A dehydrogenase mutant and a method for preparing methylprednisolone dehydro product by using the same

By optimizing the amino acid sequence of dehydrogenase and the dehydrogenase mutant expressed in E. coli, the problems of low conversion rate and cumbersome process in the preparation of methylprednisolone dehydrogenates were solved, and efficient and simple production was achieved.

CN116144615BActive Publication Date: 2025-08-01HUBEI GEDIAN HUMANWELL PHARMACEUTICAL CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202310085247.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-16
Publication Date
2025-08-01
Estimated Expiration
2043-01-16

AI Technical Summary

Technical Problem

In the prior art, the conversion rate of methylprednisolone dehydrogenates is low and the production process is cumbersome, and there is a lack of efficient and simple methods.

Method used

Using dehydrogenase mutants, the amino acid sequence is optimized through mutation or deletion of specific amino acid residues, and the expression of methylprednisolone dehydrogenates in E. coli is used to prepare methylprednisolone dehydrogenates using recombinant expression vectors.

Benefits of technology

Improve conversion rate, simplify production processes, reduce side reactions, and reduce costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116144615B_ABST
    Figure CN116144615B_ABST
Patent Text Reader

Abstract

The present invention discloses a dehydrogenase mutant and a method for preparing methylprednisolone dehydroproduct by using the same. The amino acid sequence of the dehydrogenase is shown as SEQ ID NO: 2; the dehydrogenase mutant has amino acid residue differences at one or more sites selected from the following positions in the amino acid sequence shown as SEQ ID NO: 2: position 315, position 330, or positions 452-463. The method for preparing methylprednisolone dehydroproduct by using the dehydrogenase mutant comprises one or more of the following steps: mixing an enzyme solution or pure enzyme containing the dehydrogenase mutant with methylprednisolone Grignard reagent; reacting at pH 7.5 and 35°C with stirring. The method provided by the present invention has the advantages of a simple reaction system, a short conversion period, few side reactions, and low cost.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering and relates to a dehydrogenase mutant and a method for preparing methylprednisolone dehydro product by using the same. Background Art

[0002] Methylprednisolone (as shown in Formula I) is a corticosteroid drug with strong anti-inflammatory effects, and its anti-inflammatory effect is 7 times that of cortisone. It is used for the first aid of critical diseases, and can also be used for endocrine disorders, rheumatic diseases, collagen diseases, skin diseases, allergic reactions, ophthalmic diseases, gastrointestinal diseases, blood diseases, leukemia, shock, cerebral edema, polyneuritis, myelitis, and preventing vomiting caused by cancer chemotherapy. Currently, it is mainly used for organ transplantation clinically.

[0003]

[0004] In the past, the production of steroid C1,2 dehydrogenation was carried out by using SeO2 for dehydrogenation. However, SeO2 is a highly toxic substance and the conversion rate is very low. Later, it was gradually replaced by biological methods, such as using Arthrobacter simplex, Mycobacterium, and Nocardia simplex, etc., and carrying out C1,2 dehydrogenation reaction by cell fermentation. For example, in the patents "Biological dehydrogenation preparation method of 6-α methylprednisolone intermediate" (see CN101760495A), "Production method of a methylprednisolone dehydro product" (see CN112608970A), etc., the method of cell fermentation is used to produce methylprednisolone dehydro product. However, the cell fermentation cycle is relatively long, the fermentation time is generally about 2 - 3 days, the cultivation of the pre-seed liquid, the preparation and sterilization process of the culture medium are cumbersome, and the fermentation parameters and the contamination of bacteria need to be strictly controlled during the fermentation process.

[0005] Currently, there is an urgent need for a method for preparing methylprednisolone dehydro product with high conversion rate and simple production process. Summary of the Invention

[0006] In order to solve the problem of the lack of a method for preparing methylprednisolone dehydro product with high conversion rate and simple production process in the prior art, the present invention provides a dehydrogenase mutant and its application, and a method for preparing methylprednisolone dehydro product by using the same. The preparation process is as shown in Formula II:

[0007] ...

[0008] The method for preparing methylprednisolone dehydro product provided by the present invention using the dehydrogenase mutant has a high conversion rate and a simple production process compared with the traditional cell fermentation method.

