A method for improving the quality of double-end sequencing, a chip and its application

By using a combination of three primers, P5, P7, and P5a, on the sequencing chip and adjusting the P5a ratio, the problem of low quality of 2-strand sequencing in double-end sequencing was solved, and the Q30 value and read length quality of double-end sequencing were improved.

CN116121352BActive Publication Date: 2025-09-19SHENZHEN SALUS BIOMED CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202310121392.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-03
Publication Date
2025-09-19
Estimated Expiration
2043-02-03

AI Technical Summary

Technical Problem

In existing double-end sequencing technologies, the quality of second-strand sequencing is generally lower than that of single-strand sequencing, and as the sequencing read length increases, the signal intensity decreases, resulting in a decline in sequencing quality. The difference is particularly significant when the read length is long.

Method used

Three primers, including P5, P7, and P5a without enzyme cleavage sites, were fixed on the sequencing chip. By adjusting the ratio of P5a, the starting sequencing signal intensities of Read1 and Read2 of double-end sequencing were balanced, and the sequencing process was optimized to improve Q30.

Benefits of technology

It effectively improves the Q30 value of double-end sequencing, especially the sequencing quality of read lengths of PE150 and above, balances the sequencing signal intensity of strand 1 and strand 2, and reduces the difference in sequencing quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116121352B_ABST
    Figure CN116121352B_ABST
Patent Text Reader

Abstract

The present invention relates to a double-end sequencing chip. Three primers, P5, P7, and P5a, are fixed on the chip. P5 and P7 each have one or more different restriction enzyme sites, ideoxyU and i8oxodG. P5a is a nucleotide sequence without a restriction enzyme site and having the same base composition as P5. When a sequencing kit containing the double-end sequencing chip is used for sequencing of PE150 or above, the starting sequencing signal intensities of Read1 and Read2 of the double-end sequencing can be effectively balanced, and the Q30 of the double-end sequencing can be improved, thereby obtaining a method for improving the quality of double-end sequencing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to high-throughput sequencing technology, and in particular to a method and a chip for improving the quality of double-end sequencing and applications thereof. Background Art

[0002] In recent years, high-throughput sequencing technology (Next Generation Sequencing, NGS), as an important technology for molecular diagnosis, has gradually entered people's daily lives. It plays an important role in personalized medicine, genetic diseases and clinical diagnosis. Compared with traditional nucleic acid detection methods, high-throughput sequencing technology has obvious advantages. It can identify the base sequences of millions of DNA at the same time, and has the characteristics of fast speed, low cost and high accuracy. Paired-end sequencing is an important sequencing method for high-throughput sequencing. It can increase the sequencing read length and sequencing data volume, and improve the accuracy of result comparison. It plays an important role in De-novo assembly and detection of chromosome structural variations. There are currently a variety of double-end sequencing processes and methods on the market. For example, one of Illumina's double-end sequencing methods is to fix two primers, P5 and P7, which can be complementary to the library adapter on the surface. The library is bridge-amplified on the chip through the two primers P5 and P7 to obtain DNA clusters, thereby playing a role in signal amplification. The two primers P5 and P7 carry two restriction enzyme cleavage sites, ideoxyU and i8oxodG, respectively. For example, when sequencing the first chain, the USER enzyme needs to be used to cleave all ideoxyU at the surface P5 end, leaving only the chain grown from P7. After hybridization with sequencing primer 1, SBS sequencing can be performed. After the first chain sequencing is completed, the first chain sequencing chain will be denatured and eluted with formamide, and then the 3' end of the surface P5 will be dephosphorylated (i.e., end repair) with phosphokinase. Then, P5 will be used as a primer for second chain generation. Then, FPG enzyme will be used to cleave the i8oxodG on the P7 chain, leaving only the chain grown from P5. After hybridization with sequencing primer 2, second chain sequencing can be performed (patents US7754429B2, US10457985B2). This method is often easily affected by many links in the second chain generation, resulting in a lower signal-to-noise ratio of the second chain than that of the first chain, which leads to the generally lower sequencing quality of the second chain than that of the first chain. For example, the BGISEQ platform of BGI uses the property of USER enzyme that can generate single nucleotide gaps at the uracil position to introduce some dUTP during the synthesis of strand 1. The USER enzyme cuts the strand 1 into fragments, effectively reducing the binding ability of strand 1 and the template strand. The strand 1 is then eluted and digested to reduce the impact of strand 1 on the sequencing quality of the second strand, effectively improving the quality and read length of DNB double-end sequencing data (patent CN108070642B). Generally, the sequencing quality of double-end sequencing will gradually decline as the sequencing read length increases, mainly affected by factors such as the accumulation of base lag reactions and the reduction of sequencing fluorescence signal intensity. In particular, the sequencing quality will decline significantly when the read length is long, such as PE150, PE200, PE250, or when the insert fragment is long. The difference in sequencing quality between strand 1 and strand 2 also differs significantly as the read length increases. Therefore, improving the quality of double-end sequencing is particularly important. Summary of the Invention

[0003] Based on this, the purpose of the present invention is to provide a method for improving the quality of double-end sequencing.

