A cyclized sugar phosphate compound and its application

By synthesizing cyclic sugar phosphate compound yelium monocyte alkali, the problem of unclear biochemical activity of bacteria of Xanthomonas and the regulation of plant immune responses is solved, the inhibitory effect of plant immune responses is achieved, and a tool for the study of plant immune signaling pathways is provided.

CN116178461BActive Publication Date: 2025-08-08CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310100490.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-12
Publication Date
2025-08-08
Estimated Expiration
2043-02-12

AI Technical Summary

Technical Problem

In the prior art, the biochemical activity of the tri-effector protein AvrBs2 of the Bacteria genus Xanthomonas is unclear, and the regulatory effect of carbohydrate phosphates on plant immune response has not been reported, making it difficult to effectively inhibit the basic defense response of plants.

Method used

A new cyclized phosphate sugar ester compound, yellowmonas, is synthesized in plant cells by Xanthomonas bacteria, serving as a carbon source for bacterial growth and inhibiting the basic defense response of plants.

Benefits of technology

Yellowmonocytic base can significantly inhibit plant reactive oxygen outbreaks and upregulated expression of PR genes induced by various immune triggers, providing a tool for studying plant immune signaling pathways.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116178461B_ABST
    Figure CN116178461B_ABST
Patent Text Reader

Abstract

The present invention discloses a cyclic sugar phosphate compound and its application. The compound is shown in Formula I. Experimental studies have confirmed that the compound can provide carbon source nutrition for Xanthomonas bacteria and has the ability to broadly inhibit plant basal defense responses induced by various immune elicitors, including reactive oxygen species bursts and upregulated expression of pathogenesis-related (PR) genes, providing an effective tool for studying plant immune signaling pathways. #imgabs0#
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the biological field, and in particular to a new, unidentified cyclic phosphosugar ester compound synthesized by the Xanthomonas bacterial effector protein AvrBs2 in a host plant, and its role in providing carbon source nutrition to microorganisms and inhibiting the basal immune response of plants. Background Art

[0002] Xanthomonas bacteria are important plant pathogens with a wide host range, causing serious bacterial diseases in a variety of important crops (see Ryan et al., 2011, Nat. Rev. Microbiol. 9, 344-355). Three types of effector proteins secreted by these pathogens into host cells are the primary factors contributing to their virulence (see White et al., 2009, Mol. Plant Pathol. 10, 749-766). Among these, AvrBs2 is one of the most conserved effector proteins in Xanthomonas and is ubiquitous across the species, but its biochemical activity was previously unknown (see Zhao et al., 2011, PLoS Pathog. 7, e1002408).

[0003] Phosphorylation of carbohydrates is associated with sugar energy metabolism, modification, and intracellular signaling. These different types of phosphorylated sugar esters are ubiquitous in biological cells. They occur in diverse structural forms, including monophosphate sugars (such as glucose-6-phosphate) and diester sugars (such as agropine A). These sugar phosphates exist as linear molecules, and no studies have shown that they regulate plant immune responses. Our research has uncovered a previously unreported phosphosugar structure: a symmetrical, cyclic phosphodiester sugar composed of two monosaccharides. This compound is synthesized by the Xanthomonas effector protein AvrBs2 within the host, and we have therefore named it xanthomonadine. This unique structure confers novel biological activities compared to previously reported sugar phosphate esters. We found that this compound can serve as a carbon source for Xanthomonas growth and also inhibit plant basal defense responses, suppressing plant immune responses. Summary of the Invention

[0004] Based on this, the present invention aims to provide a novel compound xanthocyanine that has a broad inhibitory effect on plant basal immune responses.

[0005] The present invention provides a cyclized sugar phosphate compound and application thereof.

[0006] The cyclic sugar phosphate compound described in this invention is the first to be discovered, and its biological activity has not been reported in patents or literature to date. It is a compound synthesized in plant cells by the type III effector protein AvrBs2 of Xanthomonas bacteria, and its application.

