A method for bacterial in vivo targeting of protein acylation modification

Abstract

The application discloses a method for in-vivo acylation modification of a target protein of bacteria, and comprises the following steps: in a CRISPR system, an acyltransferase-dCas12a fusion protein gene and a crRNA gene are constructed on a plasmid, and are transferred into bacteria, and through bacterial growth and proliferation, acylation modification of the target protein is completed. The method of the application widens the application range of the CRISPR technology, and realizes acylation modification of the target protein.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and relates to a method for targeted protein acylation modification in bacteria, and specifically to a method for targeted protein acylation modification in bacteria based on CRISPR. Background Art

[0002] Dynamic covalent post-translational modifications of proteins include phosphorylation, acylation, and methylation. Together with transcriptional and translational regulation, these modifications form a multi-layered metabolic regulatory network within organisms, enabling precise regulation of various physiological and metabolic activities to cope with a changing external environment. Among these, protein lysine acetylation (PLA) is a crucial and widespread post-translational modification of proteins. It is highly conserved across all three kingdoms of life and regulates a variety of important physiological and metabolic activities in organisms.

[0003] To understand the mysteries of acetylation, researchers have developed a variety of approaches, including interference with global acetylation levels (e.g., knockout or overexpression of acetylases or deacetylases), mimicking mutations at key acetylation sites, and inserting acetyl-lysine at key acetylation sites (Carabetta VJ, Cristea IM. 2017. J Bacteriol. doi: 10.1128 / JB.00107-17.). However, existing technologies are unable to target the proteome in situ within cells to explore the functional changes of specific proteins and their association with phenotypes, which greatly limits our understanding of the physiological functions of many acetylation sites. In recent years, with the rapid development of CRISPR technology, people have taken advantage of its ability to target nucleic acids and gradually achieved targeted modification of DNA, RNA, and histones through protein fusion technology (Vojta A, et al. 2016. Nucleic Acids Res. 44: 5615-28. Liu XM, et al. 2019. Nat Chem Biol. 15: 865-871. Hilton IB, et al. 2015. Nat Biotechnol. 33: 510-7.). Summary of the Invention

[0004] Inspired by the progress in CRISPR application technology, the inventors envisioned that, given that transcription and translation in prokaryotes are coupled, acetylases could be fused with Cas proteins for expression, and the acetylases could be locally enriched near the target protein gene under the mediation of crRNA, thereby performing targeted acetylation modification on the translated protein. Combined with phenotypic analysis, proteins that are regulated by acetylation modification and have important physiological significance can be quickly identified. Based on the inventive concept, the inventors selected four prokaryotic acetylases according to the literature, namely Pat from Salmonella enterica (97.7 kDa, NCBI accession number WP_000082639.1), YfiQ from Escherichia coli (97.7 kDa, NCBI accession number WP_000083005.1), AcuA from Bacillus subtilis (24.3 kDa, NCBI accession number WP_003229296.1), and At2 from Clostridium ljungdahlii (17.6 kDa, NCBI accession number ADK13966.1) (Starai VJ, Escalante-Semerena JC. 2004. J Mol Biol. 340: 1005-12. Liang W, et al. 2011. Mol Cell. 44: 160-6. Gardner JG, et al. 2012. Mol Cell. 44: 161-166. al.2006.J Bacteriol.188:5460-8. Zhang L, et al.2020.Mbio.11.). The four acetylases were purified and their catalytic abilities were compared by acetylation modification of the target protein Pta (phosphotransacetylase), confirming the feasibility of the present invention and achieving the expected results.

[0005] Therefore, the first aspect of the present invention is to provide a protein post-translational modification technology in an organism, that is, a method for targeted protein acylation modification in bacteria, comprising the following steps: in the CRISPR system, an acyltransferase as an acylation modification effector element is fused with dCas12a as a targeting element. The coding gene of the acyltransferase-dCas12a fusion protein and the crRNA coding gene are respectively constructed on a plasmid and transferred into bacteria, and the acylation modification of the targeted protein is completed by bacterial growth and proliferation.

[0006] The above method realizes the integration of the acylation modification effector element and the CRISPR targeting element dCas12a, which is conducive to the simplification of the construction of the CRISPR system and facilitates the rapid implementation of targeted acylation modification at the bacterial proteome level.

[0007] Wherein, acyltransferase-dCas12a fusion protein gene and crRNA encoding gene can be constructed on different plasmids respectively, or can be constructed on the same plasmid.Preferably, the above-mentioned acylase-dCas12a fusion protein gene and the crRNA gene are constructed on the same plasmid.

[0008] The acyltransferase (or acylase) may be an acetyltransferase (or acetylase) or a propionyltransferase (or propionylase).

[0009] In one embodiment, the acyltransferase (or acylase) is selected from the following group: Pat from Salmonella enterica (97.7 kDa, NCBI accession number WP_000082639.1), YfiQ from Escherichia coli (97.7 kDa, NCBI accession number WP_000083005.1), AcuA from Bacillus subtilis (24.3 kDa, NCBI accession number WP_003229296.1), At2 from Clostridium ljungdahlii (17.6 kDa, NCBI accession number ADK13966.1), described in Starai VJ, Escalante-Semerena JC. 2004. J Mol Biol. 340: 1005-12. Liang W, et al. 2011. Mol Cell. 44: 160-6. Gardner et al. 2011. Mol Cell. 44: 160-6. This has been reported in JG, et al. 2006. J Bacteriol. 188: 5460-8. Zhang L, et al. 2020. Mbio. 11.

[0010] The above-mentioned acyltransferase-dCas12a fusion protein includes: an acyltransferase, dCas12a, and a linker connecting the two, wherein the linker is selected from the group consisting of linker L1 having an amino acid sequence of GGGS (SEQ ID NO: 1), linker L2 having an amino acid sequence of GSGEAAAK (SEQ ID NO: 2), linker L3 having an amino acid sequence of GSGEAAAKEAAAK (SEQ ID NO: 3), linker L4 having an amino acid sequence of GSGEAAAKEAAAKEAAAK (SEQ ID NO: 4), and linker L2 having an amino acid sequence of GSGEAAAK (SEQ ID NO: 2).

[0011] In terms of the properties of the linkers, the four protein linkers can be divided into short-chain flexible linker L1 (GGGS), short-chain rigid linker L2 (GSGEAAAK), medium-chain rigid linker L3 (GSG(EAAAK)2) and long-chain rigid linker L4 (GSG(EAAAK)3).