[0004] Including the following technical solutions.

[0005] The first aspect of the present invention is to provide a chip for double-end sequencing, on which three primers are fixed, namely P5, P7 and P5a, wherein P5 and P7 respectively have a different restriction enzyme cleavage site, one of ideoxyU and i8oxodG, and P5a is a nucleotide sequence with the same base composition as P5 but without a restriction enzyme cleavage site.

[0006] The second aspect of the present invention provides the use of the chip in double-end sequencing, and a double-end sequencing kit comprising the chip.

[0007] The third aspect of the present invention is to provide a method for improving the quality of double-end sequencing.

[0008] A method for improving the quality of paired-end sequencing, comprising the following steps:

[0009] Chip preparation: Prepare a certain ratio of three primers: P5, P5a, and P7. Each primer has a -DBCO group at the 5' end, which can react with the polymer with an azide group on the surface of the silanized glass chip. The primers are fixed to the glass chip and washed to obtain a sequencing chip.

[0010] Perform surface amplification and sequencing.

[0011] A fourth aspect of the present invention provides a method for double-end sequencing, comprising the following steps:

[0012] S1. Obtain the sequencing chip as described above;

[0013] S2. Obtain the library to be amplified, dilute it, and denature it to prepare a 2 pM loading buffer;

[0014] S3. Load the sequencing chip and 2 pM library loading solution onto the sequencing system for amplification and double-end PE sequencing.

[0015] The present invention incorporates a certain appropriate proportion of P5a when preparing a sequencing chip while conventional primers P5 and P7 are fixed. When using this chip for double-end sequencing, it is found that the starting sequencing signal intensity of double-end sequencing Read1 and Read2 can be effectively balanced, and the Q30 (sequencing quality) of double-end sequencing with a read length of PE150 or above can be improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1a 、 Figure 1b Schematic diagram of PE sequencing when mixed with P5a.

[0017] Figure 2 Schematic diagram of the results of PE150 sequencing Q30 comparison in implementation case 1.

[0018] Figure 3 Schematic diagram of the results of PE200 sequencing Q30 comparison in implementation case 2.

[0019] Figure 4 Schematic diagram of the results of Q30 comparison of PE250 sequencing in implementation case 3.

[0020] Figure 5 Schematic diagram of the results of PE200 sequencing Q30 comparison in implementation case 4.

[0021] Figure 6 Schematic diagram of the results of PE200 sequencing Q30 comparison in implementation case 5. DETAILED DESCRIPTION

[0022] To facilitate understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the present disclosure more thorough and comprehensive.

[0023] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions, such as those in Molecular Cloning: A Laboratory Manual (4th edition, edited by Green and Sambrook, published in 2013), or according to manufacturer recommendations. All commonly used chemical reagents used in the examples were commercially available.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this invention pertains. The terms used in this specification are for the purpose of describing specific embodiments only and are not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0025] To facilitate understanding of this technology, certain terms and phrases are defined below.

[0026] Paired-end sequencing: Add adapters to both ends of the DNA fragment for the first sequencing, wash away the template chain, amplify the module at the original position, and perform the second round of sequencing.

[0027] PE: Pair End, double-end sequencing.

[0028] Read length: The length of the reads obtained by sequencing can reflect the length of the sequence that can be measured.

[0029] Q30: indicates the percentage of bases with a quality value of 30.

[0030] Some embodiments of the present invention relate to a double-end sequencing chip, on which three primers are fixed, namely P5, P7 and P5a. As usual, P5 and P7 have one different restriction enzyme cleavage site each of ideoxyU and i8oxodG, while P5a does not have a restriction enzyme cleavage site and has a nucleotide sequence with the same base composition as P5.

[0031] In some embodiments, the P5a accounts for 5%-25% of the total amount of P5 and P5a, preferably 10%-20%.

[0032] In some embodiments, the ratio of the total amount of P5 and P5a to the fixed amount of P7 is 0.9-2:0.9-2, preferably 0.9-1.1:0.9-1.1, and more preferably 1:1.

