoreceptors are key mechanisms determining extracellular neurotransmitter levels in the brain. When dopamine uptake exceeds release, the signal gradually weakens until baseline.
[0086] Surprisingly, DNA-cho-M-CS-CFE exhibited significant sensing stability in brain slices. Long-term sensing of DA was performed three consecutive times on brain slices stimulated with high K+. Figure 10 Figure B shows three similar current responses, indicating higher-level stability perception in live rat brain tissue. The reasons are as described above. The rate of increase gradually decreases over time, but the difference in response intensity is not statistically significant. This is likely due to brain tissue inactivation. Compared to DNA-cho-M-CS-CFE, even with the addition of 50 nM DA, no stability response could be detected in naked CFE. Figure 9 The results support the potential of this highly biocompatible sensor to provide long-term stable sensing of intra-tissue DA.
[0087] Activation of the inflammatory response is known to play a crucial role in Parkinson's disease, but its mechanisms remain unclear. However, damage to dopaminergic neurons in the SNc and decreased dopamine levels in vivo are the origin of clinical symptoms. We used LPS, a Gram-negative bacterial inflammatory component, as a PD model induction method. Increased LPS in brain tissue leads to microglia, persistent microglial hyperactivation, and neuroinflammatory dysregulation, resulting in dopaminergic neuronal death, manifested as decreased brain tissue activity and disordered dopamine levels. Therefore, we treated rat brain slices with LPS. LPS-treated rat brain slices were immersed in 2 μg / L LPS for 1 h, followed by stimulation with the same amount of KCl, but only produced a very weak electrical response. After treatment, the increase phase was significantly prolonged, with an increase of approximately 113.24% (n=8) at a standard deviation of 0.66, while the response intensity decreased, with a reduction of approximately 34.22% (n=8) at a standard deviation of 0.22. In conclusion, DNA-cho-M-CS-CFE is used to monitor dopamine release in an LPS-induced rat brain slice model with high spatial and temporal resolution. This method successfully achieved long-term dopamine sensing while avoiding cell damage, representing a major breakthrough in the study of inflammatory mechanisms. Its application to LPS-treated brain slices demonstrates the potential of this novel strategy for long-term dopamine sensing to explore inflammatory mechanisms in neurophysiology and pathology.
[0088] Example 10: Detection of DA in nerve cell populations
[0089] Cells were seeded on 35*10 mm culture plates for 24 hours, then the original culture medium was discarded and replaced with 2 mL of fresh culture medium. The three-electrode system was then immersed in the solution. After the signal stabilized, the fresh culture medium was replaced with 2 mL of culture medium containing 0.4 M K+, and the control group was replaced with blank culture medium.
[0090] Based on the excellent detection performance of DNA-Cho-M-CS-CFE on brain slices, we attempted to perform DA detection on a homogeneous population of PC12 neurons (n=3) to further explore the potential application value of this sensor. Figure 4D). The DNA-cho-M-CS-CFE electrode was used as the working electrode and immersed in a PC12 cell population to rapidly depolarize the cells using K+. For example... Figure 10 As shown in Figure D, the cell population with blank medium (black) showed no electrochemical signal response, while the cell population with medium containing 0.4 M K+ (red) showed a significant and rapid increase in electrochemical signal, which stabilized within approximately 10 seconds. After incubation with 2 μg / L LPS for 30 min, the current decreased by approximately 43.3%, with a standard deviation of 0.94. These results are similar to those observed in brain slices. This finding demonstrates the sensitive and stable electrochemical response of the DNA-cho-M-CS-CFE electrode in cell populations, thus realizing the potential for real-time detection of dopamine release from single-cell vesicles.
[0091] In summary, this invention provides a novel CFE for DA detection. It is modified with fully biocompatible materials such as chitosan, cell membranes, and aptamers. A chitosan film is uniformly deposited on the fiber via electrodeposition. Immersion on the CS-covered CFE effectively masks cell membranes isolated from brain cells, providing a thin and gentle membrane. The affinity between cholesterol and the cell membrane allows for the amphiphilic insertion of aptamers. Based on this design, the cell membrane is functionalized with aptamers. These biomaterials significantly improve the CFE's antifouling resistance and stability. Similarly, the biomimetic camouflage based on the cell membrane and aptamers enhances the CFE's biocompatibility, thereby avoiding immune responses. DA sensing in the aCSF using CV and it methods exhibits a wider linear range and a larger LOD. This electrode possesses good selectivity, stability, antifouling resistance, and regenerability, showing broad application prospects in in vivo detection. Furthermore, the DNA-cho-M-CS-CFE exhibits good stability and can perform DA detection in live rat brain tissue for more than 3 hours. Simultaneously, the novel sensor can be used to detect dopamine release from K+-treated neural cell populations in real time. Furthermore, detection of LPS-treated brain tissue and PC12 cells also demonstrated the electrode's sensitivity and stability. It is promising that this novel electrode modification strategy will provide a long-term, in vivo and single-cell sensing method for exploring the role of dopamine (DA) in neurochemicals and brain diseases.
