A Cyclodextrin Glucosyltransferase with Improved Solvent Tolerance and Its Preparation
By mutating amino acids at specific sites on cyclodextrin glucosyltransferase, mutants with increased tolerance are constructed, which solves the problem of reduced activity of natural enzymes in the organic solvent environment, and achieves the maintenance of enzyme activity and the improvement of glycosylation efficiency of hydrophobic substrates.
Patent Information
- Application Number
- CN202211071304.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-01
- Publication Date
- 2025-06-03
- Estimated Expiration
- 2042-09-01
AI Technical Summary
Natural cyclodextrin glycosyltransferase is affected in an organic solvent environment, limiting its production efficiency.
By mutation of the amino acid sequence of cyclodextrin glucosyltransferase at specific sites, mutants such as R146F, G539I, G539I/R146F, G539I/R146F/D147N were constructed to improve the enzyme's tolerance to organic solvents.
The tolerance of mutants in organic solvents is significantly improved, the enzyme activity is maintained at 90% to 120% of the wild type, and the glycosylation efficiency of hydrophobic substrates is improved in practical applications.
Smart Images

Figure CN116144622B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a cyclodextrin glucosyltransferase with improved solvent tolerance and its preparation, belonging to the technical fields of enzyme engineering and genetic engineering. Background Art
[0002] Cyclodextrin glycosyltransferase (CGTase, EC2.4.1.19), belonging to the α - amylase family, has great commercial value due to its multiple transglycosylation activities (cyclization, disproportionation, coupling activities). Currently, this enzyme is mainly used in industry to produce cyclodextrin. In addition, this enzyme also has partial hydrolysis activity and plays an important role in the short - chain glycosylation reaction process. In recent years, good progress has been made in the research on using its transglycosylation activity to improve the properties of natural substrates, such as stevioside, rutin, genistein, etc. Glycosylation treatment effectively solves various problems such as poor solubility, difficult storage, and instability of these substances in practical applications, and most glycosylation products maintain the excellent properties and values of the substances themselves, thus having good applications in multiple fields such as food and chemical engineering.
[0003] However, in the application process, new problems have emerged and need to be solved urgently. In practical applications, it is often difficult for directly mined natural cyclodextrin glycosyltransferase to meet production requirements. The reasons are that most natural enzymes have problems such as low enzyme activity, instability, and poor substrate promiscuity. Moreover, due to the complex catalytic mechanism of cyclodextrin glycosyltransferase, multiple products are often produced and the product specificity is poor. Therefore, current molecular modifications of this enzyme mainly focus on aspects such as catalytic activity, thermal stability, and specificity, and good progress has been made. However, for enzymatic reactions, in addition to the enzyme itself, its catalytic efficiency is also greatly related to the environment where the enzyme is located. In industrial production, the use of organic solvents is a very important link. The biotransformation of many hydrophobic substrates depends on organic solvents, but organic solvents often have an adverse impact on most enzymes, reducing enzyme activity or even inactivating it, severely limiting production efficiency.
[0004] Similar to most enzymes, the enzyme activity and enzyme stability of natural cyclodextrin glycosyltransferase in an organic solvent environment will be greatly affected. Therefore, in order to break through this bottleneck, it is of great significance to improve the organic solvent tolerance of cyclodextrin glycosyltransferase and its enzyme activity in organic solvents through molecular modification strategies. Summary of the Invention
[0005] The purpose of the present invention is to provide a mutant of cyclodextrin glucosyltransferase with improved solvent tolerance, which is beneficial to expanding the glycosylation application of cyclodextrin glycosyltransferase to natural hydrophobic substrates.
[0006] The mutant is obtained by mutating the amino acids at positions 146, 147, and 539 of the cyclodextrin glucosyltransferase having the amino acid sequence as shown in SEQ ID NO.1.
[0007] In one embodiment of the present invention, the cyclodextrin glucosyltransferase is derived from Paenibacillus macerans.
[0008] In one embodiment of the present invention, the nucleotide sequence of the cyclodextrin glucosyltransferase is as shown in SEQ ID NO.2.
[0009] In one embodiment of the present invention, the mutant is obtained by mutating the arginine at position 146 of the cyclodextrin glucosyltransferase having the amino acid sequence as shown in SEQ ID NO.1 to phenylalanine, and is named R146F.
[0010] In one embodiment of the present invention, the mutant is obtained by mutating the glycine at position 539 of the cyclodextrin glucosyltransferase having the amino acid sequence as shown in SEQ ID NO.1 to isoleucine, and is named G539I.
[0011] In one embodiment of the present invention, the mutant is obtained by mutating the glycine at position 539 of the cyclodextrin glucosyltransferase having the amino acid sequence as shown in SEQ ID NO.1 to isoleucine, and simultaneously mutating the arginine at position 146 to phenylalanine, and is named G539I / R146F.