[0033] In some embodiments, the base sequence of P5 is shown as SEQ ID NO.1; the base sequence of P7 is shown as SEQ ID NO.2.

[0034] The chip is used in double-end sequencing, which can effectively balance the starting sequencing signal intensity of double-end sequencing Read1 and Read2, and can improve the Q30 of double-end sequencing with a read length of PE150 or above.

[0035] In some of the embodiments, a double-end sequencing kit is also involved, including the above-mentioned double-end sequencing chip; according to conventional understanding, it also includes a linker sequence corresponding to the sequence of the P5 primer and / or P7 primer.

[0036] In some embodiments, the kit further includes components such as commonly used polymerases, denaturants, and various commonly used buffers.

[0037] In some embodiments of the present invention, a method for improving the quality of double-end sequencing is also provided, comprising the following steps:

[0038] Chip preparation: Prepare a certain ratio of three primers: P5, P5a, and P7. Each primer has a -DBCO group at the 5' end, which can react with the polymer with an azide group on the surface of the silanized glass chip. The primers are fixed to the glass chip and washed to obtain a sequencing chip.

[0039] According to routine procedures, the above sequencing chip was used to carry out the next step of surface amplification and sequencing.

[0040] The 5' ends of the above three primers all have a -DBCO group.

[0041] In some embodiments of the present invention, a method for double-end sequencing is also provided, comprising the following steps:

[0042] Prepare the above sequencing chip, that is, on the glass chip, in addition to the P5 and P7 primers, also immobilize an appropriate amount of P5a;

[0043] Obtain the library to be amplified, dilute, and denature to 2 pM loading solution;

[0044] The sequencing chip and 2 pM library sample solution were loaded onto the sequencing system. After setting the parameters, the system performed amplification and double-end PE sequencing in the following order: amplification - 1-strand template chain cleavage - 1-strand sequencing - 1-strand sequencing chain elution - surface P5 3' end dephosphorylation - 2-strand amplification - 2-strand template chain cleavage - 2-strand sequencing.

[0045] The PE read length in the parameters is 150-300, preferably 150-250, and can be 150, 200, 250, 300, etc.

[0046] The present invention is further described in detail below with reference to specific embodiments.

[0047] The sequencing chips in the following examples were prepared according to conventional methods, including the following steps: 1) cleaning the glass surface; 2) surface silanization; 3) chip packaging: packaging the silanized surface into a flow cell. Depending on the experimental needs, the flow cell may have 2, 3, 4, or more flow channels; 4) oligonucleotide primer immobilization: configuring a certain ratio of three oligonucleotide primers: P5, P5a, and P7. These three primers have a -DBCO group at the 5' end, which is used to react with a polymer with an azide group to immobilize the probe primer to the sequencing chip. After cleaning, the chip is ready for use.

[0048] The base compositions of P5 and P7 are as follows. When used, polyT is added to the 5' portion, and the polyT may be 6-10 Ts.

[0049] The base sequence of P5 is: 5'-AATGATACGGCGACCACCGAATCTACAC-3' (SEQ ID NO. 1)

[0050] The base sequence of P7 is: 5'-CAAGCAGAAGACGGCAACGAGAT-3' (SEQ ID NO. 2). The surface oligonucleotide probe sequences of P5, P5a, and P7 used in Examples 1-4 below are:

[0051] P5 sequence: 5'-TTTTTTTTAATGATACGGCGACCACCGA / i8oxodG / ATCTACAC-3'

[0052] P5a sequence: 5'-TTTTTTTTAATGATACGGCGACCACCGAGATCTACAC-3'

[0053] P7 sequence: 5'-TTTTTTTTCAAGCAGAAGACGGCA / ideoxyU / ACGAGAT-3'

[0054] The surface P5, P5a, and P7 oligonucleotide probe sequences used in Example 5 below are:

[0055] P5 sequence: 5'-TTTTTTTTAATGATACGGCGACCACCGAGATC / ideoxyU / ACAC-3'

[0056] P5a sequence: 5'-TTTTTTTTAATGATACGGCGACCACCGAGATCTACAC-3'

[0057] P7 sequence: 5'-TTTTTTTTCAAGCAGAAGACGGCATAC / i8oxodG / AGAT-3'.

[0058] The oligonucleotide primers are fixed: a certain ratio of three oligonucleotide primers P5, P5a, and P7 is configured. In the experiment, the concentrations of the three primers can be carried out in various ratios (such as 1:1:1, 2:1:1, 2:1:2, 3:1:3, etc.). The 5' ends of the three primers are stained with -DBCO.