[0009] The first aspect of the present invention provides a dehydrogenase mutant, and the amino acid sequence of the dehydrogenase is as shown in SEQ ID NO: 2; the dehydrogenase mutant has differences in amino acid residues at one or more sites selected from the following on the amino acid sequence shown in SEQ ID NO: 2:

[0010] Position 315, position 330, or positions 452 - 463.

[0011] In some embodiments of the present invention, the dehydrogenase mutant has differences in amino acid residues at one or more sites selected from the following on the amino acid sequence shown in SEQ ID NO: 2:

[0012] The amino acid residue at position 315 is mutated from F to A, G, V, or S, the amino acid residue at position 330 is mutated from L to A, G, V, or S, and / or the amino acid residues at positions 452 - 463 are deleted.

[0013] In some embodiments of the present invention, the dehydrogenase mutant sequence is SEQ ID NO: 4 or SEQ ID NO: 5.

[0014] In some specific embodiments of the present invention, the dehydrogenase mutant sequence is SEQ ID NO: 5.

[0015] The second aspect of the present invention provides an isolated nucleic acid, wherein the nucleic acid encodes the dehydrogenase mutant as described in the first aspect.

[0016] The third aspect of the present invention provides a recombinant expression vector, wherein the recombinant expression vector contains the nucleic acid as described in the second aspect.

[0017] In some embodiments of the present invention, the backbone plasmid of the recombinant expression vector is pET26b(+) or pET28a(+).

[0018] The fourth aspect of the present invention provides a transformant, wherein the transformant contains the recombinant expression vector as described in the third aspect.

[0019] In some embodiments of the present invention, the chassis bacterium of the transformant is Escherichia coli, such as Escherichia coli BL21(DE3).

[0020] The fifth aspect of the present invention provides a method for preparing the dehydrogenase mutant as described in the first aspect, the method comprising growing the transformant in a suitable medium to produce the dehydrogenase mutant.

[0021] In some embodiments of the present invention, the method comprises:

[0022] (1) Inoculate the seed solution containing the transformant as described in the fourth aspect into LB liquid medium and culture it with shaking at 37°C;

[0023] (2) Add IPTG when the OD 600 is approximately 0.6 - 0.8;

[0024] (3) Culture it with shaking at 25°C;

[0025] (4) Collect and disrupt the bacterial cells;

[0026] (5) Collect the supernatant to obtain the product.

[0027] In some embodiments of the present invention, in the method:

[0028] (1) The inoculation amount of the transformant is 1%;

[0029] (2) The final concentration of IPTG is 0.1 - 0.2 mM;

[0030] (3) Culture it with shaking for 18 - 24 hours;

[0031] (4) Centrifuge to collect the bacterial cells, resuspend the bacterial cells with PBS, and the pH is 7 - 7.5.

[0032] The sixth aspect of the present invention provides a method for preparing methylprednisolone dehydro product, and the method uses the dehydrogenase mutant as described in the first aspect to prepare methylprednisolone dehydro product.

[0033] In some embodiments of the present invention, the method includes one or more of the following steps: <�

[0034] (1) Mix the enzyme solution or pure enzyme containing the dehydrogenase mutant with methylprednisolone Grignard reagent;

[0035] (2) React at pH 7.5 and 35°C with stirring.

[0036] In some embodiments of the present invention, the method includes adding a cosolvent to solubilize the methylprednisolone Grignard reagent, and the cosolvent is selected from one or more of DMSO, Triton-X100, Tween 80, and / or PEG-200.

[0037] In some specific embodiments of the present invention, the cosolvent is Triton-X100 and / or DMSO.

[0038] The seventh aspect of the present invention provides the use of the dehydrogenase mutant as described in the first aspect in the preparation of methylprednisolone dehydro product; wherein the dehydrogenase mutant sequence is SEQ ID NO: 4 or SEQ ID NO: 5.

[0039] In some embodiments of the present invention, the dehydrogenase mutant sequence is SEQ ID NO: 5.

[0040] Based on common general knowledge in the art, the above preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0041] The reagents and raw materials used in the present invention are all commercially available.

[0042] The positive and progressive effects of the present invention are as follows:

[0043] The present invention provides a dehydrogenase mutant and its application, as well as a method for preparing methylprednisolone dehydro product using the same. Compared with the traditional cell fermentation method for producing methylprednisolone dehydro product, the method provided by the present invention has the advantages of simple reaction system, short conversion period, few side reactions, and low cost. Description of the Drawings

[0044] Figure 1 It is the liquid phase detection result of the fermentation broth for the conversion of methylprednisolone Grignard reagent to methylprednisolone dehydro product by simple fatty liver bacteria. The peak time of the substrate methylprednisolone Grignard reagent is 18.193 min, and the peak time of the product methylprednisolone dehydro product is 17.004 min.

