Method for enhancing the transcription level of glycoside hydrolase encoding gene APASM_6114 to increase the production of ansamitocin

By enhancing the transcription level of the extracellular glycoside hydrolase encoding gene APASM_6114 in the precious actinomycetes, the problem of insufficient production of asceticin in the prior art was solved, and the effect of significantly improving the fermentation yield of asceticin and carbon source utilization efficiency was achieved.

CN116144563BActive Publication Date: 2025-06-06SHANGHAI JIAOTONG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211301760.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-24
Publication Date
2025-06-06
Estimated Expiration
2042-10-24

AI Technical Summary

Technical Problem

The prior art is difficult to effectively increase the yield of ascetin. Although sucrose can be used as a carbon source by bacteria, its consumption efficiency and carbon source utilization still have room for improvement.

Method used

By enhancing the transcription level of the extracellular glycoside hydrolase encoding gene APASM_6114 in the precious actinomycetes, the consumption of sucrose and the utilization of carbon sources are promoted, thereby increasing the yield of ascetin.

Benefits of technology

The fermentation yield of ascetin was significantly improved. Compared with the control strain, the yield of ascetin increased by 36.9%, while improving the carbon source utilization efficiency of the bacteria.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116144563B_ABST
    Figure CN116144563B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for enhancing the transcription level of glycoside hydrolase encoding gene APASM_6114 to increase the yield of ansamitocin. Specifically, by using the strong promoter kasOp* in Actinomyces preciousis ATCC 31280 to enhance the expression of endogenous glycoside hydrolase encoding gene APASM_6114, the sucrose consumption of Actinomyces preciousis is promoted, the carbon source utilization rate is improved, and the yield of ansamitocin can be significantly increased. The final ansamitocin yield reached 63.7 mg / L at the laboratory shake flask fermentation level, which is 36.9% higher than the control strain. The present invention can significantly increase the fermentation yield of ansamitocin and reduce the fermentation cost at the same time.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and relates to a method for increasing the production of ansamitocin by enhancing the transcription level of an extracellular glycoside hydrolase encoding gene APASM_6114 for hydrolyzing sucrose; in particular, it relates to a method for increasing the sucrose consumption of bacterial cells by enhancing the transcription level of an extracellular glycoside hydrolase encoding gene for hydrolyzing sucrose, thereby improving the carbon source utilization rate and ultimately improving the fermentation level of ansamitocin. Background Art

[0002] Ansamitocin is a macrolide antibiotic produced by Actinosynnema pretiosum. It can bind to the β subunit of tubulin, hinder microtubule assembly, and thus inhibit tumor cell division. Chari et al. from ImmunoGen, Inc. formed DM1 molecules by connecting disulfide bonds at the C-3 ester group, which can be connected with different antibodies to form antibody-drug conjugates (ADCs) after DTT reduction. At present, a variety of ADC drugs derived from ansamitocin have entered different clinical testing stages, among which Trastuzumab Emtansine (T-DM1) developed by Roche for the treatment of human breast cancer has been marketed. In addition to its anti-tumor activity, ansamitocin can also inhibit the growth and reproduction of other eukaryotic organisms such as fungi, yeast, and insects.

[0003] In the fermentation process of ansamitocin-producing bacteria ATCC 31280, sucrose can be effectively utilized by the bacteria as a carbon source, and a certain concentration of sucrose can provide a carbon skeleton for bacterial growth, can provide reducing power and energy for primary and secondary metabolic pathways, and enhance the generation of precursors for the synthesis of secondary metabolites. The present invention combines protein fractionation and activity tracking to find an extracellular glycoside hydrolase and its encoding gene: APASM_6114 that hydrolyzes and utilizes sucrose. By enhancing the transcription level of the gene encoding the extracellular glycoside hydrolase that hydrolyzes sucrose, the sucrose consumption of the bacteria can be increased, thereby improving the utilization rate of the carbon source, and ultimately significantly increasing the yield of ansamitocin. Summary of the invention