[0012] As for the structure of the acyltransferase-dCas12a fusion protein, that is, the order of the C-terminus and N-terminus of the two main proteins, it can be determined by comparing the acyltransferase activity in the specific fusion protein and the ability of dCas12a to bind to the target gene. For example, for a fusion protein composed of At2, dCas12a, and L2, by comparing the ability of At2 to acetylate Pta protein and the ability of dCas12a to bind to the target gene, it was determined that At2 is at the N-terminus and dCas12a is at the C-terminus, that is, dCas12a-L2-At2.

[0013] The above-mentioned dCas12a is a CRISPR-related nuclease dCas12a derived from Francisella tularensis, and its amino acid sequence is SEQ ID NO: 5, which is an E1006A mutant of the Cas12a protein derived from Francisella tularensis. The dCas12a still retains DNA binding activity, but does not have the activity of cutting DNA.

[0014] In one embodiment, the acylation is acetylation, which can be catalyzed by At2 with acetyl-CoA as the acetyl donor.

[0015] In one embodiment, the acylation is propionylation, which can be catalyzed by YfiQ with propionyl-CoA as the propionyl donor.

[0016] The above-mentioned bacteria may be Gram-negative bacteria, such as Escherichia coli.

[0017] A second aspect of the present invention provides a kit for implementing the above-mentioned bacterial in vivo targeted protein acylation modification method, which includes a plasmid cloned with the above-mentioned acyltransferase-dCas12a fusion protein gene and crRNA encoding gene used in the above-mentioned bacterial in vivo targeted protein acylation modification method.

[0018] The CRISPR / Cas system comprising the plasmid of the above-mentioned acyltransferase-dCas12a fusion protein gene and crRNA encoding gene can be referred to as a targeted acylation system TPA (Targeted protein acylation system). When acylation is acetylation, TPA refers to a targeted acetylation system, or a targeted acetylation (modification) tool.

[0019] Therefore, the above-mentioned kit of the present invention is essentially a targeted acylation system kit, which mainly comprises a plasmid of an acyltransferase-dCas12a fusion protein gene and a crRNA encoding gene.

[0020] Obviously, the kit of the present invention can be used to achieve acylation, especially acetylation, of targeted proteins in bacteria, thereby precisely regulating the transcription and expression of specific genes in bacteria, regulating protein activity, and bacterial physiological processes.

[0021] Experiments have shown that compared with isolated acyltransferases and dCas12a proteins, the expression of acyltransferase-dCas12a fusion proteins can achieve efficient acylation modification of targeted proteins. The targeted acylation modification system TPA of the present invention is efficient and versatile, helps to quickly identify proteins that are regulated by acylation modification and have important physiological significance, and can directly target bacterial genomes to acylate target proteins, broadening the application range of CRISPR technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The immunoblot photos of the acetylation modification reaction of the target protein Pta (phosphotransacetylase) catalyzed by four acetylases Pat, YfiQ, AcuA and At2 are shown. In the figure, Kac is the characterization of the degree of acetylation modification of Pta (using acetylation antibodies to perform western blot analysis on the modified Pta protein), and Control is the characterization of the amount of substrate Pta protein (after SDS-PAGE electrophoresis separation of the modified Pta protein, use Coomassie Brilliant Blue staining). The catalytic ability of the four alternative acetylases is compared by the ratio of the acetylation western blot quantitative value Kac of the acetylation reaction product to the protein quantitative Control (Kac / control).

[0023] Figure 2 The structure of At2-dCas12a fusion proteins using different protein linkers (L1, L2, L3, L4) and immunoblot photos of the catalytic target protein Pta (phosphotransacetylase) reaction are shown. The left figure is a schematic diagram of the structure of the At2-dCas12a fusion protein, and the right figure is a comparison of the enzymatic activity of the acetylation reaction catalyzed by the fusion proteins using different linkers relative to At2.

[0024] Figure 3Shown are the structures of two At2-dCas12a fusion proteins, dCas12a-L2-At2 and At2-L2-dCas12a, and immunoblot photos of the catalytic target protein Pta (phosphotransacetylase) reaction. The left figure shows the schematic structure of dCas12a-L2-At2 and At2-L2-dCas12a, and the right figure shows the comparison of the enzymatic activity of the acetylation reaction catalyzed by the two fusion proteins relative to At2.

[0025] Figure 4 The dual-plasmid CRISPR system was used to detect the transcriptional inhibition of the acetyl-CoA synthase gene acs and the RNaseII gene rnb by At2-dCas12a (no crRNA), At2-dCas12a-crRNA, and dCas12a-crRNA, respectively. The upper left figure is a schematic diagram of the crRNA targeting gene acs, and the upper right figure is a schematic diagram of the crRNA targeting gene rnb, where RBS is the ribosome binding site. The lower left figure shows a bar graph of the transcriptional inhibition of the target gene acs by At2-dCas12a (no crRNA), At2-dCas12a-crRNA, and dCas12a-crRNA, respectively. The lower right figure shows a bar graph of the transcriptional inhibition of the target gene rnb by At2-dCas12a (no crRNA), At2-dCas12a-crRNA, and dCas12a-crRNA, respectively. The ordinate is the relative expression level of the target gene. ***, P < 0.001, **, P < 0.01.

[0026] Figure 5 This figure shows the use of a dual-plasmid CRISPR system to detect the acetylation of the protein Acs by targeting the template strand (TS) and non-template strand (NTS) of the acetyl-CoA synthase gene acs using the plasmid At2-dCas12a (no crRNA) and At2-dCas12a-crRNA, respectively. The top figure is a schematic diagram of the template strand (TS) and non-template strand (NTS) of the plasmid targeting the gene acs. The bottom figure is a photograph of an immunoblot.

[0027] Figure 6The figure shows the acetylation modification of proteins Acs and RNase II by targeting the acetyl-CoA synthase gene acs and RNase II gene rnb of the Escherichia coli genome using plasmids At2-dCas12a (no crRNA), dCas12a-crRNA, and At2-dCas12a-crRNA, respectively. The upper left figure is a schematic diagram of the non-template strand (NTS) of the plasmid targeting gene acs; the lower left figure is a photograph of an immunoblot. The upper right figure is a schematic diagram of the non-template strand (NTS) of the plasmid targeting gene rnb; the lower right figure is a photograph of an immunoblot.

[0028] Figure 7 The phenotypes and relative expression levels of Acs in E. coli after treatment with the Acs-targeting plasmids dCas12a-crRNA, At2-dCas12a (no crRNA), and At2-dCas12a-crRNA are shown. The left figure is a growth curve with bacterial concentration on the ordinate and incubation time on the abscissa; the right figure is a bar graph of relative Acs expression levels. ns, not significant.