[0012] In one embodiment of the present invention, the mutant is obtained by mutating the glycine at position 539 of the cyclodextrin glucosyltransferase having the amino acid sequence as shown in SEQ ID NO.1 to isoleucine; simultaneously mutating the arginine at position 146 to phenylalanine; simultaneously mutating the aspartic acid at position 147 to asparagine; and is named G539I / R146F / D147N.
[0013] The present invention also provides a gene encoding the above mutant.
[0014] The present invention also provides a recombinant vector carrying the above gene.
[0015] In one embodiment of the present invention, the vector is: pET series vector, pUT series vector or pBAD series vector.
[0016] The present invention also provides a recombinant cell expressing the above mutant, or carrying the above gene, or carrying the above recombinant vector.
[0017] In one embodiment of the present invention, the recombinant cell uses a fungus or a bacterium as the host cell.
[0018] In one embodiment of the present invention, the host cell is: Escherichia coli or Bacillus subtilis.
[0019] The present invention also provides a method for preparing the cyclodextrin glucosyltransferase mutant, and the specific steps include:
[0020] (1) First, design primers for site-directed mutagenesis, perform whole plasmid PCR using the plasmid containing the cyclodextrin glucosyltransferase gene as a template, obtain a recombinant plasmid carrying the mutant gene after digesting the template, transfer it into the host bacterium, screen with kanamycin resistance, pick colonies for culture, and send samples for sequencing;
[0021] (2) Culture the strain with correct sequencing, transfer it to TB medium at an inoculation amount of 1% after culturing at 37 °C for 12 h, culture at 37 °C until the OD reaches about 0.8, then induce expression, the induction temperature is 16 °C, and induce for 18 h;
[0022] (3) After the culture is ended, centrifuge the collected fermentation broth to collect the thalli, perform ultrasonic disruption, centrifuge again, and the collected supernatant is the crude enzyme solution of the mutant.
[0023] In one embodiment of the present invention, the recombinant plasmid uses pET-28a(+) as an expression vector.
[0024] In one embodiment of the present invention, the host bacterium is E. coli BL21(DE3).
[0025] In one embodiment of the present invention, the organic solvents include: dimethyl sulfoxide (DMSO), ethanol, methanol, and acetone.
[0026] The present invention also provides a method for improving the tolerance of cyclodextrin glucosyltransferase to organic solvents, and the method is to mutate the glycine at the 539th position of the cyclodextrin glucosyltransferase with the amino acid sequence shown in SEQ ID NO.1 into isoleucine;
[0027] or mutate the glycine at the 539th position of the cyclodextrin glucosyltransferase with the amino acid sequence shown in SEQ ID NO.1 into isoleucine, and at the same time mutate the arginine at the 146th position into phenylalanine;
[0028] or mutate the glycine at the 539th position of the cyclodextrin glucosyltransferase with the amino acid sequence shown in SEQ ID NO.1 into isoleucine; at the same time mutate the arginine at the 146th position into phenylalanine; at the same time mutate the aspartic acid at the 147th position into asparagine.
[0029] In one embodiment of the present invention, the organic solvent includes one or more of dimethyl sulfoxide (DMSO), ethanol, methanol, and acetone.
[0030] The present invention also provides a method for producing long-chain glycosylated genistein, characterized in that the method comprises adding a cyclodextrin glucosyltransferase mutant to a reaction system containing soluble starch and genistein for reaction to obtain a reaction solution; separating the reaction solution to obtain long-chain glycosylated genistein.
[0031] The present invention also provides the above mutant, or the above gene, or the above recombinant vector, or the above recombinant cell, for glycosylation application in natural hydrophobic substrates, or for glycosylation application in a partial organic solvent reaction system.
[0032] Beneficial effects
[0033] (1) The present invention constructs four cyclodextrin glucosyltransferase mutants with improved organic solvent tolerance, R146F, G539I, G539I / R146F, G539I / R146F / D147N, and their original activities directly measured in a system without organic solvents remain at 90% - 120% of the WT activity.
[0034] (2) In the determination of the tolerance to dimethyl sulfoxide, the residual activity of WT after incubation in a 25% DMSO system for 1 h is 21.3%, while the tolerances of the mutants R146F, G539I, G539I / R146F, G539I / R146F / D147N are all improved. Among them, the optimal mutant is G539I / R146F / D147N, and its DMSO tolerance is 1.6 times higher than that of WT.
[0035] (3) In the determination of the tolerance to ethanol, the residual activity of WT after incubation in 12% ethanol for 1 h is 17.9%. When the above four mutants are measured under the same conditions, it is found that the optimal mutant among them is R146F, and its ethanol tolerance is 1.4 times higher than that of WT.
[0036] (4) In the determination of the tolerance to methanol, the residual activity of WT after incubation in 12% methanol for 1 h is 27.4%. When the above four mutants are measured under the same conditions, it is found that the optimal mutant among them is G539I / R146F / D147N, and its methanol tolerance is 1.7 times higher than that of WT.