[0045] Figure 2 It is the electrophoresis pattern for extracting genomic DNA of simple fatty liver bacteria. The four lanes are all parallel groups extracted simultaneously.

[0046] Figure 3 It is the electrophoresis pattern for amplifying the KstD gene in the genomic DNA of simple fatty liver bacteria. The size of the target gene is 1659 bp, and the four lanes are all parallel operations.

[0047] Figure 4 It is the electrophoresis pattern of colony PCR for the constructed clone strain. The five lanes are the PCR results of different single colonies.

[0048] Figure 5 It is the catalytic result of KstD enzyme, with a substrate concentration of 2 mg / mL and a conversion time of 24 h.

[0049] Figure 6 It is the liquid phase spectrum of the product methylprednisolone dehydro product.

[0050] Figure 7 It is the liquid phase spectrum of the substrate methylprednisolone Grignard reagent.

[0051] Figure 8 [[ID= / * Figure 8 * / 46]]It is the one-sided electrophoresis pattern of KstD and its mutants KstD-M6 and mutant KstD-M 12 in which lane 1 is the mutant KstD-M 12, lane 2 is the mutant KstD-M6, and lanes 3 and 4 are the wild-type KstD protein.

[0052] Figures 9A - 9D are KstD-WT, KstD-M6 and KstD-M 12 Liquid phase diagram of the catalytic conversion results. Among them Figure 9A are KstD-WT, KstD-M6 and KstD-M 12 TLC thin layer chromatography analysis results of the conversion of the substrate respectively; Figure 9B The result shows that the product peak accounts for 28%; Figure 9C The result shows that the product peak accounts for 75%; Figure 9D The result shows that the product peak accounts for 97%. Detailed implementation mode

[0053] The present invention will be further described below by way of examples, but the present invention is not limited to the scope of the described examples. For the experimental methods without specific conditions in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0054] Example 1 Conversion of methylprednisolone Grignard by simple fatty liver bacteria

[0055] The present invention has carried out whole-genome sequencing and transcriptome sequencing on the existing simple fatty liver bacteria in the laboratory. According to the whole-genome sequence and transcriptome sequencing results, a gene with dehydrogenation function is screened out. The specific method is as follows:

[0056] The existing simple fatty liver bacteria in the laboratory are subjected to transcriptome sequencing. Total RNA is extracted from the strains before and after substrate induction respectively, and sent to the sequencing company for transcriptome sequencing. With the whole-genome sequencing results as a reference, the sequencing results are spliced.

[0057] After database annotation of the sequencing results, genes with increased expression levels before and after induction are screened out according to the sequencing results, and according to the gene function annotation, the target genes with potential dehydrogenation function are selected. Gene upstream and downstream primers are designed according to the target gene sequence, and an NdeI restriction site is added at the 5' end and a HindIII restriction site is added at the 3' end, and the target gene is amplified by PCR.

[0058] Construct the expression plasmid pET26b(+) containing the target gene. After verifying that the plasmid is correct, transform it into the expression strain BL21(DE3). Induce the constructed expression strains respectively, centrifuge to collect the induced strains, resuspend the bacterial liquid with PBS at pH 7, ultrasonically disrupt it, and centrifuge to collect the supernatant enzyme solution; react the collected enzyme solution with the substrate methylprednisolone Grignard reagent. After reacting overnight, perform liquid-phase detection on the conversion solution. The liquid-phase results show that the protein expressed by the sequence SEQ ID NO: 1 (the amino acid sequence is as shown in SEQ ID NO: 2) has a conversion effect on the substrate methylprednisolone Grignard reagent.

[0059] Due to codon preference, the gene of SEQ ID NO: 1 was selected to be optimized into codons preferred by Escherichia coli, and the optimized DNA sequence is SEQ ID NO: 3.

[0060] Activation of the strain :

[0061] The composition of the slant medium is: 1.2% glucose, 1.2% yeast extract powder, 1.5% agarose. After adding distilled water to 1000 mL, sterilize at 115 °C for 20 min. Pour it into the slant. After the slant solidifies, inoculate the bacteria. Dip a small amount of bacterial liquid with an inoculation loop and evenly streak it on the slant culture in the ultra-clean bench. Place the slant in a constant temperature incubator at 30 °C and culture for 2 - 3 days.