[0029] Figure 8 The phenotypes and relative RNase II expression levels of Escherichia coli treated with dCas12a-crRNA, At2-dCas12a (no crRNA), and At2-dCas12a-crRNA targeting RNase II are shown. The left figure is a growth curve with bacterial concentration on the ordinate and incubation time on the abscissa; the right figure is a bar graph of RNase II relative expression levels. ns, not significant.

[0030] Figure 9 The SDS gel electrophoresis photos of the whole protein acetylation modification levels of the test strains are shown after the plasmids At2-dCas12a (no crRNA), dCas12a-crRNA, and At2-dCas12a-crRNA are used to target the acetyl-CoA synthase gene acs of the Escherichia coli genome to acetylate the protein Acs. In the figure, Kac is the result of western blot analysis of the whole protein acetylation level using an acetylation antibody, and Control is the result of quantitative analysis of the whole protein using Coomassie brilliant blue staining.

[0031] Figure 10Shown are immunoblot photos of targeted propionylation tests of Acs protein using a two-plasmid system containing a negative control plasmid YfiQ-dCas12a (no crRNA) and a two-plasmid system containing a fusion protein plasmid YfiQ-dCas12a-crRNA. In the figure, KPr is a characterization of the degree of propionylation modification of the target protein Acs (Western blot analysis of Acs protein using a propionylation antibody), and Control is a quantitative characterization of Acs protein (the Acs protein in the incubation system is separated by SDS-PAGE electrophoresis, and then the Acs protein is stained and quantitatively analyzed by staining). DETAILED DESCRIPTION

[0032] In order to explore the rapid identification of proteins regulated by acetylation based on CRISPR technology, the inventors conceived a method for expressing acyltransferase-dCas12a fusion proteins. Four acetylases reported in the literature, Pat, YfiQ, AcuA, and At2, were purified, and the catalytic ability of the target protein Pta (phosphotransacetylase) was compared for acetylation modification. By measuring the catalytic ability and protein size, At2 from Clostridium jundal was selected as the acetylation modification effector element, and dCas12a from Francisella tularensis was selected as the targeting element. To determine the method of protein fusion, the inventors selected four protein linkers, namely the short-chain flexible linker L1 (GGGS), the short-chain rigid linker L2 (GSGEAAAK), the medium-chain rigid linker L3 (GSG(EAAAK)2), and the long-chain rigid linker L4 (GSG(EAAAK)3). By comparing the At2 enzyme activity after protein fusion and the ability of dCas12a to bind to the target gene after protein fusion, it was determined that the optimal method of protein fusion is to use linker L2, with At2 at the N-terminus and dCas12a at the C-terminus.

[0033] The present invention unexpectedly found that after At2 was fused with dCas12a through linker L2, the activity of the acetylase modification enzyme increased instead of decreased, and was higher than that of the isolated acetylase At2.

[0034] The inventors used a dual-plasmid system to validate the feasibility of targeted acetylation modification. The crRNAs were targeted to the template strand (TS) and non-template strand (NTS) of the target protein Acs (acetyl-CoA synthase). The results showed that the targeted acetylation system TPA can achieve targeted acetylation modification of the target protein in Escherichia coli, and that targeting the template strand or non-template strand had little effect on the modification effect.

[0035] The inventors also tested the TPA system's ability to directly target the genome and modify target proteins. The target genes, acs, an acetyl-CoA synthase gene, and rnb, an RNase II gene, were selected. The results demonstrated that the TPA system could achieve targeted acetylation of the target proteins and result in significant differences in growth phenotypes. Furthermore, analysis of global protein acetylation levels revealed that the TPA system did not cause significant changes in global protein acetylation levels, demonstrating good specificity.

[0036] Next, the versatility of the TPA system was tested. By modularly replacing the acetylation response element, the acetylase At2 was replaced with the propionylation-catalyzing YfiQ. The effectiveness of targeted propionylation of TPP was confirmed in E. coli using a two-plasmid system. Through these studies, we confirmed the effectiveness and versatility of the TPA targeted acetylation modification system.

[0037] The above-mentioned CRISPR technology includes but is not limited to the CRISPR-Cas12a prokaryotic immune system, and is also applicable to other CRISPR / Cas systems.

[0038] For ease of description, the names of proteins, such as At2, and their encoding genes (DNA) are sometimes used interchangeably herein. Those skilled in the art will understand that these refer to different substances in different contexts. Those skilled in the art will readily understand their meanings based on the context. For example, when describing the function or class of an acyltransferase, At2 refers to the protein; when describing a gene, it refers to the gene encoding the acyltransferase At2.

[0039] Similarly, for ease of description, RNA, such as crRNA, is sometimes used interchangeably with the names of its encoding genes. Those skilled in the art will understand that they represent different substances in different descriptions. Those skilled in the art will readily understand their meanings based on the context.

[0040] It is understood that for the coding gene of acyltransferase-dCas12a fusion protein such as dCas12a-L2-At2, those skilled in the art can perform codon optimization according to the specific species of bacteria to be treated, such as Escherichia coli. The purpose of codon optimization is to enable these polypeptides to achieve optimal expression in the cells to be treated. Codon optimization is a technique that can be used to maximize protein expression in organisms by increasing the translation efficiency of genes of interest. Different organisms generally show a special preference for one of some codons encoding the same amino acid due to mutation propensity and natural selection. For example, in fast-growing microorganisms such as Escherichia coli, the optimized codon reflects the composition of its respective genomic tRNA library. Therefore, in fast-growing microorganisms, low-frequency codons of amino acids can be used for codon replacement of the same amino acid but with high frequency. Therefore, the expression of the optimized DNA sequence is improved in fast-growing microorganisms.

[0041] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended for illustrative purposes only and are not intended to limit the present invention. In addition, it should be understood that after reading the concept of the present invention, various changes or adjustments made by those skilled in the art should fall within the scope of protection of the present invention, and these equivalent forms also fall within the scope defined in the appended claims.

[0042] Example

[0043] The examples involve the addition amounts, contents and concentrations of various substances, wherein the percentages mentioned are by mass unless otherwise specified.

[0044] In the examples, if no specific description is given for the reaction temperature or the operating temperature, the temperature generally refers to room temperature (15-30° C.).

[0045] Materials and methods

[0046] The primer synthesis, gene synthesis, and nucleic acid sequencing in the examples were all commissioned to Nanjing GenScript Biotechnology Co., Ltd.

[0047] The molecular biology experiments in the examples, including plasmid construction, enzyme digestion, ligation, competent cell preparation, transformation, culture medium preparation, etc., were performed primarily with reference to Molecular Cloning: A Laboratory Manual (3rd edition), edited by J. Sambrook and D.W. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. Specific experimental conditions can be determined by simple experiments when necessary.

[0048] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. These conditions can be adjusted through simple experiments if necessary.