[0037] (5) In the determination of the tolerance to acetone, the residual activity of WT after incubation in 15% acetone for 1 h is 22.3%. When the above four mutants are measured under the same conditions, it is found that the optimal mutant among them is G539I / R146F, and its acetone tolerance is 1.5 times higher than that of WT.
[0038] (6) Two cyclodextrin glycosyltransferase mutants with improved organic solvent tolerance were obtained in this invention, which promoted the glycosylation efficiency of hydrophobic substrates, helped to expand the industrial application scope of CGTase, and had great application prospects. Description of the Drawings
[0039] Figure 1 : SDS-PAGE of wild-type and mutant pure enzymes; where M: Marker; 1: R146F; 2: G539I; 3: G539I / R146F; 4: G539I / R146F / D147N; 5: wild-type WT. Detailed Embodiments
[0040] The specific embodiments of the present invention are only used for further illustration and cannot be used as the limiting content and scope of the present invention.
[0041] The primer sequences involved in the following examples are shown in Table 1:
[0042] Table 1: Primers
[0043]
[0044] The culture media involved in the following examples are as follows:
[0045] LB liquid medium: Yeast extract 5.0 g·L -1 , Tryptone 10.0 g·L -1 , NaCl 10.0 g·L -1 .
[0046] LB solid medium: Add 2% agar to the LB liquid medium.
[0047] TB liquid medium: Yeast extract 24.0 g·L -1 , Tryptone 12.0 g·L -1 , KH 2 PO 3 2.3 g·L -1 , K 2 HPO 3 16.4 g·L -1 , Glycerol 5 g·L -1 .
[0048] The detection methods involved in the following examples are as follows:
[0049] Activity detection of cyclodextrin glycosyltransferase:
[0050] Determination of cyclization activity by methyl orange method: Take 50 μL of enzyme solution diluted to an appropriate concentration, add 200 μL of maltodextrin (prepared at a concentration of 10 g·L -1 ) with 50 mM phosphate buffer (pH 6.0), react in a water bath shaker at 40 °C for 10 min, immediately add 250 μL of hydrochloric acid (1.0 M) to terminate the reaction, then add 150 μL of methyl orange (prepared at a concentration of 0.5 mM with 50 mM phosphate buffer), let it stand at room temperature (20 °C) for 20 min, and measure the absorbance at 505 nm. Use the group without enzyme solution as the blank control.
[0051] Definition of enzyme activity: The amount of enzyme required to generate 1 μmol of α-cyclodextrin per minute under this condition is defined as one enzyme activity unit.
[0052] The construction method of the T599D / N600D / Y601H mutant pure enzyme involved in the following examples is recorded in the Chinese patent application text with the publication number CN113817704A.
[0053] Example 1: Preparation and expression of cyclodextrin glucosyltransferase mutants
[0054] 1. Site-directed mutagenesis
[0055] (1) Construction of pET28a(+)-cgt
[0056] The specific steps are as follows:
[0057] Take the glycerol bacteria E.coli BL21(DE3) / pET-20b(+)-cgt preserved in the laboratory. The strain E.coliBL21(DE3) / pET-20b(+)-cgt is prepared by digesting and ligating pET-20b(+) with cyclodextrin glucosyltransferase cgt with the nucleotide sequence shown in SEQ ID NO.2 to obtain a recombinant plasmid, and then introducing the recombinant plasmid into E.coli BL21(DE3) to prepare sufficient bacteria. The specific construction process can be seen in the reference: Han, R., Ge, B., Jiang, M. et al. High production of genistein diglucoside derivative using cyclodextrin glycosyltransferase from Paenibacillus macerans. J Ind Microbiol Biotechnol 44, 1343–1354 (2017);
[0058] After streaking and activating E. coli BL21(DE3) / pET-20b(+)-cgt, a single colony was picked and inoculated into LB liquid medium containing ampicillin (100 mg / L). After culturing at 37 °C for 10 h, plasmid pET-20b(+)-cgt was extracted using a kit.
[0059] One-step cloning for vector replacement: Primers were designed with the primer sequences as follows: F: CAGCAAATGGGTCGCGGATCCTCACCGGACACCTCAGTGGA
[0060] R: GTGGTGGTGGTGGTGCTCGAGATTTTGCCAATCCACCGTCA; Using plasmid pET-20b(+)-cgt as a template, a large number of cloned target fragments were obtained by PCR technology. After gel extraction, they were ligated with plasmid pET-28a(+) digested with double enzymes (BamH I and Xho I). After transformation into Escherichia coli BL21, they were spread on the culture medium for culturing. After obvious colonies grew out, they were picked and inoculated into LB liquid medium for culturing for 10 h. The plasmid was extracted and sent for sequencing. The plasmid with correct sequencing was labeled as pET-28a(+)-cgt.