[0004] The object of the present invention is to provide a method for enhancing the transcription level of glycoside hydrolase encoding gene APASM_6114 to increase the yield of ansamitocin; specifically, a method for improving the fermentation level of ansamitocin by enhancing the transcription level of extracellular glycoside hydrolase encoding gene APASM_6114 that hydrolyzes sucrose; by enhancing the expression of endogenous extracellular glycoside hydrolase encoding gene APASM_6114 that hydrolyzes sucrose in Actinomyces preciousis ATCC31280, a mutant strain (ARE-11) with high ansamitocin production is obtained, and the carbon source utilization efficiency of the bacteria is improved, thereby ultimately increasing the yield of ansamitocin.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect, the present invention relates to ansamitocin high-producing strain, wherein the expression of an extracellular glycoside hydrolase encoding gene for hydrolyzing sucrose is enhanced in Actinomyces preciousi.

[0007] As an embodiment of the present invention, the exoglycoside hydrolase encoding gene is APASM_6114, and its sequence is shown in SEQ ID NO. 1. The encoding gene is an endogenous exoglycoside hydrolase encoding gene of Actinomyces preciousis responsible for sucrose hydrolysis.

[0008] As an embodiment of the present invention, the Actinosynnema pretiosum subsp. pretiosum ATCC 31280. At this time, the ansamitocin high-yield strain is obtained by enhancing the expression of the endogenous extracellular glycoside hydrolase encoding gene APASM_6114 for hydrolyzing sucrose in Actinosynnema pretiosum ATCC 31280, and the obtained mutant strain is based on the enhanced expression of the endogenous glycoside hydrolase encoding gene APASM_6114 responsible for sucrose hydrolysis, and the ansamitocin yield is increased by promoting sucrose consumption and improving the carbon source utilization efficiency of the bacteria.

[0009] In a second aspect, the present invention relates to an integrative vector for enhancing the expression of a gene encoding a glycoside hydrolase for hydrolyzing sucrose, wherein the vector comprises an extracellular glycoside hydrolase encoding gene APASM_6114 (derived from Actinomyces preciousi), and the sequence thereof is shown in SEQ ID NO.1.

[0010] As an embodiment of the present invention, the gene encoding the extracellular glycoside hydrolase is derived from Actinomyces pretica ATCC 31280.

[0011] In the third aspect, the present invention relates to a method for constructing an integrative vector for enhancing the expression of a gene encoding a glycoside hydrolase for hydrolyzing sucrose, wherein the specific construction method of the integrative plasmid is to obtain a (4281 bp) APASM_6114 gene fragment from the ATCC31280 genome by PCR amplification, and connect it to the NdeI / EcoRI site downstream of the artificial strong promoter KasOp* in the integrative plasmid pLQ648 by enzyme cutting and ligation. The obtained integrative vector is recorded as pLQ2013.

[0012] As one embodiment of the present invention, the APASM_6114 gene was obtained by PCR amplification using primers APASM_6114-F / R.

[0013] In a fourth aspect, the present invention relates to an ansamitocin high-producing strain, which is obtained by introducing the aforementioned integrative plasmid vector, or the integrative plasmid vector constructed by the aforementioned method, into Actinomyces pretica for recombination.

[0014] As one embodiment of the present invention, the present invention provides a mutant strain ARE-11 of Actinomyces pretica having high ansamitocin production, wherein the aforementioned integrative plasmid vector or the integrative plasmid vector constructed by the aforementioned method is introduced into a recipient bacterium Actinomyces pretica ATCC 31280 through conjugation transfer to obtain the mutant strain.

[0015] In a fifth aspect, the present invention relates to a method for constructing an ansamitocin high-yield strain, wherein the integrative plasmid vector obtained by the integrative plasmid vector construction method is introduced into Actinomyces pretti by conjugation transfer for recombination to obtain the gene-enhanced expression mutant strain.

[0016] As an embodiment of the present invention, the construction method comprises the following steps:

[0017] S1, design and construction of an integrative plasmid for enhanced expression of the exoglycoside hydrolase encoding gene APASM_6114;

[0018] S2, introducing the integrative plasmid into the recipient strain by conjugation transfer, then verifying the mutant strain for apramycin resistance, and picking mycelium to screen the gene-enhanced expression mutant strain by the difference in PCR product fragment size.