[0049] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2, sterilized at 121°C for 20 min.

[0050] Example 1: Design of targeted acetylation TPA system and screening of acetylation response elements

[0051] 1.1 The principle of the targeted acetylation modification tool was designed by taking advantage of the characteristics of prokaryotic transcription-translation coupling. The working principle of the targeted acetylation tool TPA system is to fuse the effector element acetylase with the targeting element dCas12a protein for expression. Under the guidance of the corresponding crRNA, it targets the target protein gene and takes advantage of the characteristics of prokaryotic transcription-translation coupling to achieve targeted acetylation modification of the target protein. The protein acetylation modification is catalyzed by the acetylase reaction.

[0052] 1.2 Through literature research, four representative prokaryotic acetylases were selected, namely Pat from Salmonella enterica (97.7 kDa, NCBI accession number WP_000082639.1), YfiQ from Escherichia coli (97.7 kDa, NCBI accession number WP_000083005.1), AcuA from Bacillus subtilis (24.3 kDa, NCBI accession number WP_003229296.1), and At2 from Clostridium ljungdahlii (17.6 kDa, NCBI accession number ADK13966.1).

[0053] 1.3 Using the genomic DNA of the four bacteria as templates, the coding genes of the four acetylases Pat, YfiQ, AcuA and At2 were obtained by PCR amplification and constructed into the pET-28a expression vector respectively. The constructed plasmids were introduced into BL21(DE3) Escherichia coli for heterologous expression. The expressed proteins with 6×His tags were purified using Ni-NAT to obtain the four acetylases Pat, YfiQ, AcuA and At2.

[0054] 1.4 Comparison of catalytic ability of acetyltransferases. Pta (phosphotransacetylase) from Clostridium ljungdahlii, which has been reported to be catalytically modified by acetyltransferases, was selected as the target protein. The four purified acetyltransferases of equal substances were incubated with them, and the level of acetylation modification of Pta protein was analyzed by western blot. The specific operation method is as follows: the incubation system is divided into two parts, one part is subjected to SDS-PAGE gel electrophoresis and then stained with Coomassie Brilliant Blue for protein quantitative analysis. The software used is ImageJ, and the specific value is used as Control; the other part is analyzed by western blot using acetylation antibodies (PTMBIO, PTM-105RM), and the immunoblot bands are quantitatively analyzed using ImageJ software. The specific value is used as Kac; the degree of acetylation modification of Pta protein is measured by the ratio of Kac / Control, and the catalytic ability of acetyltransferase is then compared.

[0055] The catalytic ability comparison of the four acetylases is shown in Figure 2. Figure 1 As shown. Figure 1 It can be seen that the Kac scanning concentration value (using acetylation antibody to perform western blot analysis of the acetylation degree of Pta) of the acetylase Pat (the bands were quantified using ImageJ software) was 2.96, and the Kac / Control ratio was 2.58 (Control is the quantitative value of the test-stained band, representing the protein amount); the Kac scanning concentration value of the acetylase At2 was 2.76, and the Kac / Control ratio was 2.55, both slightly lower than Pat, but higher than YfiQ and AcuA.

[0056] 1.5 Taking into account the catalytic ability and small molecular weight of At2, it was finally chosen as the effector element for acetylation modification.

[0057] The targeting element selected was the CRISPR-associated nuclease dCas12a from Francisella tularensis.

[0058] Example 2: Optimization of protein fusion method in TPA system

[0059] 2.1 After research and analysis, four protein linkers were selected, namely the short-chain flexible linker L1 (GGGS), the short-chain rigid linker L2 (GSGEAAAK), the medium-chain rigid linker L3 (GSG(EAAAK)2), and the long-chain rigid linker L4 (GSG(EAAAK)3), to explore the effect of protein fusion using different linkers on At2 enzyme activity.

[0060] Prepare the At2-dCas12a fusion protein according to the method in step 1.3. The enzyme activity assay method for the acetylation reaction of protein Pta catalyzed by the fusion protein is shown in step 1.4.

[0061] See also Figure 2 The left figure shows the schematic structure of the At2-dCas12a fusion protein, with At2 at the N-terminus and dCas12a at the C-terminus, connected by a linker. The right figure compares the enzymatic activity of fusion proteins catalyzed by different protein linkers (L1, L2, L3, and L4) relative to At2 in acetylation reactions, demonstrating the applicability of different linkers.

[0062] Depend on Figure 2 The results show that relative to the acetylase At2 (Kac scanning concentration value set to 1.00, Kac / Control ratio set to 1.00), the Kac scanning concentration value of the L2-linked fusion protein dCas12a-L2-At2 is 2.02, and the Kac / Control ratio is 2.01, which are higher than L1, L3 and L4. The results show that linker L2 is the best.

[0063] 2.2 While keeping the linker L2 unchanged, we explored the effect of the relative position of dCas12a and At2 on the functional integrity of At2 after protein fusion.

[0064] Two fusion proteins, dCas12a-L2-At2 and At2-L2-dCas12a, were prepared according to the method in step 1.3.

[0065] The enzymatic activities of the two fusion proteins in catalyzing the acetylation reaction of protein Pta were determined according to the method in step 1.4.

[0066] See also Figure 3 Relative to the acetylase At2 (Kac scanning concentration value set to 1.00, Kac / Control ratio set to 1.00), the Kac scanning concentration value of the fusion protein dCas12a-L2-At2 was 4.09, and the Kac / Control ratio was 4.11; the Kac scanning concentration value of the fusion protein At2-L2-dCas12a was 3.18, and the Kac / Control ratio was 3.57.

[0067] The results show that the relative position of the fusion of dCas12a and At2 proteins has no significant effect on the catalytic ability of At2, but the fusion protein structure of dCas12a-L2-At2 is relatively better than the At2-L2-dCas12a structure. Moreover, the Kac scanning concentration values ​​and Kac / Control ratios of these two fusion proteins are higher than those of the isolated acetylase At2, indicating that the fusion of At2 and dCas12a enhances the acetylase activity of At2.

[0068] 2.3 Functional integrity test of dCas12a in fusion protein. CrRNAs were designed for the promoter regions of the Escherichia coli acetyl-CoA synthase gene acs and the RNaseII gene rnb, respectively, to test the transcriptional inhibition effect of the fusion protein on acs and rnb. The crRNAs targeted the template strand (TS) of the target protein Acs (acetyl-CoA synthase). The specific operation method is as follows:

[0069] (1) Using pACYC-Duet1 as the starting plasmid, double enzyme digestion was performed with NdeI / XhoI to obtain a linearized plasmid.