[0061] (2) Construction of mutants
[0062] The amino acid sequence of cyclodextrin glucosyltransferase in the present invention is shown as SEQ ID NO.1 (the nucleotide sequence of the gene is shown as SEQ ID NO.2). According to the selected mutation sites, primers were designed and whole plasmid PCR was carried out using the extracted recombinant plasmid pET28a(+)-cgt as a template. The primer sequences are as follows:
[0063] Primers used for mutant R146F:
[0064] Forward primer: 5'-TCTCCGGCAGAT TTT GACAATCCG-3', the underlined part is the mutated base;
[0065] Reverse primer: 5'-CGGATTGTC AAA ATCTGCCGGAGA-3', the underlined part is the mutated base.
[0066] Primers used for mutant G539I:
[0067] Forward primer: 5'-ACCGCGGTCACC ATT AGTGGTATT-3', the underlined part is the mutated base;
[0068] Reverse primer: 5'-AATACCACT AATGGTGACCGCGGT-3', where the underlined bases are the mutated bases.
[0069] Primers used for mutant G539I / R146F:
[0070] Forward primer 1: 5'-TCTCCGGCAGAT TTT GACAATCCG-3', where the underlined bases are the mutated bases;
[0071] Reverse primer 1: 5'-CGGATTGTC AAA ATCTGCCGGAGA-3', where the underlined bases are the mutated bases.
[0072] Forward primer 2: 5'-ACCGCGGTCACC ATT AGTGGTATT-3', where the underlined bases are the mutated bases;
[0073] Reverse primer 2: 5'-AATACCACT AAT GGTGACCGCGGT-3', where the underlined bases are the mutated bases.
[0074] Primers used for mutant G539I / R146F / D147N:
[0075] Forward primer 1: 5'-TCTCCGGCAGAT TTTAAT AATCCG-3', where the underlined bases are the mutated bases;
[0076] Reverse primer 1: 5'-CGGATT ATTAAA ATCTGCCGGAGA-3', where the underlined bases are the mutated bases.
[0077] Forward primer 2: 5'-ACCGCGGTCACC ATT AGTGGTATT-3', where the underlined bases are the mutated bases;
[0078] Reverse primer 2: 5'-AATACCACT AAT GGTGACCGCGGT-3', where the underlined bases are the mutated bases.
[0079] The PCR reaction system is as follows: 5×PrimeSTAR Buffer (Mg 2+ Plus) 5 μL, 2.5 mM dNTPs 4 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, template DNA 1 μL, 2.5 U / μL PrimeSTAR Taq HS 0.5 μL, and double-distilled water is added to make up to 50 μL;
[0080] The amplification conditions for PCR products were as follows: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s, annealing at 50°C for 15 s, extension at 68°C for 4 min, 25 cycles, followed by incubation at 68°C for 10 min, and finally storage at 16°C.
[0081] The PCR products were detected by 1% agarose gel electrophoresis. After correct detection, the template was digested with restriction enzyme (Dpn I) at 37°C for 1 h. The digested products were then transferred into competent Escherichia coli BL21 and cultured overnight on LB solid medium containing 50 mg / L kanamycin. Positive clones were picked and inoculated into LB liquid medium for 10 h, and then plasmids were extracted and sent for sequencing. If the sequencing was correct, recombinant Escherichia coli capable of expressing mutants was obtained, namely, recombinant Escherichia coli: E. coli BL21(DE3) / pET28a(+)-R146F, E. coli BL21(DE3) / pET28a(+)-G539I, E. coli BL21(DE3) / pET28a(+)-G539I / R146F, E. coli BL21(DE3) / pET28a(+)-G539I / R146F / D147N;
[0082] (3) Construction of recombinant bacteria containing wild-type CGTase
[0083] The recombinant plasmid pET28a(+)-cgt was introduced into E. coli BL21(DE3) according to the above method, and E. coli BL21(DE3) / pET-28a(+)-cgt was obtained.
[0084] 2. Expression of mutants
[0085] The recombinant Escherichia coli containing mutant genes prepared in step 1 and the wild-type strain E. coli BL21(DE3) / pET-28a(+)-cgt were respectively inoculated into LB liquid medium (containing 50 mg / L kanamycin) and cultured at 37°C for 10 h to prepare seed solutions;
[0086] The obtained seed solutions were inoculated into TB liquid medium (containing 50 mg / L kanamycin) at an inoculation amount of 1% (v / v) and cultured on a shaker at 37°C until the OD 600 reached 0.6 - 0.8. IPTG was added at a final concentration of 0.1 mM for induction expression at 16°C. After fermentation culture for 18 h, fermentation broth was prepared;
[0087] The obtained fermentation broth was centrifuged to collect bacteria at 4°C and 8000 r / min for 10 min. The supernatant was discarded, and the remaining precipitate was resuspended with phosphate buffer (pH 6.0, 50 mM) and then ultrasonically disrupted at 300 W for 10 min. The disrupted solution was centrifuged at 4°C and 8000 r / min for 30 min, and the resulting supernatant was the crude enzyme solution containing the mutant, that is, the crude enzyme solution containing wild-type CGTase, the crude enzyme solution containing R146F, the crude enzyme solution containing G539I, the crude enzyme solution containing G539I / R146F, and the crude enzyme solution containing G539I / R146F / D147N were obtained.