[0059] The base composition of the linker sequence in the following examples is:

[0060] i5:AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T (SEQ ID NO.3);

[0061] i7:CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T((SEQ ID NO.4). * represents thiophospho modification.

[0062] Example 1

[0063] 1) On the surface of the aforementioned chip grafted with azide-group-containing polymer, a mixture of three oligonucleotide primers, P5, P5a, and P7, was prepared using a 3xSSC solution at two different ratios. The molar concentration ratios of P5:P5a:P7 primers were as follows: channels 1-3 served as experimental groups with P5a / (P5+P5a) mixed at 10%, 20%, and 40%, respectively; channel 4 served as a control group.

[0064] runner P5 concentration (uM) P5a concentration (uM) P7 concentration (uM) 1 4.5 0.5 5 2 4 1 5 3 3 2 5 4 5 0 5

[0065] 2) Add the prepared primers to the corresponding flow channel and heat in a 55°C oven for 4 hours;

[0066] 3) Wash each flow channel with 3xSSC solution to obtain sequencing chip A;

[0067] 4) The library to be amplified is Escherichia coli ATCC8739 with a length of 550 bp using TE buffer. The library can be prepared using a commercially available library preparation kit (e.g., Norvegian VAHTS Universal Pro DNA Library Prep Kit for Illumina, #ND608-01; VAHTS Multiplex Oligos Set 4 / 5 for Illumina,

[0068] The library was constructed using the adapter sequences in the library (#N321 / N322-01), which are compatible with next-generation sequencing platforms such as Illumina and BGI. The library was diluted to 2 nM and denatured with 0.1 M NaOH at room temperature for 3 minutes.

[0069] 5) After denaturation, prepare a 2 pM loading solution with 3xSSC buffer, and load the prepared sequencing chip a and the 2 pM library loading solution after denaturation and dilution onto the Salus Pro sequencing system;

[0070] 6) Setting parameters for PE150 amplification and sequencing;

[0071] 7) Combination Figure 1a, after the library is amplified into a double-stranded chain on the surface, in order to hybridize with sequencing primer 1 for read1 sequencing (1 chain), the P5 or P5a extended chain that is complementary to the P7 extended chain needs to be removed, leaving a separate P7 extended chain. There is a 1-chain sequencing primer hybridization site on the P7 extended chain. Since the P5a primer does not have an i8oxodG cleavage site, the P5a extended chain cannot be removed and is retained. In read1 sequencing, part of the P7 extended chain will hybridize with P5a to continue to form a double-stranded state and will not participate in sequencing. The read1 sequencing results of the flow channel with P5a show that the signal will be lower than the control (without P5a). The results in Table 2a show that compared with the control (flow channel 4), when P5a / (P5+P5a) is 10%, 20%, and 40%, respectively, that is, P7 remains unchanged and the content of mixed P5a increases, the 1-chain sequencing signal is lower than the control, and decreases as the ratio increases. Combination Figure 1b After strand 1 sequencing, the excised P5 is repaired and the repaired P5 is used as a primer to regenerate a P5 extension as strand 2. Since P5a cannot be excised, its extension directly serves as strand 2, eliminating the need for strand 2 regeneration. Before strand 2 sequencing, the P7 extension (the P7 primer contains the ideoxyU restriction site) is completely excised, leaving only the regenerated P5 extension and the non-excised P5a extension, which can then be hybridized with sequencing primer 2 for read2 sequencing. Therefore, the strand 2 sequencing signal in the flow channel containing P5a is higher than the control.

[0072] Comprehensive Table 1a, Table 1b and Figure 2 Results showed that when the P5a / (P5+P5a) ratio was 10% and 20%, the PE150 sequencing signal for strand 1 was slightly lower than the control, with no significant impact on Q30. However, the signal for strand 2 was slightly higher than the control, which helped improve Q30. However, when the P5a / (P5+P5a) ratio reached 40%, the low signal for strand 1 affected Q30. Comparing the sequencing Q30 of channels 1, 2, and 4 under PE150 read length, the low-level P5a content slightly outperformed the low-level P5a content. However, channel 3, due to the high P5a content, affected the sequencing signal for strand 1, thus affecting Q30.