[0070] (2) Using the genome of Clostridium jundal as a template, PCR amplification was performed to obtain the at2 fragment. The primer sequences were:

[0071] Forward primer: agtataagaaggagatatacatatgatgataagaagaggaaatataaaagatc,

[0072] Reverse primer: gctcattttggcagcggcttcaccggagccttttttaatttcatacattagataatgcg.

[0073] Using the pUC57-dCas12a plasmid (commissioned by Jinsrui Company for synthesis) as a template, PCR amplification was performed to obtain the dCas12a fragment. The primer sequences used were:

[0074] Forward primer: aattaaaaaaggctccggtgaagccgctgccaaaatgagcatctatcaggagttcg,

[0075] Reverse primer: cagcggtttctttaccagactcgagttagttgttacggttttgaacgaattc.

[0076] The At2-L2-dCas12 fragment was obtained by overlapping PCR. The primer sequences used were:

[0077] Forward primer: agtataagaaggagatatacatatgatgataagaagaggaaatataaaagatc,

[0078] Reverse primer: cagcggtttctttaccagactcgagttagttgttacggttttgaacgaattc.

[0079] (3) Using the ClonExpress II one-step cloning kit (Vazyme Biotech Co., Ltd., Nanjing, China), the At2-L2-dCas12a fragment obtained by the above PCR was ligated with the above linearized plasmid by the large fragment assembly method, and then the plasmid was introduced into the competent Escherichia coli DH5α by heat shock at 42°C for 90s. The plasmid was then cultured at 37°C on an LB agar plate containing chloramphenicol (concentration 12.5 μg / ml). After the transformants grew, colony PCR was performed, and the positive clones were picked for plasmid sequencing. The plasmid with correct sequencing was the control plasmid without crRNA. Finally, the control plasmid was transferred into the competent Escherichia coli BW25113 by heat shock to obtain the control strain At2-dCas12a (without crRNA).

[0080] The construction methods of other plasmids are similar to those described above. Only the corresponding primers need to be replaced. In addition, the restriction enzyme sites used in the construction of different crRNAs are NcoI / BamHI.

[0081] The experimental results of the dCas12a functional integrity test in the fusion protein can be found in Figure 4 The left figure shows the transcriptional inhibition of acetyl-CoA synthase gene acs by At2-dCas12a (no crRNA) plasmid, At2-dCas12a-crRNA plasmid, and dCas12a-crRNA plasmid, respectively. Compared with the negative control At2-dCas12a (no crRNA), both At2-dCas12a-crRNA and dCas12a-crRNA can significantly inhibit the transcription of acs, and the transcriptional inhibition efficiency of At2-dCas12a-crRNA and dCas12a-crRNA for gene acs is similar.

[0082] The right figure shows the transcriptional inhibition of RNaseII gene rnb by At2-dCas12a (no crRNA) plasmid, At2-dCas12a-crRNA plasmid, and dCas12a-crRNA plasmid, respectively. Compared with the negative control At2-dCas12a (no crRNA), both At2-dCas12a-crRNA and dCas12a-crRNA can inhibit the transcription of acs, and the transcriptional inhibition efficiency of At2-dCas12a-crRNA for gene acs is higher than that of dCas12a-crRNA, which seems to suggest that the fusion protein dCas12a-L2-At2 has a higher inhibitory effect on gene rnb than dCas12a alone.

[0083] The results showed that when using Linker L2 as the protein linker, At2 at the N-terminus of the fusion protein, and dCas12a at the C-terminus, dCas12a still has the complete ability to bind to the target gene.

[0084] Example 3: Functional Verification and Specificity of the TPA System in Gram-negative Bacteria

[0085] 3.1 The dual-plasmid system was used to verify the TPA system's ability to target acetylation modification in E. coli. The functions of the dual plasmids are as follows: one plasmid contains the At2-dCas12a fusion protein and the corresponding crRNA; the other plasmid is responsible for expressing the protein to be targeted for modification. To facilitate detection, a 6×His tag was added to its N-terminus. The target protein was E. coli's own Acs (acetyl-CoA synthase). At the same time, in order to test the effect of targeting the template chain (TS) or non-template chain (NTS) on the effect of targeted acetylation modification, we designed a crRNA for the TS chain and NTS chain at the tail of the Acs protein gene.

[0086] For the construction of the dual-plasmid CRISPR system, refer to step 2.3.

[0087] The plasmid At2-dCas12a (without crRNA) or At2-dCas12a-crRNA with the targeted modification system and the plasmid expressing the target protein gene acs were introduced into Escherichia coli, and the target protein Acs was purified and its acetylation modification level was detected by western blot.

[0088] The experimental results can be found in Figure 5, relative to At2-dCas12a (no crRNA) (Acs-Kac scanning concentration value set to 1.00, Kac / Control ratio set to 1.00), the Kac scanning concentration value of At2-dCas12a-crRNA for the non-template strand (NTS) of the targeted modified protein expression plasmid is 2.51, and the Kac / Control ratio is 2.54;

[0089] The Kac scanning concentration value of At2-dCas12a-crRNA for the template strand (TS) was 2.72, and the Kac / Control ratio was 3.04.

[0090] The results showed that the TPA system achieved targeted acetylation modification of Acs protein. In addition, crRNA targeting the TS chain or NTS chain had no significant effect on the targeted acetylation modification ability of the TPA system.

[0091] 3.2 Directly targeting the E. coli genome to achieve protein-directed acetylation modification. We selected E. coli acetyl-CoA (Acs) and RNase II, which have been previously reported to be regulated by acetylation, as test targets (You D, et al. 2014. J Bacteriol. 196:3169-78. Song L, et al. 2016. Nucleic Acids Research. 44:1979-1988.) and tested the system by directly targeting the E. coli genome.

[0092] For experimental methods, see step 3.1.

[0093] Prior to this, CRISPR / Cas9 technology was used to knock in 6×His tags at the tails of the acs and rnb genes, respectively; subsequently, targeted acetylation modification elements were introduced through plasmids to consider changes in the acetylation modification levels of the target proteins.

[0094] The experimental results can be found in Figures 6 to 8 , Figure 6The middle left picture shows that the TPA system acts directly on the acs gene on the genome to achieve targeted acetylation modification of the Acs protein. Relative to At2-dCas12a (no crRNA) (Acs-His scanning concentration value is set to 1.00, Acs-Kac scanning concentration value is set to 1.00, Kac / His ratio is set to 1.00), At2-dCas12a-crRNA for the non-template chain (NTS) of the Escherichia coli genome has an Acs-Kac scanning concentration value of 1.95 and a Kac / His ratio of 2.87; the Acs-Kac scanning concentration value of dCas12a-crRNA for the non-template chain (NTS) of the Escherichia coli genome is 0.56, and the Kac / His ratio is 1.02, that is, the results of the targeting element dCas12a are comparable to those of At2-dCas12a (no crRNA), while the acetylation modification level of acetyl-CoA (Acs) by At2-dCas12a-crRNA of the fusion protein + targeting element crRNA is significantly improved.