[0019] As an embodiment of the present invention, the obtained mutant strain ARE-11 is based on enhancing the expression of the endogenous sucrose hydrolase encoding gene APASM_6114 that hydrolyzes sucrose, thereby promoting sucrose consumption and improving the carbon source utilization efficiency of the bacteria, thereby increasing the production of ansamitocin.

[0020] In a sixth aspect, the present invention relates to a method for increasing the yield (fermentation level) of ansamitocin, wherein the expression of an extracellular glycoside hydrolase encoding gene for hydrolyzing sucrose is enhanced in Actinomyces preciousis ATCC 31280 to obtain ansamitocin high-yield strain; and ansamitocin is obtained by fermentation.

[0021] As one embodiment of the present invention, the transcription level of the gene APASM_6114 encoding the extracellular glycoside hydrolase that hydrolyzes sucrose is enhanced to obtain ansamitocin by obtaining an enhanced expression mutant strain, fermenting, and obtaining ansamitocin. As a specific example, the artificial strong promoter KasOp* is used in Actinomyces preciousis ATCC 31280 to enhance the expression of the endogenous gene APASM_6114 encoding the extracellular glycoside hydrolase that hydrolyzes sucrose, promote sucrose consumption, improve the carbon source utilization efficiency of the bacteria, and thus increase the yield of ansamitocin.

[0022] As an embodiment of the present invention, the fermentation comprises the following steps: activating an enhanced expression mutant strain (ARE-11) encoding an extracellular glycoside hydrolase for hydrolyzing sucrose on a solid culture medium, and then culturing the activated mycelium in a primary seed culture medium at 30°C and 220rpm for 24 hours; transferring the inoculation amount to a secondary seed culture medium at 3.3%-6.6%, and culturing at 30°C and 220rpm for 24 hours; transferring the inoculation amount to a fermentation culture medium at 10%, and fermenting at 25°C and 220rpm for 7 days, and collecting the fermentation broth for extraction.

[0023] As a specific embodiment, the high-yield strain of ansamitocin is activated on a solid culture medium, and then the activated mycelium is cultured in a primary seed culture medium at 30°C and 220rpm for 24 hours; it is transferred to a secondary seed culture medium at a 6.6% inoculation rate, and cultured at 30°C and 220rpm for 24 hours; it is transferred to a fermentation medium at a 10% inoculation rate, and the fermentation liquid is collected and extracted after fermentation at 25°C and 220rpm for 7 days. As a specific comparative example, the wild-type ATCC 31280 and the mutant strain with enhanced gene expression are activated on a solid culture medium, and then the activated mycelium is cultured in a primary seed culture medium at 30°C and 220rpm for 24 hours; it is transferred to a secondary seed culture medium at a 6.6% inoculation rate, and cultured at 30°C and 220rpm for 24 hours; it is transferred to a fermentation medium at a 10% inoculation rate, and the fermentation liquid is collected and extracted after fermentation at 25°C and 220rpm for 7 days.

[0024] As an embodiment of the present invention, the solid culture medium comprises 0.4 w / v% yeast extract, 1 w / v% malt extract, 0.4 w / v% glucose, and 1.6-2% agar powder.

[0025] As one embodiment of the present invention, the primary seed culture medium comprises TSB 3w / v%, yeast extract 0.5w / v%, and sucrose 7.0w / v%. The secondary seed culture medium comprises TSB 3w / v%, yeast extract 0.6-0.8w / v%, sucrose 7.0w / v%, isobutanol 0.05v / v%, and isopropanol 0.05v / v%.

[0026] As an embodiment of the present invention, the fermentation medium comprises 3.3-6.6 w / v% yeast extract, 1 w / v% malt extract, 7.0 w / v% sucrose, 40 mmol / L valine, 0.5 v / v% isobutanol, 1.2 v / v% isopropanol, MgCl 2 2mmol / L.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] 1) By enhancing the extracellular glycoside hydrolase encoding gene APASM_6114 that hydrolyzes sucrose in Actinomycetes precious, the sucrose consumption is promoted and the carbon source utilization efficiency of the fungus is improved, thereby increasing the production of ansamitocin.