[0007] The compound provided by the present invention has a structural formula as shown in Formula I:

[0008]

[0009] The compound is named xanthocyanine, and the structure of the compound xanthocyanine is named: bis-1',6'-cyclic dimericα-D-galactose-phosphate)

[0010] The above compound xanthophylline can be named according to the IUPAC nomenclature: dimethylphosphinic acid--(2R,3R,4S,5R,6S)-2-((λ 1 -oxidaneyl)methyl)-6-(λ 1 -oxidaneyl)tetrahydro-2H-pyran-3,4,5-triol(1 / 2).

[0011] The present invention provides a method for preparing the compound xanthocyanine, which is characterized in that it comprises the following steps:

[0012] After dehulling, transgenic rice seeds expressing dexamethasone (Dex)-induced avrBs2 were soaked in 75% ethanol for 2 minutes, then surface-sterilized by soaking in 50% sodium hypochlorite solution for 40 minutes, and then washed six times with sterile water. The seeds were then placed on sterile filter paper to absorb moisture and then grown on 1 / 2 Murashige & Skoog (MS) solid medium for one week. Grown seedlings were treated with 1 / 2 MS liquid medium plus 30 μM dexamethasone (DEX) for 1-2 weeks, with 50-100 seedlings induced in 400 ml of 1 / 2 MS liquid medium plus 30 μM DEX per bottle. 400 ml of culture medium (or 200 g of seedlings ground into powder and added with 200 ml of ddH2O) and 400 ml of phenol were mixed and then heated at 65°C for 30 minutes. The mixture was stirred every 10 minutes and filtered to remove solid impurities. After centrifugation at 10000g for 10 minutes at 25℃, separate the layers, collect the aqueous layer, and discard the phenol layer. Extract the aqueous phase with ether (volume ratio, aqueous phase: ether = 10:1), then concentrate by rotary evaporation at 65℃ to a final volume of 20ml; pass through a Sephadex G-25 molecular sieve column, add 20ml of the concentrated extract, use 0.01M NH4HCO3 as the mobile phase, and elute with 500ml of 0.01M NH4HCO3 solution. Discard the first 100ml and collect the remaining 10ml into a tube in sequence. Then detect the compounds by thin layer chromatography; combine the fractions containing the higher concentration of the compound, concentrate by rotary evaporation at 65℃ to a final volume of 5ml; repeat the molecular sieve once; pass the concentrated compound onto a 1ml anion exchange chromatography column (GE, Healthcare), pre-equilibrate with deionized water, and then elute with 30 column volumes of 0-100% 1

[0013] The product was linearly eluted with 1 M NH4HCO3 solution, and 1 ml of the eluate was continuously sampled for thin-layer chromatography analysis. The eluates containing the compound were combined and analyzed by thin-layer chromatography. The eluted sample containing the new compound was rotary evaporated at 65°C to a powder. Anion exchange chromatography was repeated three times, and after rotary evaporation and drying, the compound of the present invention, xanthomonasine, was obtained.

[0014] Experiments have shown that this compound has a good inhibitory effect on plant reactive oxygen species bursts and PR gene upregulation induced by various immune elicitors, providing an effective tool for the study of plant immune signaling pathways. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The compound of the present invention is xanthocyanine compound xanthocyanine H NMR spectrum 1 H-NMR (400M).

[0016] Figure 2 for (and C NMR13 C-NMR data are shown in Figure 1 ) and C NMR spectroscopy 13 C-NMR (400M) Figure 2 ) data (chemical shift value δ unit ppm, test solvent: D2O).

[0017] Figure 3 The xanthocyanine of the present invention inhibits the active oxygen burst induced by various elicitors in different plants.

[0018] Figure 4 The results show that xanthophylline inhibits the expression of rice PR gene.