[0095] Figure 6 The middle right picture shows that the TPA system acts directly on the rnb gene on the genome to achieve targeted acetylation modification of RNase II protein. Relative to At2-dCas12a (no crRNA) (RNase II-His scanning concentration value is set to 1.00, RNase II-Kac scanning concentration value is set to 1.00, Kac / His ratio is set to 1.00), At2-dCas12a-crRNA is used for the RNase II-Kac scanning concentration value of the non-template chain (NTS) of the Escherichia coli genome. It is 2.09, and the Kac / His ratio is 1.74; the RNase II-Kac scanning concentration value of the non-template chain (NTS) of the dCas12a-crRNA for the Escherichia coli genome is 1.12, and the Kac / His ratio is 0.93, that is, the results of the targeting element dCas12a are comparable to those of At2-dCas12a (no crRNA), while the acetylation modification level of RNase II by At2-dCas12a-crRNA of the fusion protein + targeting element crRNA is significantly improved.

[0096] The results showed that compared with the control strain, the acetylation modification levels of Acs and RNase II in the targeted TPA system experimental group were significantly increased.

[0097] We then conducted phenotypic tests on the corresponding strains. For Acs, the test culture medium was M9 medium with 10 mM sodium acetate as the carbon source; for RNase II, the test culture medium was LB medium.

[0098] Strain growth phenotype test Figure 7-8As shown, Figure 7 The middle left figure shows that the growth curve of Escherichia coli treated with the dCas12a-crRNA plasmid targeting Acs is similar to that of At2-dCas12a (no crRNA), while the growth of Escherichia coli treated with the At2-dCas12a-crRNA plasmid targeting Acs is significantly inhibited. Figure 7 The middle right panel shows that the Acs expression level in E. coli treated with the At2-dCas12a-crRNA plasmid targeting Acs is not significantly different from that in E. coli treated with the At2-dCas12a (no crRNA) plasmid. This shows that targeted acetylation of the Acs protein significantly impairs growth, while no significant changes in the corresponding gene transcription level are observed.

[0099] Figure 8 The middle left figure shows that the growth curve of Escherichia coli treated with the dCas12a-crRNA plasmid targeting rnb is similar to that of At2-dCas12a (no crRNA), while the growth of Escherichia coli treated with the At2-dCas12a-crRNA plasmid targeting RNase II is significantly inhibited. Figure 7 The middle right figure shows that the expression level of RNase II in E. coli treated with the At2-dCas12a-crRNA plasmid targeting RNase II is not significantly different from that in E. coli treated with the At2-dCas12a (no crRNA) plasmid. As can be seen, targeted acetylation of the RNase II protein significantly impairs growth, while the corresponding gene transcription level does not change significantly.

[0100] The above results indicate that the growth of the strain was significantly affected after targeted acetylation modification of Acs and RNase II; further qPCR results confirmed that the growth difference was not due to transcriptional changes.

[0101] 3.3 Validation of TPA-targeted acetylation modification tool specificity: For the strains in the Acs-targeted TPA system experimental group in step 3.2, test the whole-protein acetylation modification level of the strains.

[0102] The experimental results can be found in Figure 9 The results showed that the whole-protein acetylation modification level of the strain with targeted acetylation modification elements was not significantly different from that of the control strain expressing only dCas12a; however, the whole-protein acetylation level of the strain expressing only At2-dCas12a fusion protein (without crRNA) was significantly improved, proving that the TPA system did not cause significant changes in the degree of acetylation modification at the whole-protein level and had good specificity.

[0103] Example 4: Targeted protein propionylation modification by replacing the effector element

[0104] 4.1 Modularity is a key concept in synthetic biology. To further validate the versatility of the targeted acetylation modification system TPA, we considered whether it was possible to replace the acetylation modification effector module with other acyltransferases to achieve a wider range of targeted modifications. After a literature review, we ultimately chose propionylation as a research direction. Propionylation has been systematically studied in Escherichia coli. This modification is primarily catalyzed by YfiQ, using propionyl-CoA as the propionyl donor (Sun M, et al. 2016. J Proteome Res. 15:4696-4708.).

[0105] 4.2 We replaced the acetylation effect element At2 of the targeted acetylation system in Examples 1-3 with the propionylation effect element YfiQ, and selected the Acs (acetyl-CoA) protein that has been reported to be modified by propionylation as the test object, and performed a targeted propionylation test in Escherichia coli using a dual-plasmid system.

[0106] The experimental method was similar to that of Example 3.1. However, the YfiQ protein / gene was used instead of the At2 protein / gene. Kpr represents the degree of protein propionylation modification (after western blot analysis of the target protein using a propionylation antibody (PTM BIO, PTM-203), the grayscale value of the target band was quantified using ImageJ software).

[0107] The results are as follows Figure 10 As shown, relative to the negative control plasmid YfiQ-dCas12a (no crRNA) treatment (KPr scanning concentration value set to 1.00, Control scanning concentration value set to 1.00, KPr / Control ratio set to 1.00), the KPr scanning concentration value after fusion protein plasmid YfiQ-dCas12a-crRNA treatment is 2.61, and the KPr / Control ratio is 2.60. The propionylation modification level of Acs is significantly improved, achieving targeted propionylation modification of the target protein Acs.