[0062] Culture of the seed liquid :

[0063] The composition of the seed medium is: 1% tryptone, 0.5% yeast extract, 1% NaCl. After adding distilled water to 1000 mL, sterilize at 115 °C for 20 min. After the above slant grows uniform colonies, scrape a loop of bacterial cells with an inoculation loop and inoculate it into 20 mL of the seed medium. Place the seed medium in a shaker at 32 °C and shake culture for 20 - 24 h. Take a small amount of bacterial liquid to measure the OD 600 which is about 6 - 7.

[0064] Culture in the fermentation medium :

[0065] The composition of the fermentation medium is: 1% glucose, 1% corn steep liquor, 0.3% peptone, 0.1% yeast extract powder, 0.25% KH2PO4, 0.5% Tween 80, and adjust the pH to 7.0 - 7.2 with NaOH. According to the transfer amount of 10%, pipette 5 mL of the bacterial liquid from the above seed medium and transfer it to 50 mL of the fermentation medium. After shaking culture at 32 °C for 18 - 24 h, add 500 mg of the substrate methylprednisolone Grignard reagent, shake culture at 32 °C, and the conversion time is 60 - 72 h. After the conversion is completed, take a sample for liquid-phase inspection. The conversion rate is greater than 95%. The liquid-phase results are shown in Figure 1 and Table 1.

[0066] Table 1 Statistical data of liquid phase for the conversion of methylprednisolone by simple fatty liver bacteria

[0067]

[0068] Example 2 PCR amplification of C1,2 dehydrogenase gene

[0069] Extract the genomic DNA of simple fatty liver bacteria using the method for extracting bacterial genomic DNA. The reagents used were purchased from Sangon Biotech (Shanghai) Co., Ltd., the Bacterial Genomic DNA Rapid Extraction Kit. Verify the extracted genomic DNA by agarose nucleic acid gel electrophoresis, see Appendix Figure 2 . Design upstream and downstream primers according to the DNA sequence of Seq ID NO: 1. The primer names and sequences are as follows:

[0070] KstD forward primer (SEQ ID NO: 6): GGAATTC CATATG TCCGACACCACC

[0071] KstD reverse primer (SEQ ID NO: 7): CCC AAGCTTT CAGGCGGTGGCCGC

[0072] Use PCR technology to amplify the C1,2 dehydrogenase gene. The PCR reaction system is shown in Table 1:

[0073] Table 2 PCR reaction system for amplifying C1,2 dehydrogenase gene

[0074]

[0075] The PCR amplification conditions are: pre-denaturation at 98°C for 5 min, denaturation at 95°C for 20 s, annealing at 55°C for 15 s, extension at 72°C for 30 s, and 30 cycles of denaturation-annealing-extension. After PCR, perform agarose gel electrophoresis on the PCR reaction solution. The size of the KstD gene is 1659 bp, and the results are shown in Figure 3 .

[0076] Example 3 Construction of engineering strains expressing C1,2 dehydrogenase gene

[0077] Recover the PCR product electrophoresis gel in Example 2. The kit used was purchased from Sangon Biotech (Shanghai) Co., Ltd., the DiaSpin Column DNA Gel Extraction Kit. NdeI, HindIII, and 10× Buffer are all commercial reagents, purchased from NEW England BioLabs. Digest the recovered PCR product with NdeI and HindIII restriction endonucleases. The digestion system is shown in Table 2.

[0078] Table 3 Restriction Enzyme Digestion System for PCR Products of C1,2 Dehydrogenase Gene

[0079]

[0080] The plasmid vector was digested with the same restriction endonuclease. Among them, T4 DNA Ligase and 10×T4 DNA Ligase Buffer were both purchased from NEW England BioLabs. The reaction solution after digestion was separated by nucleic acid gel electrophoresis, and the target band was recovered. The digested target gene and plasmid vector pET26b(+) were ligated with T4 DNA ligase. The ligation system is shown in Table 3.