[0088] The above-mentioned mutant crude enzyme solution and wild enzyme crude enzyme solution were respectively subjected to agarose gel electrophoresis to verify the successful protein expression.
[0089] 3. Purification of Mutants and Wild-Type Enzymes
[0090] The above-mentioned crude enzyme solutions were respectively filtered through a membrane and purified by Ni column affinity chromatography. First, the Ni column was equilibrated with buffer A (containing 20 mM sodium phosphate, 0.5 M sodium chloride, 20 mM imidazole, pH 7.4). After equilibration, the protein sample was loaded. After multiple loadings for complete adsorption, gradient elution was carried out successively with imidazole solutions of different concentrations (20 - 500 mM) and the flow-through was collected. After completion, a 10% protein gel was prepared to detect the target protein. The imidazole solutions containing the target protein were combined, concentrated and replaced with an ultrafiltration tube and phosphate buffer at pH 6.0. Finally, the obtained protein samples were aliquoted, quickly frozen with liquid nitrogen, and stored at -80°C for standby.
[0091] The pure enzyme solutions containing wild-type CGTase, R146F, G539I, G539I / R146F, and G539I / R146F / D147N were respectively prepared.
[0092] The above-mentioned mutant and wild-type enzyme solutions were respectively subjected to agarose gel electrophoresis, and the results were as Figure 1 shown, with corresponding bands at 74 kDa (the size of the third band of the Marker is 70 kDa).
[0093] Example 2: Detection of Organic Solvent Tolerance of Cyclodextrin Glucosyltransferase
[0094] In the embodiment of the present invention, the organic solvent tolerance of cyclodextrin glucosyltransferase was analyzed by measuring its residual enzyme activity after incubation in organic solvents of different concentrations for a certain time.
[0095] Calculation of residual activity = enzyme activity after incubation (enzyme activity measured in organic solvent systems with different concentrations) / enzyme activity without incubation (enzyme activity measured in a system containing only PBS)
[0096] The specific steps are as follows:
[0097] 1. Detection of the tolerance of cyclodextrin glucosyltransferase to the organic solvent dimethyl sulfoxide (DMSO)
[0098] The concentration of dimethyl sulfoxide (DMSO) was selected as 0% and 25% (v / v) respectively, and the incubation time was controlled at 1 h. The activity of the obtained pure enzyme was measured using the methyl orange method (the methyl orange method was appropriately improved for convenient detection).
[0099] The specific method is as follows:
[0100] (1) After diluting the pure enzyme solution prepared in Example 1 and the pure enzyme solution of the T599D / N600D / Y601H mutant to an enzyme activity of 0.01 - 0.02 mg / mL respectively, 100 μL was taken and added to 100 μL of phosphate buffer (50 mM, pH 6.0) containing DMSO, where the initial volume fractions of DMSO in the phosphate buffer containing DMSO were 0% and 50% respectively;
[0101] (2) Prepare a maltodextrin solution: Use 50 mM phosphate buffer (pH 6.0) to prepare a maltodextrin solution with a concentration of 40 g·L -1 of maltodextrin solution;
[0102] Prepare a methyl orange solution: Use 50 mM phosphate buffer to prepare a methyl orange solution with a concentration of 0.5 mM methyl orange solution.
[0103] (3) After incubating the systems obtained in step (1) at 4 °C for 1 h respectively, add 50 μL of the maltodextrin solution prepared in step (2). After reacting at 40 °C for 10 min, immediately add 250 μL of hydrochloric acid (1.0 M) to terminate the reaction, then add 150 μL of the methyl orange solution prepared in step (2), and let it stand at room temperature for 20 min, and measure the absorbance at 505 nm.
[0104] Taking the enzyme activity measured in the 0% (v / v) DMSO group as the original activity, the residual activities and relative activities of the wild type WT and the mutant after incubation in 25% (v / v) DMSO are listed in Table 2.
[0105] Table 2 Comparison of residual activities and relative activities between wild type WT and mutant
[0106]
[0107] As can be seen from Table 2: After incubation at 4°C for 1 h in a 25% DMSO system and then measuring the activity, the residual activity of WT was 21.3%. Compared with WT, the DMSO tolerance of the four mutants was all improved to a certain extent. The single mutants R146F and G539I had a 6 - 7% increase in tolerance compared with WT after incubation in 25% DMSO for 1 h. The tolerance of the combined double mutant G539I / R146F increased, with a 10.5% increase compared with WT. The optimal triple mutant G539I / R146F / D147N had a 13.8% increase compared with WT under the same incubation conditions, which was 1.6 times that of WT. The mutant T599D / N600D / Y601H also had good tolerance in a 25% DMSO system, and the effect was similar to that of the optimal triple mutant G539I / R146F / D147N.