[0019] Figure 5 The wild type Xoc bacteria uses xanthomonas as a carbon source for growth. DETAILED DESCRIPTION

[0020] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0021] Example 1. Obtaining the Cyclic Sugar Phosphate Compound of the Present Invention

[0022] Through research, the inventors discovered a cyclic sugar phosphate synthase, AvrBs2. During plant infection by various pathogenic bacteria from the genus Xanthomonas, a sugar compound is synthesized within plant cells. Through isolation, purification, and structural analysis of this compound, a novel cyclic sugar phosphate compound was obtained. Experimental results show that this compound can provide nutrients for the bacterial leaf streak pathogen, promoting its infection of rice, and can also strongly inhibit the plant's basal defense responses.

[0023] 1. Preparation of Cyclic Sugar Phosphate Compounds of the Present Invention

[0024] We constructed transgenic rice expressing dexamethasone (Dex)-inducible avrBs2. The avrBs2 coding region was first constructed into the dexamethasone (Dex)-inducible expression vector pTA7001. The sequence-verified pTA7001-avrBs2 plasmid DNA was then transformed into Agrobacterium tumefaciens strain EHA105 for rice transformation experiments. (Li et al., The Type III Effector AvrBs2 in Xanthomonas oryzae pv. oryzicola Suppresses Rice Immunity and Promotes Disease Development Mol. Plant Microbe Interact. 2015, 28, 869-880.)

[0025] We then used the following method to induce callus culture from mature embryos of rice seeds. Hulled mature seeds of the rice variety Nipponbare were first soaked in 75% ethanol for 1-2 minutes, then in 50% sodium hypochlorite solution for 40 minutes. Surface sterilization was performed (preferably on a shaker), followed by rinsing with sterile water 3-4 times. The seeds were then placed on sterile filter paper to absorb moisture and then incubated on mature embryo callus induction medium NBi at 28°C with 16 hours of light and 8 hours of darkness. Approximately 7, 14, and 30 days later, callus emerging from the scutellum of the mature embryos was removed and transferred to mature embryo subculture medium NBi for 7 days of subculture under the same conditions.

[0026] Agrobacterium EHA105 containing the target gene vector was cultured in a liquid medium containing 50 μg / mL Ka and 25 μg / mL RifYEP at 200 rpm and 28°C for 16-24 hours. The culture was spread on a new solid medium containing 50 μg / mL Ka and 25 μg / mL RifYEP, cultured in the dark at 28°C for 2-3 days, and then scraped and transferred to a co-culture liquid medium. Acetosyringone (AS) was added to a final AS concentration of 100 μM. The bacterial concentration was adjusted to OD 600 =0.1, which is the Agrobacterium suspension used for co-cultivation and transformation of rice.

[0027] Place the subcultured callus in a 100 mL sterile Erlenmeyer flask and add an appropriate amount of Agrobacterium suspension (ensure sufficient suspension is in contact with the material). Incubate at room temperature for 15 minutes with occasional gentle agitation. Discard the suspension and place the infected rice callus on sterile filter paper for 30 minutes. Remove any excess suspension from the surface of the rice callus and place on solid co-culture medium at 25°C in the dark for 3 days.

[0028] Place the co-cultivated callus into a 100 mL sterile Erlenmeyer flask, wash nine times with sterile water, then once with sterile water containing 400 mg / L Timentin. Blot dry the callus surface with sterile filter paper. Place the callus on resistant callus screening medium NBs containing 40 mg / L Hygromycin and incubate at 28°C for 30 days. Most calli will turn brown around 10 days after screening, followed by the re-growth of bright yellow resistant calli around the edges of the browned tissue. Select the newly emerged resistant calli and transfer them to freshly prepared screening medium for another 7-10 days.

[0029] From the resistant calli that emerged after two rounds of screening, bright yellow, dense resistant calli were selected and transferred to a regeneration medium containing 40 mg / L hygromycin (NBr). After 15-25 days of light incubation, green spots appeared. After 30-40 days, seedlings were further differentiated. When the buds differentiated from the resistant calli reached approximately 2 cm in length, the seedlings were transferred to a rooting medium and cultured for approximately two weeks. Seedlings approximately 10-15 cm tall with well-developed root systems were selected, the culture medium was washed off, and sterilized water was used to continue incubation in the tissue culture room for approximately one week. Once the seedlings had developed robust stems, they were transplanted into the soil. After field planting, rice seeds were harvested and transgenic lines capable of DEX-induced expression were tested. T2 seeds were planted and, after harvest, seeds from individual T2 plants were tested for hygromycin resistance, and homozygous plants were selected. Seed propagation and further experiments were carried out.