[0081] Table 4 Ligation System of C1,2 Dehydrogenase Gene and Plasmid Vector

[0082]

[0083] The ligation reaction solution was transformed into Escherichia coli DH5α competent cells. After the transformation was completed, the bacterial solution was spread on an LB solid medium plate containing 50 μg / mL kanamycin and cultured overnight at 37°C in an inverted position. The next day, the grown single colonies were verified by colony PCR. The colony PCR reaction system is shown in Table 4. Among them, 2×Rapid Taq Master Mix was purchased from Nanjing Novozymes Biotech Co., Ltd., and the universal primers were provided by Beijing Tsingke Biotechnology Co., Ltd. Wuhan Branch. Their sequences are:

[0084] pET26b Universal Upstream Primer (SEQ ID NO: 8): TGCTAGTTATTGCTCAGCGG;

[0085] pET26b Universal Downstream Primer (SEQ ID NO: 9): TAATACGACTCACTATAGGG.

[0086] Table 5 Colony PCR Reaction System

[0087]

[0088] The colony PCR program was: pre-denaturation at 98°C for 5 min, denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 15 s. The denaturation-annealing-extension cycle was carried out 28 times. The PCR products were verified by gel electrophoresis. The electrophoresis results are shown in Figure 4 , and the size of the target gene is 2000 bp.

[0089] Select the single colonies with correct colony PCR, inoculate them into 5 mL of LB liquid medium containing 50 μg / mL, culture them overnight with shaking at 37 °C, collect the bacterial liquid, extract the plasmid. The kit used was purchased from Novoprotein, FastPure Plasmid MiniKit. Sequence and identify the KstD gene in the plasmid. Transform the correct plasmid into the competent cells of Escherichia coli expression strain BL21(DE3). Verify the transformed single colonies by colony PCR. The correct colonies are the required expression strains.

[0090] Example 4 Verification of C1,2 dehydrogenation functional gene

[0091] Inoculate the above-verified correct expression strain into LB liquid medium containing 50 μg / mL kanamycin, culture it overnight with shaking at 37 °C. The next day, transfer it to 50 mL of LB liquid medium containing kanamycin according to a transfer amount of 1%, and culture it with shaking at 37 °C for 2.5 - 3 h. Take a sample to measure the OD of the bacterial liquid 600 When it is about 0.6 - 0.8, add isopropyl-β-D-thiogalactoside (IPTG) to a final concentration of 0.1 mM, culture it with shaking at 25 °C for 18 h, then centrifuge at 5000 r / min for 5 min to collect the bacterial cells. Resuspend and mix the collected bacterial cells with 20 mL of PBS buffer at pH 7. Ultrasonically disrupt the resuspended solution for 20 min, then centrifuge at 12000 r / min for 10 min to collect the supernatant enzyme solution. Put the collected enzyme solution into the enzyme-catalyzed reaction. The reaction system is shown in Table 6. Among them, menaquinone was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. and was used as an electron acceptor in the dehydrogenation reaction.

[0092] Table 6 Enzyme-catalyzed reaction system

[0093]

[0094]

[0095] Adjust the pH of the system to 7.5 with NaOH, place the reaction in a 35 °C water bath, and stir the reaction magnetically overnight. Take a sample for liquid phase detection the next day. The detection results are shown in Figure 5 and Table 7. The substrate standard product spectrum is Figure 6 , and the product standard product spectrum is Figure 7 . By analyzing the liquid phase results, it can be known that there is a product of methylprednisolone dehydrogenase generated in the above enzyme-catalyzed system, verifying that the KstD enzyme has the activity to transform methylprednisolone Grignard reagent.

[0096] Table 7 Statistical liquid phase data of KstD enzyme transforming methylprednisolone Grignard reagent

[0097]

[0098] Example 5 Expression of Codon-Optimized KstD Protein in Escherichia coli

[0099] After verifying that the KstD protein had a transformation effect, due to codon preference, the codons of the SEQ ID NO: 1 gene were optimized for the Escherichia coli expression host. The optimized DNA sequence was SEQ ID NO: 3, and artificial synthesis of the DNA was performed: an NdeI restriction site was added at the 5' end, and a HindIII restriction site was added at the 3' end. The synthesized gene was cloned into the pET26b(+) expression vector by the above method, and the expression vector was transformed into the Escherichia coli expression strain BL21(DE3) for protein expression. A verified single colony was inoculated into 5 mL of LB medium containing kanamycin and cultured overnight with shaking at 37°C. The next day, according to an inoculation amount of 1%, the bacterial solution was transferred to 300 mL of LB liquid medium containing kanamycin and cultured with shaking at 37°C for 2.5 - 3 h. OD 600 was measured. When OD was approximately 0.6 - 0.8, IPTG was added to a final concentration of 0.2 mM. After culturing with shaking at 25°C for 20 h, the cells were collected by centrifugation at 5000 r / min for 5 min. The collected cells were resuspended in 50 mL of PBS buffer with a pH of 7.5, and the cells were disrupted by an ultrasonic disruptor for 20 min. The supernatant was collected by centrifugation at 12000 r / min for 10 min. 30 μL of the supernatant enzyme solution was pipetted into a 1.5 mL EP tube, 10 μL of 4× Protein Loading Buffer was added, and after mixing well by pipetting, it was placed in a metal bath and treated at 98°C for 5 min. 10 μL of the sample was loaded for SDS-PAGE protein electrophoresis. The electrophoresis results are shown in Figure 8 , and the size of the target protein was 60 KD.

