Nucleic acid aptamer that binds to IGFBP-2 protein and its applications

Abstract

The present invention discloses a nucleic acid aptamer that binds to IGFBP-2 protein and its applications, belonging to the field of biotechnology. The nucleic acid aptamer of the present invention is obtained by in vivo selection, and the sequence is shown as SEQ ID NO.1. The nucleic acid aptamer of the present invention has the characteristics of high specificity, stable chemical properties, easy preparation and preservation, small molecular weight, high affinity, strong stability, etc.; moreover, compared with in vitro selection, the nucleic acid aptamer obtained by in vivo selection has better stability and is more suitable for binding specific targets in vivo.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to nucleic acid aptamers that bind to IGFBP-2 protein and their applications. Background Art

[0002] IGFBP2 (insulin-like growth factor binding protein 2) is one of the six homologous proteins in the IGFBP family. It consists of 289 amino acids, with a protein molecular mass of 36 kDa. It has a conserved amino terminus and carboxyl terminus, as well as a non-conserved linker region in the middle; it has a high affinity for IGF and can regulate the biological activities of cells by binding to IGF; in previous studies, it was found that IGFBP2 is also one of the most abundant and common proteins in tumor regions and plays a crucial role in tumor metastasis, invasion, proliferation, angiogenesis, epithelial-mesenchymal transition, and immune regulation. This is mainly because IGFBP2, as a secreted protein, its structure contains an arginine-glycine-aspartic acid sequence (RGD) sequence, a heparin-binding domain (HBD), and a nuclear localization sequence (NLS); for example, the RGD sequence can bind to integrin to regulate downstream cell signaling pathways, thereby enhancing the invasion and migration ability of tumors, while the HBD sequence can bind to glycosaminoglycans in the extracellular matrix to regulate the growth, differentiation, migration, etc. of tumor cells; in addition, IGFBP2 is overexpressed in glioblastoma, ovarian cancer, breast cancer, and prostate cancer, so it can also be used as a class of biomarkers for tumor diagnosis and prognosis examination.

[0003] Nucleic acid aptamers refer to single-stranded oligonucleotides that are screened from synthetic single-stranded DNA / RNA libraries and can bind to target molecules with high specificity and high affinity. Nucleic acid aptamers form special three-dimensional structures, such as hairpins, bulges, G-quadruplexes, etc., through intermolecular forces such as hydrogen bonds, van der Waals forces, and hydrophobic interactions, so as to specifically recognize target substances and even affect their biological activities. The unique biochemical properties of nucleic acid aptamers themselves give them many advantages in the field of biomedical applications, such as high specificity, stable chemical properties, easy preparation and preservation, small molecular weight, etc.

[0004] Systematic evolution of ligands by exponential enrichment (SELEX) and cell-SELEX are currently the main methods for screening nucleic acid aptamers. After several rounds of screening, the sequences that bind to the target will be enriched. Subsequently, the enriched sequences are sequenced and identified to obtain specific nucleic acid aptamers; however, due to differences in intermolecular interactions, microenvironments, etc., the binding conformations of nucleic acid aptamers screened in vitro with the target are usually different from those in vivo, which also makes nucleic acid aptamers unable to play a good role in vivo. Better screening methods need to be further studied. Summary of the Invention

[0005] The object of the present invention is to provide a nucleic acid aptamer capable of binding to IGFBP-2 protein, which has the characteristics of high specificity, stable chemical properties, easy preparation and preservation, small molecular weight, high affinity, strong stability, etc. And the nucleic acid aptamer of the present invention is obtained by in vivo screening, and the stability of the nucleic acid aptamer obtained by this method is improved compared with the in vivo stability of the aptamer obtained by in vitro screening.

[0006] To achieve the above object of the invention, the following technical solutions are adopted.

[0007] A nucleic acid aptamer that binds to IGFBP-2 protein, and the nucleic acid aptamer sequence includes the sequence shown in SEQ ID NO.1;

[0008] SEQ ID NO.1:

[0009] TGCTGGATGTTCCACACTGCCACTCATTTGCCTCTCTCACCACGACTGACACATCCAGC.

[0010] Preferably, the above nucleic acid aptamer is obtained by in vivo SELEX screening.

[0011] Preferably, the screening library of the above nucleic acid aptamer is:

[0012] 5’-GTTCGTGGTGTGCTGGATGT(N36)TGACACATCCAGCAGCACGA-3’ (SEQ ID NO.2).