[0108] In summary, the acylation modification effector element can be combined with the CRISPR targeting element dCas12a to form a fusion protein, achieving highly efficient acylation modification of the targeted protein. The targeted acylation modification system TPA is highly efficient and versatile, broadening the application scope of CRISPR technology. Sequence Listing <110> Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences <120> A method for targeted protein acylation modification in bacteria <130> SHPI2110487 <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 4 <212> PRT <213> Artificial Sequence() <400> 1 Gly Gly Gly Ser 1 <210> 2 <211> 8 <212> PRT <213> Artificial Sequence() <400> 2 Gly Ser Gly Glu Ala Ala Ala Lys 1 5 <210> 3 <211> 13 <212> PRT <213> Artificial Sequence() <400> 3 Gly Ser Gly Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys 1 5 10 <210> 4 <211> 18 <212> PRT <213> Artificial Sequence() <400> 4 Gly Ser Gly Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala 1 5 10 15 Ala Lys <210> 5 <211> 1300 <212> PRT <213> Francisella tularensis <400> 5 Met Ser Ile Tyr Gln Glu Phe Val Asn Lys Tyr Ser Leu Ser Lys Thr 1 5 10 15 Leu Arg Phe Glu Leu Ile Pro Gln Gly Lys Thr Leu Glu Asn Ile Lys 20 25 30 Ala Arg Gly Leu Ile Leu Asp Asp Glu Lys Arg Ala Lys Asp Tyr Lys 35 40 45 Lys Ala Lys Gln Ile Ile Asp Lys Tyr His Gln Phe Phe Ile Glu Glu 50 55 60 Ile Leu Ser Ser Val Cys Ile Ser Glu Asp Leu Leu Gln Asn Tyr Ser 65 70 75 80 Asp Val Tyr Phe Lys Leu Lys Lys Ser Asp Asp Asp Asn Leu Gln Lys 85 90 95 Asp Phe Lys Ser Ala Lys Asp Thr Ile Lys Lys Gln Ile Ser Glu Tyr 100 105 110 Ile Lys Asp Ser Glu Lys Phe Lys Asn Leu Phe Asn Gln Asn Leu Ile 115 120 125 Asp Ala Lys Lys Gly Gln Glu Ser Asp Leu Ile Leu Trp Leu Lys Gln 130 135 140 Ser Lys Asp Asn Gly Ile Glu Leu Phe Lys Ala Asn Ser Asp Ile Thr 145 150 155 160 Asp Ile Asp Glu Ala Leu Glu Ile Ile Lys Ser Phe Lys Gly Trp Thr 165 170 175 Thr Tyr Phe Lys Gly Phe His Glu Asn Arg Lys Asn Val Tyr Ser Ser 180 185 190 Asn Asp Ile Pro Thr Ser Ile Ile Tyr Arg Ile Val Asp Asp Asn Leu 195 200 205 Pro Lys Phe Leu Glu Asn Lys Ala Lys Tyr Glu Ser Leu Lys Asp Lys 210 215 220 Ala Pro Glu Ala Ile Asn Tyr Glu Gln Ile Lys Lys Asp Leu Ala Glu 225 230 235 240 Glu Leu Thr Phe Asp Ile Asp Tyr Lys Thr Ser Glu Val Asn Gln Arg 245 250 255 Val Phe Ser Leu Asp Glu Val Phe Glu Ile Ala Asn Phe Asn Asn Tyr 260 265 270 Leu Asn Gln Ser Gly Ile Thr Lys Phe Asn Thr Ile Ile Gly Gly Lys 275 280 285 Phe Val Asn Gly Glu Asn Thr Lys Arg Lys Gly Ile Asn Glu Tyr Ile 290 295 300 Asn Leu Tyr Ser Gln Gln Ile Asn Asp Lys Thr Leu Lys Lys Tyr Lys 305 310 315 320 Met Ser Val Leu Phe Lys Gln Ile Leu Ser Asp Thr Glu Ser Lys Ser 325 330 335 Phe Val Ile Asp Lys Leu Glu Asp Asp Ser Asp Val Val Thr Thr Met 340 345 350 Gln Ser Phe Tyr Glu Gln Ile Ala Ala Phe Lys Thr Val Glu Glu Lys 355 360 365 Ser Ile Lys Glu Thr Leu Ser Leu Leu Phe Asp Asp Leu Lys Ala Gln 370 375 380 Lys Leu Asp Leu Ser Lys Ile Tyr Phe Lys Asn Asp Lys Ser Leu Thr 385 390 395 400 Asp Leu Ser Gln Gln Val Phe Asp Asp Tyr Ser Val Ile Gly Thr Ala 405 410 415 Val Leu Glu Tyr Ile Thr Gln Gln Ile Ala Pro Lys Asn Leu Asp Asn 420 425 430 Pro Ser Lys Lys Glu Gln Glu Leu Ile Ala Lys Lys Thr Glu Lys Ala 435 440 445 Lys Tyr Leu Ser Leu Glu Thr Ile Lys Leu Ala Leu Glu Glu Phe Asn 450 455 460 Lys His Arg Asp Ile Asp Lys Gln Cys Arg Phe Glu Glu Ile Leu Ala 465 470 475 480 Asn Phe Ala Ala Ile Pro Met Ile Phe Asp Glu Ile Ala Gln Asn Lys 485 490 495 Asp Asn Leu Ala Gln Ile Ser Ile Lys Tyr Gln Asn Gln Gly Lys Lys 500 505 510 Asp Leu Leu Gln Ala Ser Ala Glu Asp Asp Val Lys Ala Ile Lys Asp 515 520 525 Leu Leu Asp Gln Thr Asn Asn Leu Leu His Lys Leu Lys Ile Phe His 530 535 540 Ile Ser Gln Ser Glu Asp Lys Ala Asn Ile Leu Asp Lys Asp Glu His 545 550 555 560 Phe Tyr Leu Val Phe Glu Glu Cys Tyr Phe Glu Leu Ala Asn Ile Val 565 570 575 Pro Leu Tyr Asn Lys Ile Arg Asn Tyr Ile Thr Gln Lys Pro Tyr Ser 580 585 590 Asp Glu Lys Phe Lys Leu Asn Phe Glu Asn Ser Thr Leu Ala Asn Gly 595 600 605 Trp Asp Lys Asn Lys Glu Pro Asp Asn Thr Ala Ile Leu Phe Ile Lys 610 615 620 Asp Asp Lys Tyr Tyr Leu Gly Val Met Asn Lys Lys Asn Asn Lys Ile 625 630 635 640 Phe Asp Asp Lys Ala Ile Lys Glu Asn Gly Glu Gly Tyr Lys Lys 645,650,655 Ile Val Tyr Lys Leu Leu Pro Gly Ala Asn Lys Met Leu Pro Lys Val 660,665,670 Phe Phe Ser Ala Lys Ser Ile Lys Phe Tyr Asn Pro Ser Glu Asp Ile 675,680,685 Leu Arg Ile Arg Asn His Ser Thr His Thr Lys Asn Gly Ser Pro Gln 690,695,700 Lys Gly Tyr Glu Lys Phe Glu Phe Asn Ile Glu Asp Cys Arg Lys Phe 705 710 715 720 Asp Phe Tyr Lys Gln Ser Ile Ser Lys His Pro Glu Trp Lys Asp 725 730 735 Phe Gly Phe Arg Phe Ser Asp Thr Gln Arg Tyr Asn Ser Ile Asp Glu 740,745,750 Phe Tyr Arg Glu Val Glu Asn Gln Gly Tyr Lys Leu Thr Phe Glu Asn 755,760,765 Ser Glu Ser Tyr and Asp Ser Val Val Asn Gln Gly Lys Tyr 770,775,780 Leu Phe Gln Ile Tyr Asn Lys Asp Phe Ser Ala Tyr Ser Lys Gly Arg 785,790,795,800 Pro Asn Leu His Thr Leu Tyr Trp Lys Ala Leu Phe Asp Glu Arg Asn 805 810 815 Gln Asp Val Val Tyr Lys Gln Gl Glu Ala Glu Phe Tyr 820 825 830 Arg Lys Gln Ser Ile Pro Lys Lys Ile Thr His Pro Ala Lys Glu Ala 835 840 845 Ile Ala Asn Lys Asn Lys Asp Asn Pro Lys Lys Glu Ser Val Phe Glu 850 855 860 Tyr Asp Leu Ile Lys Asp Lys Arg Phe Thr Glu Asp Lys Phe Phe 865 870 875 880 His Cys Pro Ile Thr Ile Asn Phe Lys Ser Ser Gly Ala Asn Lys Phe 885,890,895 Asn Asp Glu With Asn Leu Leu Lys Glu Lys Ala Asn Val His 900 905 910 The Asp Arg Gly Glu Arg His Is Tyr Thr 915,920,925 Val Asp Gly Lys Gly Asn Ile Ile Lys Gln Asp Thr Phe Asn Ile Ile 930,935,940 Gly Asn Asp Arg Met Lys Thr Asn Tyr His Asp Lys Leu Ala Ala Ile 945 950 955 960 Glu Lys Asp Arg Asp Ser Ala Arg Lys Asp Trp Lys Lys Ile Asn Asn 965,970,975 Ile Lys Glu Met Lys Glu Gly Tyr Leu Serve Gln Val Val His Glu Ile 980,985,990 Only Lys Leu Only Glu Tyr Asn Only Only Only Only Only Only Phe Only Asp Leu 995 1000 1005 Asn Phe Gly Phe Lys Arg Gly Arg Phe Lys Val Glu Lys Gln Val Tyr 1010 1015 1020 Gln Lys Leu Glu Lys Met Leu And Glu Lys Leu Asn Tyr Leu Val Phe 1025 1030 1035 1040 Lys Asp Asn Glu Phe Asp Lys Thr Gly Gly Val Leu Arg Ala Tyr Gln 1045 1050 1055 Leu Thr Ala Pro Phe Glu Thr Phe Lys Lys Met Gly Lys Gln Thr Gly 1060 1065 1070 Ile Ile Tyr Tyr Val Pro Ala Gly Phe Thr Ser Lys Ile Cys Pro Val 1075 1080 1085 Thr Gly Phe Val Asn Gln Leu Tyr Pro Lys Tyr Glu Ser Val Ser Lys 1090 1095 1100 Ser Gln Glu Phe Phe Ser Lys Phe Asp Lys Ile Cys Tyr Asn Leu Asp 1105 1110 1115 1120 Lys Gly Tyr Phe Glu Phe Ser Phe Asp Tyr Lys Asn Phe Gly Asp Lys 1125 1130 1135 Ala Ala Lys Gly Lys Trp Thr Ile Ala Ser Phe Gly Ser Arg Leu Ile 1140 1145 1150 Asn Phe Arg Asn Ser Asp Lys Asn His Asn Trp Asp Thr Arg Glu Val 1155 1160 1165 Tyr Pro Thr Lys Glu Leu Glu Lys Leu Leu Lys Asp Tyr Ser Ile Glu 1170 1175 1180 Tyr Gly His Gly Glu Cys Ile Lys Ala Ala Ile Cys Gly Glu Ser Asp 1185 1190 1195 1200 Lys Lys Phe Phe Ala Lys Leu Thr Ser Val Leu Asn Thr Ile Leu Gln 1205 1210 1215 Met Arg Asn Ser Lys Thr Gly Thr Glu Leu Asp Tyr Leu Ile Ser Pro 1220 1225 1230 Val Ala Asp Val Asn Gly Asn Phe Phe Asp Ser Arg Gln Ala Pro Lys 1235 1240 1245 Asn Met Pro Gln Asp Ala Asp Ala Asn Gly Ala Tyr His Ile Gly Leu 1250 1255 1260 Lys Gly Leu Met Leu Leu Gly Arg Ile Lys Asn Asn Gln Glu Gly Lys 1265 1270 1275 1280 Lys Leu Asn Leu Val Ile Lys Asn Glu Glu Tyr Phe Glu Phe Val Gln 1285 1290 1295 Asn Arg Asn Asn 1300