[0030] After dehulling, the seeds were first soaked in 75% ethanol for 2 minutes, then in 50% sodium hypochlorite solution for 40 minutes to sterilize the surface. The seeds were then washed six times with sterile water. After drying on sterile filter paper, the seeds were placed on 1 / 2 MS solid medium and grown for one week. The grown seedlings were treated with 1 / 2 MS liquid medium plus 30 μM DEX (400 ml per bottle of 1 / 2 MS liquid medium plus 30 μM DEX) for 50-100 seedlings for 1-2 weeks. 400 ml of culture medium (or 200 g of seedlings ground into powder and added with 200 ml of ddH2O) and 400 ml of phenol were mixed and then heated at 65°C for 30 minutes. Stirring was performed every 10 minutes, and solid impurities were removed by filtration. The mixture was centrifuged at 10,000 g for 10 minutes at 25°C. The aqueous layer was collected and the phenol layer was discarded. The aqueous phase was extracted with ether (volume ratio, aqueous phase: ether = 10:1) and then concentrated by rotary evaporation at 65°C to a final volume of 20 ml. The product was then passed through a Sephadex G-25 molecular sieve column, 20 ml of the concentrated extract was added, and eluted with 0.01 M NH4HCO3 as the mobile phase using 500 ml of 0.01 M NH4HCO3 solution. The first 100 ml was discarded, and subsequent 10 ml fractions were collected in separate tubes. The compound was then analyzed by thin-layer chromatography. Fractions containing the novel compound of Formula I at a higher concentration were combined and concentrated by rotary evaporation at 65°C to a final volume of 5 ml. The molecular sieve column was repeated once. The concentrated compound was passed through a 1 ml anion exchange chromatography column (GE Healthcare), pre-equilibrated with deionized water, and then linearly eluted with 0-100% 1 M NH4HCO3 solution over 30 column volumes. The eluent was continuously sampled at 1 ml per column for thin-layer chromatography analysis. The eluates containing the new compound were combined and analyzed by thin-layer chromatography. The eluted sample containing the new compound was collected and rotary evaporated at 65°C to a powder. Anion exchange chromatography was repeated three times. After rotary evaporation and drying, the compound of the present invention, xanthomonidine, was obtained, which is a cyclic sugar phosphate compound of the present invention.

[0031] 2. Structure and physicochemical properties of the cyclic sugar phosphate compound of the present invention:

[0032] The compound obtained in step 1 has the structural formula shown in Formula I:

[0033]

[0034] The structural name is: bis-1',6'-cyclic dimericα-D-galactose-phosphate

[0035] According to IUPAC nomenclature, it can be named as: dimethylphosphinic acid--(2R,3R,4S,5R,6S)-2-((λ1 -oxidaneyl)methyl)-6-(λ 1 -oxidaneyl)tetrahydro-2H-pyran-3,4,5-triol(1 / 2).

[0036] CA search showed that compound xanthanine was a new compound.

[0037] The compound xanthocyanine is a white powder, soluble in water but insoluble in ethanol, with a molecular formula of C 12 H 22 O 16 P2.

[0038] The molecular weight of the compound xanthan gum is 484.24.

[0039] H NMR spectrum of compound xanthomonasine 1 H-NMR and carbon nuclear magnetic resonance spectroscopy 13 C-NMR data are shown in the H NMR spectrum of compound xanthocyanine 1 H-NMR (400M) Figure 1 ) and C NMR spectroscopy 13 C-NMR (400M) Figure 2 ) data (chemical shift value δ unit ppm, test solvent: D2O).