[0108] In addition, except for the mutant G539I, the relative activities of the other three mutants had not much impact on WT. When comparing with the mutant T599D / N600D / Y601H, although the DMSO resistance of this mutant was also greatly improved, its original activity decreased seriously. While the activity of the triple mutant G539I / R146F / D147N increased by 20% compared with WT. Therefore, the triple mutant G539I / R146F / D147N may have more advantages in practical applications.
[0109] 2. Detection of the organic solvent ethanol tolerance of cyclodextrin glucosyltransferase
[0110] The concentrations of ethanol were selected as 0% and 12% (v / v) respectively. The incubation time was controlled at 1 h, and the activity of the obtained pure enzyme was measured using the methyl orange method (the methyl orange method was appropriately improved for convenient detection).
[0111] The specific method is as follows:
[0112] (1) After diluting the pure enzyme solution prepared in Example 1 and the pure enzyme solution of the T599D / N600D / Y601H mutant to an enzyme activity of 0.01 - 0.02 mg / mL respectively, take 100 μL and add it to 100 μL of phosphate buffer (50 mM, pH 6.0) containing ethanol, where the volume fractions of ethanol in the phosphate buffer containing ethanol are 0% and 24% respectively;
[0113] (2) Prepare a maltodextrin solution: Use 50 mM phosphate buffer (pH 6.0) to prepare a maltodextrin solution with a concentration of 40 g·L -1 of maltodextrin solution;
[0114] Prepare a methyl orange solution: Use 50 mM phosphate buffer to prepare a methyl orange solution with a concentration of 0.5 mM methyl orange solution.
[0115] (3) After incubating the system obtained in step (1) at 4 °C for 1 h, add 50 μL of the maltodextrin solution prepared in step (2). After reacting at 40 °C for 10 min, immediately add 250 μL of hydrochloric acid (1.0 M) to terminate the reaction. Then add 150 μL of the methyl orange solution prepared in step (2), and let it stand at room temperature for 20 min. Measure the absorbance at 505 nm.
[0116] Taking the enzyme activity measured in the 0% (v / v) ethanol group as the original activity, the residual activities and relative activities of the wild-type WT and mutants measured after incubation in 12% (v / v) ethanol are listed in Table 3.
[0117] Table 3 Comparison of residual activities and relative activities between wild-type WT and mutants
[0118]
[0119] As can be seen from Table 3: After incubating at 4 °C for 1 h and then measuring the activity in a 12% ethanol system, the residual activity of WT is 17.9%. Compared with WT, the ethanol tolerance of the two single mutants has a relatively obvious improvement. The optimal single mutant R146F is 7.4% higher than WT and is 1.4 times that of WT. The ethanol tolerance of the single mutant G539I is 5.9% higher than that of WT. However, the tolerance of the two combined mutants in ethanol has no obvious improvement compared with WT. The tolerance of the mutant T599D / N600D / Y601H in 12% ethanol is similar to that of the above two combined mutants, and the effect is not obvious, which may also be related to the relatively large decrease in the original activity of this mutant. In addition, by comparing the data of DMSO, it is found that the enzyme has poor tolerance to ethanol.
[0120] In addition, in terms of enzyme activity, the relative activities of the four mutants in the present invention have no obvious decrease compared with WT, and the relative activities remain at 87-115%. The activity of the triple mutant G539I / R146F / D147N has increased compared with WT.
[0121] 3. Detection of the organic solvent methanol tolerance of cyclodextrin glucosyltransferase
[0122] Select the concentrations of methanol to be 0% and 12% (v / v) respectively. Control the incubation time at 1 h, and measure the activity of the obtained pure enzyme using the methyl orange method (the methyl orange method has been appropriately improved for convenient detection).
[0123] The specific method is as follows:
[0124] (1) After diluting the pure enzyme solution and the pure enzyme solution of the T599D / N600D / Y601H mutant prepared in Example 1 to an enzyme activity of 0.01 - 0.02 mg / mL respectively, take 100 μL and add it to 100 μL of phosphate buffer (50 mM, pH 6.0) containing methanol, where the volume fractions of methanol in the phosphate buffer containing methanol are 0% and 24% respectively;
[0125] (2) Prepare a maltodextrin solution: Use 50 mM phosphate buffer (pH 6.0) to prepare a maltodextrin solution with a concentration of 40 g·L -1 of maltodextrin solution;
[0126] Prepare a methyl orange solution: Use 50 mM phosphate buffer to prepare a methyl orange solution with a concentration of 0.5 mM methyl orange solution.