[0073] Table 1a: Implementation Case 1 PE150 Sequencing Start Signal

[0074]

[0075] Table 1b: Implementation Case 1 PE150 Sequencing Q30

[0076]

[0077] Example 2

[0078] 1) On the surface of the polymer chip grafted with azide groups: using 3xssc solution to prepare a mixture of three oligonucleotide probes, P5, P5a, and P7, at two ratios, with a total concentration of 8uM for P5 and P5a, and an 8uM concentration for P7. The molar concentration ratios of P5:P5a:P7 primers were as follows: channels 1 to 3 were experimental groups with P5a / (P5+P5a) mixed at 10%, 15%, and 40%, respectively; channel 4 was a control group without P5a;

[0079] runner P5 concentration (uM) P5a concentration (uM) P7 concentration (uM) 1 7.2 0.8 8 2 6.8 1.2 8 3 4.8 3.2 8 4 8 0 8

[0080] 2) Add the prepared primers to the corresponding flow channel and heat in a 55°C oven for 4 hours;

[0081] 3) Wash each flow channel with 3xSSC solution to obtain sequencing chip B;

[0082] 4) Dilute the library to be amplified (the library is the same as in Example 1 above, Escherichia coli ATCC8739, 550 bp in length, and the adapters included in the library are compatible with second-generation sequencing platforms such as Illumina and BGI) to 2 nM in TE buffer and denature with alkali (0.1 M NaOH solution) at room temperature for 3 minutes;

[0083] 5) After denaturation, prepare a 2 pM loading solution with 3xSSC buffer, and load the prepared sequencing chip b and the denatured and diluted 2 pM library loading solution onto the Salus Pro sequencing system;

[0084] 6) Setting parameters for PE200 amplification and sequencing;

[0085] 7) Combination Figure 1a , after the library is amplified into a double-stranded chain on the surface, in order to hybridize with sequencing primer 1 for read1 sequencing (1 chain), the P5 or P5a extended chain that is complementary to the P7 extended chain needs to be removed, leaving a separate P7 extended chain. There is a 1-chain sequencing primer hybridization site on the P7 extended chain. Since the P5a primer does not have an i8oxodG cleavage site, the P5a extended chain cannot be removed and is retained. In read1 sequencing, part of the P7 extended chain will hybridize with P5a to continue to form a double-stranded state and will not participate in sequencing. The read1 sequencing results of the flow channel with P5a show that the signal will be lower than the control (without P5a). The results in Table 2a show that compared with the control (flow channel 4), when P5a / (P5+P5a) is 10%, 15%, and 40%, respectively, that is, P7 remains unchanged and the content of mixed P5a increases, the 1-chain sequencing signal is lower than the control, and decreases as the ratio increases. Combination Figure 1bAfter 1-strand sequencing, the excised P5 is repaired and the repaired P5 is used as a primer to regenerate the P5 extended chain as the 2nd strand. Since P5a cannot be excised, its extended chain directly serves as the 2nd strand, eliminating the need for the 2nd strand regeneration process. Before 2nd strand sequencing, the P7 extended chain (P7 primer contains the enzyme cleavage site ideoxyU) is completely excised, leaving only the regenerated P5 extended chain and the non-excised P5a extended chain, which can then be hybridized with sequencing primer 2 for read2 sequencing. Therefore, the 2nd strand sequencing signal of the flow channel containing P5a is higher than that of the control. Comprehensive Table 2a, Table 2b and Figure 3 The results showed that when the total concentration of P5 and P5a was increased to 8uM and the concentration of P7 was increased to 8uM, the P5a / (P5+P5a) ratio was at 10% and 15%, and the PE200 sequencing signal of strand 1 was slightly lower than that of the control, with no significant effect on the Q30 of strand 1. The signal of strand 2 was slightly higher than that of the control, which was beneficial to improving the Q30 of strand 2. When the P5a / (P5+P5a) ratio reached 40%, the Q30 of strand 1 was affected by the low signal of strand 1. Comparing the sequencing Q30 of channels 1, 2, and 4 under PE200 read length, the low-content P5a was better than the control without P5a. However, the high content of P5a in channel 3 affected the sequencing signal of strand 1 and thus the sequencing Q30. Controlling the P5a content at a certain ratio had a significant effect on promoting the PE200 read length.

[0086] Table 2a: Implementation Case 2 PE200 Sequencing Start Signal

[0087]

[0088]

[0089] Table 2b: Implementation Case 2 PE200 Sequencing Q30

[0090]

[0091] Example 3

[0092] 1) On the surface of the polymer chip grafted with azide groups: using 3xSSC solution, prepare a mixture of three oligonucleotide probes, P5, P5a, and P7, at two ratios. The molar concentration ratios of P5:P5a:P7 primers are as follows: channels 1 to 3 are experimental groups with P5a / (P5+P5a) mixed at 10%, 20%, and 30%, respectively; channel 4 is a control group;

[0093] runner P5 concentration (uM) P5a concentration (uM) P7 concentration (uM) 1 4.5 0.5 5 2 4 1 5 3 3.5 1.5 5 4 5 0 5