[0013] Preferably, the preparation method of the above nucleic acid aptamer includes:

[0014] Design and synthesis of library and primers;

[0015] Nucleic acid aptamer screening;

[0016] Identification of nucleic acid aptamer.

[0017] More preferably, the nucleic acid aptamer screening includes:

[0018] Construction of tumor-bearing mouse model;

[0019] Injecting the library into the mouse model;

[0020] Collecting, amplifying and purifying nucleic acid molecules in tumor tissue cells;

[0021] Collecting Cy5-labeled nucleic acid molecules;

[0022] Screening high-affinity nucleic acid aptamers from the library.

[0023] The stability of the nucleic acid aptamer obtained by in vivo screening is improved compared with the in vivo stability of the nucleic acid aptamer obtained by in vitro screening.

[0024] The present invention also discloses a nucleic acid aptamer that binds to the IGFBP-2 protein, including an RNA sequence transcribed from the complementary sequence of the above nucleic acid aptamer SEQ ID NO.1.

[0025] The present invention also discloses a nucleic acid aptamer that binds to the IGFBP-2 protein, including a sequence obtained by modifying the above nucleic acid aptamer.

[0026] Preferably, the modification includes at least one of the following modification methods:

[0027] (1) Phosphorylation;

[0028] (2) Methylation;

[0029] (3) Amination;

[0030] (4) Thiolation;

[0031] (5) Isotope labeling;

[0032] (6) Replacing oxygen with sulfur;

[0033] (7) Replacing oxygen with selenium.

[0034] The present invention also discloses a nucleic acid aptamer that binds to the IGFBP-2 protein, including a sequence obtained by modifying the above nucleic acid aptamer; the modification includes at least one of the following modification methods:

[0035] (1) Connecting a fluorescent label to the nucleic acid aptamer;

[0036] (2) Connecting a radioactive substance to the nucleic acid aptamer;

[0037] (3) Connecting a therapeutic substance to the nucleic acid aptamer;

[0038] (4) Connecting biotin to the nucleic acid aptamer;

[0039] (5) Connecting digoxin to the nucleic acid aptamer;

[0040] (6) Connecting a nanoluminescent material to the nucleic acid aptamer;

[0041] (7) Connecting a small peptide to the nucleic acid aptamer;

[0042] (8) Connecting siRNA to the nucleic acid aptamer.

[0043] The present invention also discloses a derivative of a nucleic acid aptamer that binds to the IGFBP-2 protein, including at least one of the following:

[0044] (1) A phosphorothioate backbone sequence derived from the above-mentioned aptamer backbone;

[0045] (2) A peptide nucleic acid sequence designed and synthesized from the above-mentioned aptamer.

[0046] The present invention also discloses the uses of the above-mentioned aptamer and aptamer derivatives, including at least one of the following:

[0047] (1) Detecting IGFBP-2 protein;

[0048] (2) Locating and imaging cells, tissues or living bodies expressing IGFBP-2;

[0049] (3) Capturing cells or exosomes expressing IGFBP-2;

[0050] (4) Coupling with drugs;

[0051] (5) Targeted delivery of drugs to tumor cells;

[0052] (6) Regulating the function of IGFBP-2 protein;

[0053] (7) Preparing a reagent for detecting IGFBP-2 protein;

[0054] (8) Preparing an imaging agent;

[0055] (9) Preparing a drug carrier;

[0056] (10) Preparing an anti-tumor drug.

[0057] The present invention also discloses the use of in vivo screening in improving the affinity and / or stability of aptamers.

[0058] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0059] The aptamer of the present invention is obtained by in vivo SELEX screening, and has the characteristics of high specificity, stable chemical properties, easy preparation and preservation, and small molecular weight; and can effectively overcome the problem that the aptamer cannot stably exist in vivo and bind to the target to exert corresponding functions due to the changes in the in vivo microenvironment and the target conformation after entering the living body. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 Results of SPR verification of the affinity between IGFBP2-L21 and IGFBP-2 protein;

[0061] Figure 2 Results of flow cytometry verification of the binding of IGFBP2-L21 to IGFBP-2 positive cell lines. DETAILED DESCRIPTION OF THE INVENTION

[0062] Exemplary embodiments will be described in detail herein. The embodiments described in the following exemplary embodiments do not represent all embodiments consistent with the present disclosure. On the contrary, they are merely examples of methods consistent with some aspects of the present disclosure.

[0063] Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods or are carried out according to the conditions recommended by the manufacturers. Unless otherwise specified, the materials, reagents, etc. used in the following embodiments can all be obtained from commercial sources.