[0127] (3) After incubating the systems obtained in step (1) at 4 °C for 1 h respectively, add 50 μL of the maltodextrin solution prepared in step (2), react at 40 °C for 10 min, immediately add 250 μL of hydrochloric acid (1.0 M) to terminate the reaction, then add 150 μL of the methyl orange solution prepared in step (2), let it stand at room temperature for 20 min, and measure the absorbance at 505 nm.
[0128] Taking the enzyme activity measured in the 0% (v / v) methanol group as the original activity, the residual activities and relative activities of the wild-type WT and the mutant after incubation in 12% (v / v) methanol are listed in Table 4.
[0129] Table 4 Comparison of residual activities and relative activities between wild-type WT and mutant
[0130]
[0131] As can be seen from Table 4: After incubation at 4°C for 1 h in a 12% methanol system and then measuring the enzyme activity, the residual activity of WT was 27.4%. Compared with WT, the methanol tolerance of the single mutant R146F, double mutant G539I / R146F, and triple mutant G539I / R146F / D147N was improved significantly. Among them, the effect of the triple mutant was the best, which was nearly 1.7 times higher than that of WT, an increase of 18.9%. Followed by the single mutant R146F and double mutant G539I / R146F, which were increased by 12.7% and 11.3% respectively compared with WT. However, the methanol tolerance of the single mutant G539I was lower than that of WT. In addition, comparing the tolerance data of the single mutant R146F and double mutant G539I / R146F, after adding G539I, the methanol tolerance decreased. Therefore, the mutation R146F plays an important role in the methanol tolerance test. Comparing with the mutant T599D / N600D / Y601H, its tolerance in 12% methanol was improved by 6.9% compared with WT, but the effect was far less obvious than that of the optimal triple mutant G539I / R146F / D147N.
[0132] In terms of enzyme activity, the relative activities of the four mutants were not significantly lower than that of WT, and the relative activities remained at 89-113%. The activity of the triple mutant G539I / R146F / D147N was increased compared with WT.
[0133] 4. Detection of the organic solvent acetone tolerance of cyclodextrin glucosyltransferase
[0134] The concentrations of acetone were selected as 0% and 15% (v / v) respectively. The incubation time was controlled at 1 h, and the methyl orange method (appropriately improved for convenient detection) was used to measure the activity of the obtained pure enzyme.
[0135] The specific method is as follows:
[0136] (1) After diluting the pure enzyme solution prepared in Example 1 and the pure enzyme solution of the T599D / N600D / Y601H mutant to an enzyme activity of 0.01-0.02 mg / mL respectively, 100 μL was taken and added to 100 μL of phosphate buffer (50 mM, pH 6.0) containing acetone, where the volume fractions of acetone in the phosphate buffer were 0% and 30% respectively;
[0137] (2) Prepare a maltodextrin solution: Use 50 mM phosphate buffer (pH 6.0) to prepare a maltodextrin solution with a concentration of 40 g·L -1 of maltodextrin solution;
[0138] Prepare a methyl orange solution: Use 50 mM phosphate buffer to prepare a methyl orange solution with a concentration of 0.5 mM methyl orange solution.
[0139] (3) Incubate the system obtained in step (1) at 4 °C for 1 h, add 50 μL of the maltodextrin solution prepared in step (2), react at 40 °C for 10 min, immediately add 250 μL of hydrochloric acid (1.0 M) to terminate the reaction, then add 150 μL of the methyl orange solution prepared in step (2), let it stand at room temperature for 20 min, and measure the absorbance at 505 nm.
[0140] Taking the enzyme activity measured in the acetone group with 0% (v / v) as the original activity, the residual activities and relative activities of the wild-type WT and mutants measured after incubation in 15% (v / v) acetone are listed in Table 5.
[0141] Table 5 Comparison of residual activities and relative activities between wild-type WT and mutants
[0142]
[0143] As can be seen from Table 5: After incubation at 4 °C for 1 h in a 15% acetone system and then measuring the activity, the residual activity of WT is 22.3%. Compared with WT, the acetone tolerance of the four mutants has been improved. The best is the double mutant G539I / R146F, which is 12% higher than WT and 1.5 times that of WT. In addition, the acetone tolerance effects of the single mutant R146F and the triple mutant G539I / R146F / D147N are close, which are 7 - 8.4% higher than WT, while the acetone tolerance of the single mutants G539I and T599D / N600D / Y601H is not significantly improved compared with WT, only increased by about 4%.
[0144] In terms of enzyme activity, consistent with the previous results, the relative activities of the four mutants are not significantly lower than that of WT, and the relative activities remain at 87 - 117%. The activity of the triple mutant G539I / R146F / D147N is increased compared with WT.