[0100] Example 6 Optimization of KstD Enzyme Activity Based on the Three-Dimensional Structure of the KstD Protein

[0101] Predict the tertiary structure of the protein based on the amino acid sequence of the KstD enzyme, and perform molecular docking on the protein and the substrate ligand methylprednisolone Grignard reagent. According to the docking results, explain the dehydrogenation principle of the enzyme for the C1 and C2 positions of the substrate. Since Tyr-514 and Gly-517 bind to the 3-keto group in the substrate, it promotes the keto-enol tautomerism of the 3-keto group in the substrate, increasing the instability of the C2 hydrogen atom. Subsequently, the enolate can undergo hydrogen exchange with the solvent at C2 through Tyr514. When the negative charge of the species migrates to the C1 atom and a double bond is formed between the C1 and C2 atoms. The large amino acid residue groups of the side chains of Phe315 and Leu330 hinder the side chain at the C17 position of the substrate ligand, affecting the configuration of the substrate ligand in the active cavity and being unfavorable for substrate binding. Therefore, it is necessary to modify Phe315 and Leu330. After mutating Phe315 to Ala, Gly, Val, or Ser, and mutating Leu330 to amino acids such as Ala, Gly, Val, or Ser, the active cavity is enlarged, the stability of the conformation of the substrate in the active cavity is increased, the influence of the side chain group at the C17 position on the dehydrogenation reaction is reduced, and thus the dehydrogenation activity at the C1 and C2 positions is improved. The amino acid sequence of the optimized KstD-Mutation6 (abbreviated as KstD-M6) mutant is SEQ ID NO: 4. And through the analysis of the docking results, it can be known that the amino acids at positions 452-463 are redundant Loop structures, which hinder the entry of the side chain group at the C17 position of the substrate ligand into the active pocket, so they are deleted. The amino acid sequence after deletion is SEQ ID NO: 5 (i.e., KstD-M 12 )

[0102] Example 7 Construction of KstD Mutants and Expression of Mutant Proteins in Escherichia coli

[0103] After determining the mutant sequence, design primers and construct mutants using the method of overlap extension PCR. Construct KstD-M6 and KstD-M 12 mutants by this method, and then use restriction enzyme digestion and ligation to construct the expression vector of pET26b(+). Transform the expression plasmid containing the KstD mutant into the competent cells of the Escherichia coli expression strain BL21(DE3). After verifying the correct mutant monoclonal, inoculate the correct single colony into the LB liquid medium containing kanamycin resistance, and express KstD-M6 and KstD-M 12 mutant proteins according to the above protein expression process. Electrophorese the expressed proteins, and the results are as Figure 8 shown

[0104] Example 8 Reaction of KstD Mutants Catalyzing Methylprednisolone Grignard Reagent to Generate Methylprednisolone Dehydrogenate

[0105] They were put into the enzymatic reaction according to the following system: The enzyme solutions of KstD-WT, KstD-M6 and KstD-M 12 were diluted to 10 mg / mL with PBS (0.1 mM K2HPO4 and KH2PO4) at pH 7.5. 45 mL of the diluted enzyme solution was taken, 1 g of the substrate methylprednisolone Grignard reagent (dissolved in 5 mL DMSO) was added, 1.5 mL of Triton-X100 was added, and the pH of the system was adjusted to 7.5 with NaOH. The reaction was placed in a water bath at 35 °C and stirred overnight with a magnetic stirrer. The next day, 0.5 mL of the reaction solution was pipetted, 0.5 mL of ethyl acetate was added for extraction, vortexed, and centrifuged at 12,000 r / min for 1 min. The upper organic layer was taken for TLC spotting analysis, and samples were taken for HPLC analysis. The results are shown in Figure 9.