[0040] Example 2: Xanthan Gum Compound Inhibits Plant Reactive Oxygen Species Burst Induced by Immune Elicitors

[0041] Take 4-week-old tobacco, Arabidopsis, tomato and rice leaves, use a hole puncher to take a leaf disc with a diameter of 3 mm, put it in distilled water, transfer the leaves to a 96-well flat white opaque plate, put 3 leaf discs in each sample well, add 100 μl distilled water (control) or 1 mM xanthocyanin aqueous solution, and place it in the dark at 25°C overnight. The next day, use a pipette to wash out the distilled water and xanthocyanin solution, and add 200 ul detection reagent, including exciters (1 μM flg22, 1 μM elf18, 5 μM chitin or distilled water), 20 μg / ml horseradish peroxidase, 40 μM luminol or L-012. Among them, luminol is used as the luminescent substrate for tobacco, Arabidopsis and tomato, and L-012 is used as the luminescent substrate for rice. After adding the detection reagent, immediately put it into the enzyme reader to measure the chemiluminescence value. Read each sample once every 1 minute for a total of 30-50 minutes. Figure 3 As shown, xanthocyanine can significantly inhibit the ROS burst induced by various elicitors in different plants. Figure 3A shows xanthocyanidin inhibiting the reactive oxygen species burst (ROS) in rice leaves induced by flg22; B shows xanthocyanidin inhibiting the reactive oxygen species burst (ROS) in rice leaves induced by N-acetylcohexose (chitin); C shows xanthocyanidin inhibiting the reactive oxygen species burst (ROS) in tomato leaves induced by flg22; D shows xanthocyanidin inhibiting the reactive oxygen species burst (ROS) in Arabidopsis leaves induced by elf18; E shows xanthocyanidin inhibiting the reactive oxygen species burst (ROS) in Nicotiana benthamiana leaves induced by flg22.

[0042] Example 3: Xanthan Gum Compound Inhibits Immune Elicitor-Induced Rice PR Gene Expression

[0043] Hulled mature seeds of wild-type rice (Oryza sativa L. cv. Nipponbare) were first soaked in 75% ethanol for 1-2 minutes, then in 50% sodium hypochlorite solution for 40 minutes for surface sterilization. The seeds were then rinsed six times with sterile water. The seeds were then placed on sterile filter paper to absorb moisture, placed on 1 / 2 MS culture medium plates, and cultured at 28°C with 16 h of light and 8 h of darkness for 6 days. The seeds were then transferred to 1 / 2 MS liquid medium containing 1 mM xanthomonasine or an equal volume of distilled water (control) and cultured for 2 days. The rice seedlings were then placed in 1 / 2MS liquid medium containing an elicitor (1 μM flg22 or 5 μM N-acetylhexachitosan) and 0.01% silwet-L77 for 6 hours. The seedlings were then immediately frozen in liquid nitrogen, ground into powder, and total RNA was extracted. After mRNA was reverse transcribed into cDNA, real-time fluorescence quantitative RT-PCR was performed to detect the expression levels of rice PR genes (OsPBZ1, OsPR1a, and OsPR1b), with OsActin1 as an internal reference gene. The PCR amplification primer sequences are as follows: OsPBZ1-qRT-FGACATCGTGGATGGCTACTATGG; OsPBZ1-qRT-R

[0044] TCACTCACTCTAGGTGGGATATAC; OsPR1a-qRT-FGTCTTCATCACCTGCAACTACTC; OsPR1a-qRT-RCATGCATAAACACGTAGCATAGC; OsPR1b-qRT-FCGATCAGCGCCCTTACTAGC; OsPR1b-qRT-RACACACAATCCGGCTACATAGAT; ;OsActin1-qRT-RGTACCCGCATCAGGCATCTG. The result is as follows Figure 4 As shown, xanthan gum significantly inhibited the expression of rice PR gene. Figure 4In the figure, A shows xanthocyanine inhibiting the flg22-induced transcriptional upregulation of OsPBZ1 in rice seedlings; B shows xanthocyanine inhibiting the flg22-induced transcriptional upregulation of OsPR1b in rice seedlings; C shows xanthocyanine inhibiting the N-acetylhexachitosan (chitin)-induced transcriptional upregulation of OsPBZ1 in rice seedlings; D shows xanthocyanine inhibiting the N-acetylhexachitosan (chitin)-induced transcriptional upregulation of OsPR1a in rice seedlings.