[0092] The above description is intended to be illustrative and not restrictive. For example, the above examples (or one or more thereof) can be used in combination with each other. Other embodiments may be used by those skilled in the art upon reading the above description. Furthermore, in the above detailed description, various features may be grouped together to simplify this disclosure. This should not be construed as an intention that a disclosed feature, which is not claimed, is necessary for any claim. Rather, the subject matter of the invention may be less than all the features of a particular disclosed embodiment. Thus, the following claims are incorporated herein by reference as examples or embodiments, wherein each claim is independently considered as a separate embodiment, and these embodiments are contemplated as being possible in various combinations or arrangements. The scope of the invention should be determined by reference to the appended claims and the full scope of their equivalents.
Claims
1. An enhancement electrode for determining dopamine, characterized in that, The invention includes a carbon fiber electrode, on which chitosan, brain cell membrane and specific aptamers are sequentially modified. The specific aptamer is a cholesterol amphiphilic aptamer; the sequence of the cholesterol amphiphilic aptamer is: ggacgacgccagtttgaaggttcgttcgcaggtgggagtgacgtcgtccttttttt.
2. A method for preparing an enhanced electrode for determining dopamine as described in claim 1, characterized in that, The preparation method includes: Fabrication of carbon fiber electrodes; The carbon fiber electrode was immersed in a chitosan solution, and a negative potential relative to the counter electrode in the solution was applied to the electrode for a preset time to obtain a carbon fiber electrode modified with chitosan. Brain cell membranes were coated onto the chitosan-modified carbon fiber electrodes. A specific aptamer was added to a carbon fiber electrode coated with the brain cell membrane to obtain an enhanced electrode for measuring dopamine.
3. The preparation method according to claim 2, characterized in that, The preparation of the carbon fiber electrode includes: A glass capillary is pulled into two thin capillaries to serve as a sheath for the carbon fiber electrode. A carbon fiber is attached to a copper wire coated with silver conductive paste, and the copper wire is inserted into the sheath. The ends of the carbon fiber microstructures were sealed with molten paraffin and cured in air at room temperature. The length of the fiber extending from the glass is fixed at the glass seal.
4. The preparation method according to claim 2, characterized in that, The carbon fiber electrode was immersed in a chitosan solution, and a voltage of -0.5V was applied to the electrode within 300-500s to increase the anti-AA interference effect.
5. The preparation method according to claim 2, characterized in that, The carbon fiber electrode modified with chitosan is coated with a brain cell membrane, comprising: Before coating, the vesicle solution was homogenized by ultrasound, and any time between 0.5 and 3.0 h was selected as the modification time for the cell membrane. Finally, the carbon fiber electrode coated with the brain cell membrane was dried.
6. The preparation method according to claim 2, characterized in that, A specific aptamer is added to a carbon fiber electrode coated with the brain cell membrane to obtain an enhanced electrode for measuring dopamine, comprising: Based on the affinity of cholesterol for cell membranes, cholesterol amphiphilic aptamers are added to the carbon fiber electrodes coated with the brain cell membrane. An aptamer modified with cholesterol groups at its three ends was dissolved in Mg. 2+ in solution; Then immerse in the aptamer solution; The electrode was rinsed and stored in phosphate buffer to prepare an enhanced electrode for dopamine determination.
7. The preparation method according to claim 6, characterized in that, The aptamer modified with cholesterol groups at its three ends was dissolved in 5 mg / mL water. 2+ in solution.
8. A method of using the enhancement electrode for determining dopamine as described in claim 1, characterized in that, The method of use includes: inserting the enhancement electrode into the substantia nigra striatum (SNc) and adding an appropriate amount of potassium chloride, and determining the dopamine concentration or whether dopamine is present based on the current response detected by the enhancement electrode.
9. A method of using the enhancement electrode for determining dopamine as described in claim 1, characterized in that, The method of use includes: immersing the enhancement electrode in a PC12 cell population, using K+ to depolarize the cells, and determining the dopamine concentration or whether dopamine is present based on the current response detected by the enhancement electrode.
Citation Information
Patent Citations
Sensing electrode suitable for in-situ detection of living body as well as preparation method and application of sensing electrode
CN114371203A
Composite membrane modified carbon fiber electrode as well as preparation method and use method thereof
CN116794133A