[0106] The TLC developing agent ratio was dichloromethane∶petroleum ether = 3∶1, and 5 drops of methanol were added. The liquid chromatography conditions were as follows: The mobile phase was acetonitrile∶water∶trifluoroacetic acid = 32∶68∶0.1, and isocratic elution was used. According to the liquid phase results, when the substrate concentration was 20 g / L and the conversion time was 18 h, the enzymatic conversion rate of KstD-WT was 28%, the conversion rate of KstD-M6 was 75%, and the conversion rate of KstD-M 12 was 97%. The activity of the mutant KstD-M 12 was increased by 350% compared with the wild type.

Claims

1. A dehydrogenase mutant, characterized in that, The amino acid sequence of the dehydrogenase mutant is shown in SEQ ID NO: 4 or SEQ ID NO:

5.

2. The dehydrogenase mutant according to claim 1, characterized in that, The amino acid sequence of the dehydrogenase mutant is SEQ ID NO:

5.

3. An isolated nucleic acid, wherein the nucleic acid encodes the dehydrogenase mutant as described in claim 1 or 2.

4. A recombinant expression vector, wherein the recombinant expression vector contains the nucleic acid as described in claim 3.

5. The recombinant expression vector according to claim 4, characterized in that, The backbone plasmid of the recombinant expression vector is pET26b(+) or pET28a(+).

6. A transformant, wherein the transformant contains the recombinant expression vector as described in claim 4 or 5; the transformant is not an animal or plant variety.

7. The transformant according to claim 6, wherein, The chassis bacterium of the transformant is Escherichia coli.

8. The transformant according to claim 7, wherein The chassis bacterium of the transformant is Escherichia coli BL21(DE3).

9. A method for preparing the dehydrogenase mutant as described in claim 1 or 2, characterized in that, The method includes growing the transformant as described in any one of claims 6-8 in a suitable medium to produce the dehydrogenase mutant.

10. The method according to claim 9, wherein The method includes: (1) Inoculating the seed liquid containing the transformant into LB liquid medium and culturing it with shaking at 37 °C; (2)OD 600 Add IPTG when it is 0.6 - 0.8; (3) Culturing with shaking at 25 °C; (4) Collecting and lysing the bacterial cells; (5) Collecting the supernatant to obtain the product.

11. The method according to claim 10, wherein In the method: (1) The inoculation amount of the transformant is 1%; (2) The final concentration of IPTG is 0.1-0.2 mM; (3) Culturing with shaking for 18-24 hours; (4) Centrifuging to collect the bacterial cells, resuspending the bacterial cells with PBS, and the pH is 7-7.

5.

12. A method for preparing methylprednisolone dehydro compound, characterized in that, Using the dehydrogenase mutant as described in claim 1 or 2 to catalyze the substrate to generate methylprednisolone dehydro product.

13. The method according to claim 12, characterized in that, The method includes one or more of the following steps: (1) Mixing the enzyme solution or pure enzyme containing the dehydrogenase mutant with methylprednisolone Grignard reagent; (2) Reacting at pH 7.5 and 35 °C with stirring.

14. The method according to claim 13, wherein The method includes adding a cosolvent to solubilize the methylprednisolone Grignard reagent, wherein the cosolvent is selected from one or more of DMSO, Triton-X100, Tween 80, and PEG-200.

15. The method according to claim 14, wherein The cosolvent is Triton-X100 and / or DMSO.

16. Use of the dehydrogenase mutant as described in claim 1 or 2 in the preparation of methylprednisolone dehydro product; wherein the amino acid sequence of the dehydrogenase mutant is SEQ ID NO: 4 or SEQ ID NO:

5.

17. The application according to claim 16, characterized in that, The amino acid sequence of the dehydrogenase mutant is SEQ ID NO: 5.

Citation Information

Patent Citations

  • Biological dehydrogenation preparation method of 6 alpha-methylprednisolone intermediate

    CN101760495A

  • Production method of methylprednisolone dehydrogenate

    CN112608970A

  • Amino acid dehydrogenase mutant and application of mutant in synthesizing L-glufosinate

    CN109609474A

  • Arthrobacter simplex engineering bacterial strains with steroid C1, 2 dehydrogenation reaction capability

    CN112961816A