[0029] 2) In the present invention, the extracellular glycoside hydrolase encoding gene APASM_6114 for hydrolyzing sucrose is enhanced in Actinomycetes precious, thereby obtaining a high-yield strain; the ansamitocin fermentation yield of the high-yield strain ARE-11 obtained in the present invention reaches 63.7 mg / L at the laboratory shake flask fermentation level, which is 36.9% higher than that of the control strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0031] Figure 1 Schematic diagram of plasmid construction for enhanced expression of gene APASM_6114;

[0032] Figure 2 Schematic diagram of the fermentation yield of ansamitocin by the mutant strain ARE-11 with enhanced expression of the gene encoding the extracellular glycoside hydrolase that hydrolyzes sucrose and the control strain ATCC 31280::pSET152. DETAILED DESCRIPTION

[0033] The present invention is further described below by way of examples. This example is implemented on the premise of the technical solution of the present invention, and detailed implementation methods and processes are given, but the protection scope of the present invention is not limited to the following examples. The experimental methods in the following examples without specifying specific conditions are based on conventional conditions or the conditions recommended by the manufacturer.

[0034] The plasmid pLQ648 involved in the present invention has been recorded in the SCI database document "Liu, X.; Wu, Y.; Zhang, X.; Kang, Q.; Yan, Y.; Bai, L. Comparative Transcriptome-Based Mining of Genes Involved in the Export of Polyether Antibiotics for Titer Improvement. Antibiotics 2022, 11, 600.".

[0035] The strain Actinomyces preciousi ATCC 31280 involved in the present invention has been recorded in the document "Wenqin Pan, Qianjin Kang, Lei Wang, Linquan Bai* & Zixin Deng: Asm8, a specific LAL-type activator of 3-amino-5-hydroxybenzoate biosynthesis in ansamitocin production. Science China Life Sciences 2013(7):601-608".

[0036] Example

[0037] This example is a specific process for obtaining the enhanced expression mutant strain ARE-11 of the APASM_6114 gene encoding the extracellular glycoside hydrolase responsible for sucrose hydrolysis. The specific steps are as follows:

[0038] Step 1: Construction of plasmid pLQ2013

[0039] The genomic DNA of Actinomycetes precious ATCC 31280 (GenBank assembly accession: CP029607.1) was used as a template, and the primers APASM_6114-F / R with NdeI / EcoRI restriction sites introduced at both ends were used to amplify the APASM_6114 gene fragment (4281 bp) by PCR. The amplified fragment (NdeI / EcoRI) after restriction digestion was inserted into the NdeI / EcoRI site downstream of the strong promoter kasOp* in the plasmid pLQ-648 to obtain the plasmid pLQ2013. Figure 1 shown.

[0040] Step 2: The gene-enhanced expression plasmid pLQ2013 constructed in the first step is introduced into the recipient bacteria ATCC 31280 through conjugation transfer, and the correct gene-enhanced expression conjugate is verified by PCR and resistance verification methods. Specifically, the following steps are included:

[0041] The constructed gene-enhanced expression plasmid pLQ2013 was transformed into the host E. coli ET12567 (containing the pUZ8002 plasmid). E. coli ET12567 (pUZ8002) was cultured overnight at 37°C in LB containing 30 μg / mL apramycin, 50 μg / mL kanamycin, and 25 μg / mL chloramphenicol. The overnight culture was transferred once at a ratio of 1% using the same medium and cultured for 4-5 hours until the OD 600 Reach 0.6-0.8, then rinse the bacteria with fresh LB solution to remove the antibiotics in the culture. At the same time, prepare fresh ATCC 31280 mycelium (about 16 hours of culture), rinse it with LB solution 2-3 times, mix it with the previously prepared host bacteria ET12567 (pUZ8002) (the ratio of recipient bacteria cells to donor bacteria is about 1:10), and evenly spread it on a solid culture medium containing 10mM magnesium ions, and invert it in a 37℃ incubator. After 16 hours, take out the plate, add two antibiotics, apramycin (final concentration 100μg / mL) and nalidixic acid (final concentration 100μg / mL) to 1.5mL of sterile water, mix well, and cover it on the YMG solid culture medium. After the solid culture medium is dried, transfer it to a 30℃ incubator for inverted culture. Generally, after 3 to 5 days, conjugates can be seen growing on the plate. They are expanded by transferring to a solid culture medium containing two antibiotics, apramycin (final concentration 100 μg / mL) and nalidixic acid (final concentration 100 μg / mL). Mycelium is picked, and kasOp-F and APASM_6114-ver-R are used as primers. The conjugates are verified by PCR and resistance verification methods to obtain the correct gene-enhanced expression mutant strain ARE-11.