Claims

1. A method for targeted protein acylation modification in bacteria, characterized in that: The method comprises the following steps: in a CRISPR system, constructing an acyltransferase-dCas12a fusion protein gene and a crRNA gene on a plasmid, and transferring the gene into bacteria, and completing the acylation modification of the target protein by bacterial proliferation, wherein the acylase-dCas12a fusion protein gene and the crRNA gene are constructed on the same plasmid, the dCas12a is a CRISPR-associated nuclease dCas12a derived from Francisella tularensis, and its amino acid sequence is SEQ ID NO: 5, and the acyltransferase, i.e., the acylase, is selected from the following group: Escherichia coli with NCBI accession number WP_000083005.1 E. coli YfiQ from the source, Clostridium jondahlii with NCBI accession number ADK13966.1 C. ljungdahlii Source of At2.

2. The method according to claim 1, wherein The acylation modification is acetylation modification or propionylation modification, and the crRNA gene targets the template chain or non-template chain of the target protein.

3. The method according to claim 1, wherein The acyltransferase-dCas12a fusion protein includes: an acyltransferase, dCas12a, and a linker connecting the two, wherein the linker is selected from the following group: linkerL1 with an amino acid sequence of GGGS (SEQ ID NO: 1), linkerL2 with an amino acid sequence of GSGEAAAK (SEQ ID NO: 2), linkerL3 with an amino acid sequence of GSGEAAAKEAAAK (SEQ ID NO: 3), and linkerL4 with an amino acid sequence of GSGEAAAKEAAAKEAAAK (SEQ ID NO: 4).

4. The method according to claim 1, wherein The fusion protein includes dCas12a, an acyltransferase At2 with NCBI accession number ADK13966.1, and a linker linker L2 connecting the two with an amino acid sequence of SEQ ID NO: 2, wherein the protein fusion mode is At2 at the N-terminus and dCas12a at the C-terminus.

5. The method according to claim 1, wherein The acylation is acetylation, catalyzed by At2, with acetyl-CoA as the acetyl donor.

6. The method according to claim 1, wherein The acylation is propionylation, catalyzed by YfiQ, with propionyl-CoA as the propionyl donor.

7. The method according to claim 1, wherein The bacteria are Gram-negative bacteria.

8. A kit, characterized in that The method comprises a plasmid used in any one of claims 1 to 7.

Images