[0145] Example 3: Glycosylation application of genistein
[0146] Taking genistein as an example, appropriately dilute the pure enzyme solutions of the mutants R146F, G539I, G539I / R146F, G539I / R146F / D147N and wild-type WT prepared in Example 1, as well as the pure enzyme solution of the mutant T599D / N600D / Y601H, and carry out glycosylation reactions using soluble starch as the glycosyl donor and genistein as the glycosyl acceptor respectively.
[0147] The specific steps are as follows:
[0148] (1) Prepare a soluble starch solution with a concentration of 40 g / L using phosphate buffer (pH 6.0, 50 mM).
[0149] (2) Dissolve genistein in DMSO solution to obtain a genistein solution with a concentration of 7.5 g / L.
[0150] (3) Mix according to the ratio of soluble starch solution: genistein solution: pure enzyme solution (v:v:v) = 6:2:2 (the enzyme addition amount is controlled at 0.15 - 0.2 U / mL), and heat to terminate the reaction after reacting in a shaker at 40 °C for 16 - 18 h.
[0151] After centrifuging and filtering the sample, perform high - performance liquid chromatography (HPLC) analysis. The specific results are shown in Table 6.
[0152] Table 6 Comparison of glycosylation efficiency of wild - type WT and each mutant to genistein
[0153]
[0154] It can be seen from the above table that the glycosylation efficiency of the four mutants in the present invention to genistein has a certain improvement compared with WT. Among them, the best is the triple - mutant G539I / R146F / D147N, and the conversion rate is increased by 16% compared with WT. The single - mutants R146F and G539I, and the double - mutant G539I / R146F are increased by 12%, 9% and 13% respectively compared with WT. Although the tolerance of the mutant T599D / N600D / Y601H in DMSO has also been greatly improved, it may be due to a large decrease in its enzyme activity, and its performance in the conversion rate is not obvious, being about the same as WT without obvious improvement.
[0155] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.
Claims
1. A cyclodextrin glucosyltransferase mutant, characterized in that, the mutant is obtained by mutating the glycine at position 539 of cyclodextrin glucosyltransferase with the amino acid sequence shown in SEQ ID NO.1 into isoleucine; or by mutating the glycine at position 539 of cyclodextrin glucosyltransferase with the amino acid sequence shown in SEQ ID NO.1 into isoleucine, and simultaneously mutating the arginine at position 146 into phenylalanine; or by mutating the glycine at position 539 of cyclodextrin glucosyltransferase with the amino acid sequence shown in SEQ ID NO.1 into isoleucine; simultaneously mutating the arginine at position 146 into phenylalanine; and simultaneously mutating the aspartic acid at position 147 into asparagine.
2. A gene encoding the mutant according to claim 1.
3. A recombinant vector carrying the gene according to claim 2.
4. The recombinant vector according to claim 3, characterized in that, the pET series vector, pUT series vector or pBAD series vector is used as the expression vector.
5. A recombinant cell expressing the mutant according to claim 1, or carrying the gene according to claim 2, or carrying the recombinant vector according to claim 3 or 4.
6. The recombinant cell according to claim 5, characterized in that, the recombinant cell uses bacteria or fungi as host cells.
7. A method for improving the tolerance of cyclodextrin glucosyltransferase to organic solvents, characterized in that, the method is to mutate the glycine at position 539 of cyclodextrin glucosyltransferase with the amino acid sequence shown in SEQ ID NO.1 into isoleucine; or to mutate the glycine at position 539 of cyclodextrin glucosyltransferase with the amino acid sequence shown in SEQ ID NO.1 into isoleucine, and simultaneously mutate the arginine at position 146 into phenylalanine; or to mutate the glycine at position 539 of cyclodextrin glucosyltransferase with the amino acid sequence shown in SEQ ID NO.1 into isoleucine; simultaneously mutate the arginine at position 146 into phenylalanine; and simultaneously mutate the aspartic acid at position 147 into asparagine, and the organic solvents include one or more of dimethyl sulfoxide, ethanol, methanol and acetone.
8. A method for producing long-chain glycosylated genistein, characterized in that, the method is to add the cyclodextrin glucosyltransferase mutant according to claim 1 to a reaction system containing soluble starch and genistein for reaction to obtain a reaction solution; and separate the reaction solution to obtain long-chain glycosylated genistein.
9. The mutant according to claim 1, or the gene according to claim 2, or the recombinant vector according to claim 3 or 4, or the recombinant cell according to claim 5 or 6, in the glycosylation application of genistein, or in the glycosylation application in an organic solvent reaction system, characterized in that, the organic solvents include one or more of dimethyl sulfoxide, ethanol, methanol and acetone.
Citation Information
Patent Citations
Alpha-cyclodextrin glucosyltransferase gene and application thereof
CN103789329A
Cyclodextrin glucosyltransferase (CGTase) with improved organic solvent tolerance and preparation method of cyclodextrin glucosyltransferase
CN113817704A