[0042] The endonuclease recognition sites (enzyme cutting sites) involved in the above step 1 are shown in Table 1 below:

[0043] Table 1

[0044]

[0045] The primer sequences used in the above steps 1 and 2 are shown in Table 2:

[0046] Table 2

[0047]

[0048]

[0049] The PCR system and conditions used for the preparation of gene fragments in steps 1 and 2 above are:

[0050] PCR reaction system: DNA template 30ng, primer 30pmol, 50% DMSO 3μL, 25mM Mg 2+ 2 μL, buffer 3 μL, KOD polymerase 1 unit, add purified water to make up to 30 μL;

[0051] PCR conditions: 95°C for 5 min; 95°C for 30 s, 64°C for 30 s, 72°C for 4 min and 20 s; 30 cycles; 72°C for 5 min.

[0052] The primer sequences are:

[0053] APASM_6114-F:CCCATATGATGGGGCACATGCGGGGCAGGCGGAG SEQ ID NO.2

[0054] APASM_6114-R: CGGAATTCCTACAACCCCGTGCACTGCCCCGAC SEQ ID NO.3 The PCR system and conditions used in the PCR verification and screening of mutants in the above step 2:

[0055] PCR reaction system: DNA template 10-100 ng, primer 10 pmol, 50% DMSO 2 μL, 2×Mix buffer 10 μL, add pure water to make up to 20 μL;

[0056] PCR conditions: 95°C for 10 min; 95°C for 15 s; 64°C for 15 s; 72°C for 1 min; 30 cycles; 72°C for 5 min.

[0057] The primer sequences are:

[0058] kasOp-F:GACAACATGCTGTGCGGTGTTGT SEQ ID NO.4

[0059] APASM_6114-ver-R:GGTAGGTGCCGTCGGAGAACGC SEQ ID NO.5

[0060] Step 3: Detect the fermentation yield of ansamitocin using HPLC

[0061] Agilent 1200 series HPLC was used for chromatographic analysis, and a DAD ultraviolet absorption detector was used to measure the chromatographic absorption peak at 254 nm.

[0062] Among them, the HPLC parameters are as follows:

[0063] Chromatographic column: Agilent ZORBAX SB-C18, 2.1×150 mm, 3.5 μm;

[0064] Mobile phase flow rate: 1 mL / min;

[0065] Mobile phase: pure acetonitrile solution and 1‰ HPLC grade methanol gradient elution.

[0066] Column temperature: room temperature.

[0067] Figure 2 The results of the ansamitocin fermentation level test of the mutant strain ARE-11 expressing the gene APASM_6114 encoding the extracellular glycoside hydrolase that hydrolyzes sucrose were enhanced. The results showed that after the enhanced expression of the above gene, the ansamitocin fermentation level was significantly improved. Compared with the starting strain, the ansamitocin yield of the high-yield strain ARE-11 obtained by the present invention reached 63.7 mg / L at the laboratory shake flask fermentation level, which was 36.9% higher than that of the control strain.

[0068] In summary, the present invention uses the strong promoter kasOp* to enhance the expression of the endogenous glycoside hydrolase encoding gene APASM_6114 of Actinomyces preciousis ATCC 31280, thereby obtaining a mutant strain ARE-11 with high ansamitocin production, promoting the sucrose consumption of Actinomyces preciousis, improving the carbon source utilization rate, and ultimately significantly increasing the ansamitocin production. The present invention can significantly increase the fermentation yield of ansamitocin and reduce the fermentation cost at the same time.