[0094] 2) Add the prepared primers to the corresponding flow channel and heat in a 55°C oven for 4 hours;

[0095] 3) Wash each flow channel with 3xSSC solution to obtain sequencing chip C;

[0096] 4) Dilute the library to be amplified (the library is the same as in Example 1 above, Escherichia coli ATCC8739, 550 bp in length, and the corresponding adapters contained in the library are compatible with second-generation sequencing platforms such as Illumina and BGI) to 2 nM in TE buffer and denature with alkaline solution at room temperature for 3 minutes (the base used is 0.1 M NaOH solution);

[0097] 5) After denaturation, use 3xSSC buffer to prepare a 2 pM loading solution, and load the prepared sequencing chip c and the 2 pM library loading solution after denaturation and dilution onto the Salus Pro sequencing system;

[0098] 6) Setting parameters for PE250 amplification and sequencing;

[0099] 8) Combine Figure 1a , after the library is amplified into a double-stranded chain on the surface, in order to hybridize with sequencing primer 1 for read1 sequencing (1 chain), the P5 or P5a extended chain that is complementary to the P7 extended chain needs to be removed, leaving a separate P7 extended chain, and there is a 1-chain sequencing primer hybridization site on the P7 extended chain. Since the P5a primer does not have an i8oxodG cleavage site, the P5a extended chain cannot be removed and is retained. In read1 sequencing, part of the P7 extended chain will hybridize with P5a to continue to form a double-stranded state and will not participate in sequencing. The read1 sequencing results of the flow channel with P5a show that the signal will be lower than the control (without P5a). The results in Table 3a show that compared with the control (flow channel 4), when P5a / (P5+P5a) is 10%, 20%, and 30%, respectively, that is, P7 remains unchanged and the content of mixed P5a increases, the 1-chain sequencing signal is lower than the control, and decreases as the ratio increases. Combination Figure 1b After the 1st strand sequencing, the excised P5 is repaired and the repaired P5 is used as a primer to regenerate the P5 extended chain as the 2nd strand. Since P5a cannot be excised, its extended chain directly serves as the 2nd strand, eliminating the need for the 2nd strand regeneration step. Before the 2nd strand sequencing, the P7 extended chain (P7 primer contains the enzyme cleavage site ideoxyU) is completely excised, leaving only the regenerated P5 extended chain and the non-excised P5a extended chain, which can then be hybridized with sequencing primer 2 for read2 sequencing. Therefore, the 2nd strand sequencing signal of the flow channel containing P5a is higher than that of the control. Comprehensive Table 3a, Table 3b and Figure 4The results showed that when the P5a / (P5+P5a) ratio was 10% and 20%, the PE250 sequencing signal for strand 1 was slightly lower than the control, with no significant impact on the Q30 of strand 1. However, the signal for strand 2 was slightly higher than the control, which helped improve the Q30 of strand 2. However, when the P5a / (P5+P5a) ratio reached 30%, the low signal for strand 1 affected the Q30 of strand 1. Comparing the sequencing Q30 of channels 1, 2, and 4 under PE250 read length, the low-content P5a-mixed sequence significantly outperformed the control without P5a. However, the high P5a content in channel 3 affected the sequencing signal for strand 1, thus affecting the sequencing Q30. Controlling the P5a content at a certain ratio significantly improved the PE250 read length.

[0100] Table 3a: Example 3 PE250 sequencing start signal

[0101]

[0102] Table 3b: Implementation Case 3PE250 Sequencing Q30

[0103]

[0104] In summary, in Examples 1, 2, and 3, mixing a certain proportion (e.g., 20%) of P5a primers can modulate the sequencing signals for both strands 1 and 2, and balance the Q30 for both strands. The improvement is more pronounced compared to the control group as read length increases in PE150 to PE250 sequencing. However, the P5a ratio must be controlled; for example, a 30% content has no positive effect on PE sequencing.

[0105] Example 4

[0106] 1) On the surface of the polymer chip grafted with azide groups: using 3xssc solution to prepare two ratios of three oligonucleotide probe mixtures of P5, P5a, and P7, with a total concentration of P5 and P5a of 10 μM and a P7 concentration of 10 μM. The molar concentration ratios of P5:P5a:P7 primers were as follows: channels 1 and 3 were experimental groups with different total concentrations of P5 and P5a, with a P5a / (P5+P5a) ratio of 20%, and channels 2 and 4 were control groups with different total concentrations of P5 and P5a;

[0107] runner P5 concentration (uM) P5a concentration (uM) P7 concentration (uM) 1 4 1 5 2 5 0 5 3 8 2 10 4 10 0 10