[0045] Example 4: Xanthan gum can be used as a carbon source to provide nutrients for Xoc growth

[0046] Xanthomonas sp. Xoc strain RS105 (Li et al., 2015, Mol. Plant Microbe Interact. 28, 869-880.) cultured overnight was collected by centrifugation, washed three times with XVM2 minimal medium, and then added to XVM2 minimal medium (20 mM NaCl, 10 mM (NH4)2SO4, 5 mM MgSO4, 1 mM CaCl2, 0.16 mM KH2PO4, 0.32 mM K2HPO4, 0.01 mM FeSO4, 0.03% casamino acids, pH 6.7) containing 5 mM xanthopine and 0.05 mM sucrose, or added to XVM2 minimal medium containing 0.05 mM sucrose (as a control group) to adjust the final concentration to OD 600 =0.02, and then cultured at 28°C to measure bacterial growth. The experimental results showed that wild-type Xoc bacteria can use xanthomonasine as a carbon source to ensure bacterial growth.

[0047] The results are as follows Figure 5 As shown, Figure 5 Figure 2. A, 5 mM xanthopine can serve as a carbon source to ensure the growth of Xanthomonas. The bacterial growth medium is XVM2 minimal medium supplemented with 5 mM xanthopine and 0.05 mM sucrose. WT is the wild-type Xoc bacterium, ΔxanT is a knockout strain with the xanthopine uptake and transport gene knocked out, ΔxanP is a knockout strain with the xanthopine hydrolase knocked out, and ΔxanTP is a double knockout. B, Different Xoc strains can all utilize 5 mM sucrose as a carbon source to ensure the growth of Xanthomonas. The bacterial growth medium is XVM2 minimal medium supplemented with 5 mM sucrose. C, Under the same experimental conditions, 0.05 mM sucrose cannot ensure significant growth of Xanthomonas Xoc.

[0048] The above description is only illustrative of the present invention and not restrictive. Those skilled in the art will understand that many modifications, changes or equivalents may be made without departing from the spirit and scope defined by the appended claims, but all of them will fall within the scope of protection of the present invention.

Claims

1. A cyclized sugar phosphate compound, the structural formula of which is shown in Formula I:

2. Use of the compound of claim 1 in inhibiting a basal defense response in a plant, wherein the basal defense response in the plant is an elicitor-induced burst of reactive oxygen species and / or up-regulated expression of PR genes; the elicitor is a small peptide from the flg22 region of flagellin, chitin, and / or a small peptide from the elf18 region of a prokaryotic elongation factor; and the plant is rice, tobacco, Arabidopsis, and / or tomato.

3. Use of the compound of claim 1 in the preparation of an inhibitor of a basal defense response in a plant, wherein the basal defense response in the plant is an elicitor-induced burst of reactive oxygen species and / or up-regulated expression of PR genes; the elicitor is a small peptide from the flg22 region of flagellin, chitin, and / or a small peptide from the elf18 region of a prokaryotic elongation factor; and the plant is rice, tobacco, Arabidopsis, or tomato.

4. Use of the compound according to claim 1 as a carbon source for Xanthomonas bacteria.

5. A plant basal defense response inhibitor, the active ingredient of which is the compound according to claim 1; the plant basal defense response is an elicitor-induced reactive oxygen species burst and / or PR gene upregulation; the elicitor is a small peptide from the flg22 region of flagellin, chitin and / or a small peptide from the elf18 region of prokaryotic elongation factor; the plant is rice, tobacco, Arabidopsis and / or tomato.

6. A Xanthomonas bacteria culture medium comprising the compound according to claim 1.

Citation Information

Patent Citations

  • Plant-derived flavonoid glycoside plant immune resistance inducer and application thereof

    CN115053906A

  • Receptors for hypersensitive response elicitors and uses thereof

    US20020007501A1