[0069] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A high-yield strain of ansamitocin, It is characterized in that The expression of an extracellular glycoside hydrolase encoding gene for hydrolyzing sucrose is enhanced in Actinosynnema pretiosum subsp. pretiosum ATCC 31280; the extracellular glycoside hydrolase encoding gene is APASM_6114, and its sequence is SEQ ID NO.

1.

2. An integrative plasmid vector for enhancing the expression of an extracellular glycoside hydrolase encoding gene for hydrolyzing sucrose, It is characterized in that The vector contains the extracellular glycoside hydrolase encoding gene APASM_6114, and its sequence is SEQ ID NO.

1.

3. A method for constructing an integrative plasmid vector according to claim 2, It is characterized in that APASM_6114 gene fragments were obtained from the genome of Actinosynnema pretiosum subsp. Pretiosum ATCC 31280 by PCR amplification and were connected into the NdeI / EcoRI site of the integration plasmid pLQ648 by enzyme digestion and ligation.

4. A method for constructing ansamitocin high-yield strain, It is characterized in that The integrative plasmid vector as claimed in claim 2 or the integrative plasmid vector obtained by the construction method as claimed in claim 3 is introduced into Actinosynnema pretiosum subsp. pretiosum ATCC 31280 for recombination to obtain the ansamitocin high-producing strain.

5. The method for constructing ansamitocin high-yield strain according to claim 4, It is characterized in that The method comprises the following steps: S1, design and construct an integrative plasmid vector for enhanced expression of the exoglycoside hydrolase encoding gene APASM_6114; S2, introducing the integrative plasmid vector into the recipient strain by conjugation transfer, then verifying the mutant strain for apramycin resistance, and picking mycelium to screen the gene-enhanced expression mutant strain through the difference in PCR product fragment size, i.e., the ansamitocin high-yielding strain.

6. A method for improving the fermentation level of ansamitocin, It is characterized in that The expression of an extracellular glycoside hydrolase encoding gene for hydrolyzing sucrose is enhanced in Actinosynnemapretiosum subsp.pretiosum ATCC 31280 to obtain ansamitocin high-yield strain; and ansamitocin is obtained by fermentation; the extracellular glycoside hydrolase encoding gene is APASM_6114, and its sequence is SEQ ID NO.

1.

7. The method according to claim 6, It is characterized in that The fermentation comprises the following steps: inoculating the activated ansamitocin high-yield strain into a primary seed culture medium, and culturing at 30°C and 220rpm for 24 hours; transferring the activated ansamitocin high-yield strain into a secondary seed culture medium at an inoculation rate of 3.3%-6.6%, and culturing at 30°C and 220rpm for 24 hours; transferring the activated ansamitocin high-yield strain into a fermentation culture medium at an inoculation rate of 10%, and fermenting at 25°C and 220rpm for 7 days, collecting the fermentation liquid, extracting it, and detecting the ansamitocin yield.

8. The method according to claim 7, It is characterized in that The primary seed culture medium comprises: TSB 3w / v%, yeast extract 0.5w / v%, and sucrose 7.0w / v%.

9. The method according to claim 7, It is characterized in that The secondary seed culture medium includes TSB 3w / v%, yeast extract 0.6-0.8w / v%, sucrose 7.0w / v%, isobutanol 0.05v / v%, and isopropanol 0.05v / v%.

10. The method according to claim 7, It is characterized in that The fermentation medium comprises 3.3-6.6 w / v% yeast extract, 1 w / v% malt extract, 7.0 w / v% sucrose, 40 mmol / L valine, 0.5 v / v% isobutanol, 1.2 v / v% isopropanol, MgCl 2 2mmol / L.

Citation Information

Patent Citations

  • High-yield ansamitocin strain for reinforcing transcriptional level and preparation method thereof

    CN107881137A

  • High-yielding ansamitocin method capable of enhancing in-vivo target protein gene expression of ansamitocin

    CN113980982A