[0108] 2) Add the prepared primers to the corresponding flow channel and heat in a 55°C oven for 4 hours;

[0109] 3) Wash each flow channel with 3xSSC solution to obtain sequencing chip D;

[0110] 4) Dilute the library to be amplified (the library is the same as in Example 1 above, Escherichia coli ATCC8739, 550 bp in length, and the adapters contained in the library are compatible with second-generation sequencing platforms such as Illumina and BGI) to 2 nM in TE buffer and denature with alkali (0.1 M NaOH solution) at room temperature for 3 minutes;

[0111] 5) After denaturation, prepare a 2 pM loading solution with 3xSSC buffer, and load the prepared sequencing chip d and the 2 pM library loading solution after denaturation and dilution onto the Salus Pro sequencing system;

[0112] 6) Setting parameters for PE200 amplification and sequencing;

[0113] 7) After the library is amplified into a double-stranded state on the surface, in order to hybridize with sequencing primer 1 for read1 sequencing (1 strand), the P5 or P5a extended chain complementary to the P7 extended chain needs to be removed, leaving a separate P7 extended chain. There is a 1-strand sequencing primer hybridization site on the P7 extended chain. Since the P5a primer does not have an i8oxodG cleavage site, the P5a extended chain cannot be removed and is retained. In read1 sequencing, part of the P7 extended chain will hybridize with P5a to continue to form a double-stranded state and will not participate in sequencing. The read1 sequencing results of the flow channel with P5a will show that the signal will be lower than the control (without P5a). The results in Table 4a and Table 4b show that the total concentration of surface primers P5 and P5a is 5uM, which corresponds to a lower signal than 10uM, and the P7 concentration is 5uM, which corresponds to a lower signal than 10uM. However, the experimental groups mixed with 20% P5a are better than the corresponding control groups without P5a (see Figure 5 At different total concentrations of P5 and P5a and different total concentrations of P7, mixing in an appropriate amount of P5a had a promoting effect on PE200 sequencing.

[0114] Table 4a: Implementation Case 4 PE200 Sequencing Start Signal

[0115]

[0116] Table 4b: Implementation Case 4 PE200 Sequencing Q30

[0117]

[0118] Example 5

[0119] 1) On the surface of the polymer chip grafted with azide groups, a mixture of three oligonucleotide probes, P5, P5a, and P7, was prepared using a 3xssc solution at two ratios. The primer sequences used were: P5 with an ideoxyU restriction site, and P7 with an i8oxodG restriction site. The molar concentration ratios of P5:P5a:P7 primers were as follows: channels 1 to 3 were experimental groups with P5a / (P5+P5a) mixed at 5%, 10%, and 20%, respectively; channel 4 served as a control group.

[0120] runner P5 concentration (uM) P5a concentration (uM) P7 concentration (uM) 1 9.5 0.5 10 2 9 1 10 3 8 2 10 4 10 0 10

[0121] 2) Add the prepared primers to the corresponding flow channel and heat in a 55°C oven for 4 hours;

[0122] 3) Wash each flow channel with 3xSSC solution to obtain sequencing chip E;

[0123] 4) Dilute the library to be amplified (the library is the same as in Example 1 above, Escherichia coli ATCC8739, 550 bp in length, and the adapters contained in the library are compatible with second-generation sequencing platforms such as Illumina and BGI) to 2 nM in TE buffer and denature with alkali (0.1 M NaOH solution) at room temperature for 3 minutes;

[0124] 5) After denaturation, prepare a 2 pM loading solution with 3xSSC buffer, and load the prepared sequencing chip e and the 2 pM library loading solution after denaturation and dilution onto the Salus Pro sequencing system;

[0125] 6) Setting parameters for PE200 amplification and sequencing;

[0126] 7) After the library is amplified into double strands on the surface, in order to hybridize with sequencing primer 1 for read 1 sequencing (strand 1), the P5 or P5a extension chain that is complementary to the P7 extension chain needs to be removed, leaving a single P7 extension chain with a hybridization site for the 1-strand sequencing primer on the P7 extension chain. The results in Table 5a show that compared with the control (channel 4), when P5a / (P5+P5a) is 5%, 10%, and 20% respectively, that is, when P7 remains unchanged and the content of mixed P5a increases, the 1-strand sequencing signal is lower than the control and decreases as the ratio increases. Figure 1b After strand 1 sequencing, the excised P5 is repaired and the repaired P5 is used as a primer to regenerate the P5 extended chain as strand 2. Since P5a cannot be excised, its extended chain directly serves as strand 2, eliminating the need for strand 2 regeneration. Before strand 2 sequencing, the P7 extended chain (P7 primer contains the enzyme cleavage site i8oxodG) is completely excised, leaving only the regenerated P5 extended chain and the unexcised P5a extended chain, which can then be hybridized with sequencing primer 2 for read2 sequencing. Therefore, the strand 2 sequencing signal of the flow channel containing P5a is higher than that of the control. Comprehensive Table 5a, Table 5b and Figure 6 The results showed that when the P5a / (P5+P5a) ratio was 5%, 10%, and 20%, the PE200 sequencing signal of the first chain was slightly lower than that of the control, which had no significant effect on the Q30 of the first chain. The signal of the second chain was slightly higher than that of the control, which was beneficial to improving the Q30 of the second chain. The P5a / (P5+P5a) ratio of 10% and 20% was slightly better than 5%.

[0127] Table 5a: Implementation Case 5 PE200 Sequencing Start Signal

[0128]

[0129]

[0130] Table 5b: Implementation Case 5 PE200 Sequencing Q30

[0131]

[0132] The above experimental results show that mixing an appropriate amount of P5a with P5 containing i8oxodG restriction site and P7 containing ideoxyU restriction site also has a positive effect and promotes sequencing at PE200 read length.

[0133] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. A method for improving the quality of double-end sequencing, characterized by: The following steps are involved: Chip preparation: A certain ratio of three primers, P5, P5a, and P7, is prepared. The 5' end of each primer has a -DBCO group that can react with the azide group polymer on the surface of the silanized glass chip. The P5 and P7 each have one and a different restriction site, ideoxyU and i8oxodG. The P5a has no restriction site and has the same nucleotide sequence as P5. The P5a accounts for 5%-20% of the total amount of P5 and P5a. The ratio of the total amount of P5 and P5a to the amount of P7 is 0.9-1.1:0.9-1.

1. Fixing the primers on a glass chip, and obtaining a sequencing chip after washing; The library to be amplified is diluted and denatured, and then introduced into a sequencing chip for hybridization with the surface primers. The complementary chain is extended and fixed on the surface of the sequencing chip. The original hybridized chain is denatured and eluted, and amplification and double-end sequencing are performed on the sequencing chip. The amplification and double-end sequencing include: library surface amplification, cleavage of the first strand template chain, sequencing of the first strand, elution of the first strand sequencing chain, dephosphorylation of the 3' end of P5, amplification of the second strand using the dephosphorylated P5 to obtain the P5 extension chain and the P5a extension chain, cleavage of the second strand template chain, and sequencing of the second strand.

2. The method for improving the quality of double-end sequencing according to claim 1, wherein: The P5a accounts for 10%-20% of the total amount of P5 and P5a.

3. A method for double-end sequencing, characterized in that: The following steps are involved: S1. Obtain a double-end sequencing chip, wherein three primers, P5, P7, and P5a, are immobilized on the chip. P5 and P7 each have a different restriction site, either ideoxyU or i8oxodG. P5a is a nucleotide sequence without a restriction site and identical in base composition to P5. The proportion of P5a to the total amount of P5 and P5a is 5%-20%. The ratio of the total amount of P5 and P5a to the amount of P7 is 0.9-1.1:0.9-1.

1. S2. Obtain the library to be amplified, dilute it, and denature it to 2 pM loading solution; S3. Load the sequencing chip and 2 pM library sample solution onto the sequencing system, set the parameters, and perform amplification and paired-end sequencing; The amplification and double-end sequencing include: library surface amplification, cleavage of the first strand template chain, sequencing of the first strand, elution of the first strand sequencing chain, dephosphorylation of the 3' end of P5, amplification of the second strand using the dephosphorylated P5 to obtain the P5 extension chain and the P5a extension chain, cleavage of the second strand template chain, and sequencing of the second strand.

4. The method for double-end sequencing according to claim 3, wherein: The P5a accounts for 10%-20% of the total amount of P5 and P5a.

5. The method for double-end sequencing according to claim 4, wherein: The base sequence of P5 is shown in SEQ ID NO.1; the base sequence of P7 is shown in SEQ ID NO.

2.

6. The method for double-end sequencing according to claim 3, wherein: The read length of the paired-end sequencing in step S3 is 150bp-300bp.

Citation Information

Patent Citations

  • Methods to improve the quality of DNB paired-end sequencing, and DNB paired-end sequencing methods and kits.

    CN108070642B

  • Method for sequencing a polynucleotide template

    CN101663405A

  • Solid-phase medium surface double-end amplification sequencing method

    CN114457146A

  • Solid-phase substrate as well as preparation method and application thereof

    CN114524623A