[0064] Example 1

[0065] Screening of Nucleic Acid Aptamers Specifically Binding to IGFBP-2 Protein

[0066] 1. Design and Synthesis of Library and Primers

[0067] Random single-stranded DNA library: lib26;

[0068] SEQ ID NO.2:

[0069] 5’- GTTCGTGGTGTGCTGGATGT(N36)TGACACATCCAGCAGCACGA-3’;

[0070] Among them, "N36" represents a sequence composed of 36 arbitrary nucleotide bases connected.

[0071] The primer information for screening is shown in Table 1 and was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0072] Table 1 Primers and Their Sequences

[0073] Primer Name Sequence (5'-3') Serial Number lib26-S1 GTTCGTGGTGTGCTGGATGT SEQ ID NO.3 lib26-Cy5-S1 Cy5-GTTCGTGGTGTGCTGGATGT lib26-A2 TCGTGCTGCTGGATGTGTCA SEQ ID NO.4 lib26-A2-Biotin Biotin-TCGTGCTGCTGGATGTGTCA

[0074] Among them, S in the primer name represents the forward primer, and A in the primer name represents the reverse primer

[0075] The library and primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The synthesized primers were respectively formulated into a 100 μM stock solution with DPBS buffer (calcium chloride 0.1 g / L, potassium chloride 0.2 g / L, potassium dihydrogen phosphate 0.2 g / L, magnesium chloride hexahydrate 0.1 g / L, sodium chloride 8 g / L, disodium hydrogen phosphate dodecahydrate 2.8915 g / L; PH 7.4, 25 °C) and stored at -20 °C for later use.

[0076] 2. Screening of Nucleic Acid Aptamers

[0077] 1) Construction of Tumor-bearing Mouse Model

[0078] Inject ovarian cancer cells ID8 / OVCAR4 cells into the peritoneal cavity of C57 mice / nude mice to construct an in-situ peritoneal metastasis model;

[0079] 2) In vivo screening

[0080] Take a random single-stranded nucleotide library, centrifuge at 13,000 rpm for 10 minutes to centrifuge the library to the bottom of the tube, dilute it to 2 μM with PBS buffer solution, and dispense it into PCR tubes for denaturation-renaturation treatment. The treatment process is as follows: Set the program of the PCR instrument to 95 °C for 10 minutes. The purpose of this step is to unwind the folded single strand, then keep it at 4 °C for 5 minutes, and then keep it at room temperature (25 °C) for 5 minutes. Subsequently, inject the treated library (100 μL) into the body through the tail vein of the mouse, and then monitor the Cy5 fluorescence of the mouse to observe the enrichment of the library. The total observation time is 1 h, and the interval is 10 min; After the monitoring is completed, sacrifice the mouse, collect the tumor tissue, place the tissue in a petri dish and rinse it several times with PBS, use a surgical blade to alternately cut it, cut the tissue into small pieces of 1-2 mm, transfer it into a 2 mL EP tube, add 1.5 mL of calcium- and magnesium-free PBS to resuspend the tissue, then add 30 μL of collagenase, mix well and incubate at room temperature for about 5 minutes, pipette the tissue until it becomes viscous, remove large tissue through a 200-mesh sieve, centrifuge at 250 G to recover the cells, then add 200 μL of red blood cell lysate, mix well, incubate at 4 °C for about 3 minutes, centrifuge to remove the supernatant, and wash the cell pellet 1-2 times with PBS. Finally, add 200 μL of cell lysate, incubate with the cells at 4 °C for 5 min, centrifuge and take out the supernatant, labeled as elution.

[0081] Use the nucleic acid molecules in elution as templates and amplify them by PCR. The method is as follows: Add all the template elution to 2 mL of PCR mix and mix well. Divide the mixture into 100 μL / tube and add it to PCR tubes. The amplification conditions are as follows: Pre-denaturation at 95 °C for 2 minutes, denaturation at 95 °C for 1 minute, annealing at 60 °C for 1 minute, extension at 72 °C for 1 minute, a total of 34 cycles, and store at 4 °C. The formula of PCR mix is shown in Table 2.

[0082] Table 2 Formula of PCR mix

[0083] Reagent Total Volume 1000 μL Ultra-pure Water 875 μL dNTP 20 μL Pfu Enzyme 4 μL Enzyme buffer 100 μL Forward Primer 0.5 μL Reverse Primer 0.5 μL

[0084] The amplified products were purified with n-butanol: All PCR products were collected in a 50 mL conical bottom centrifuge tube, and approximately 5 volumes of n-butanol were added. The mixture was shaken on a vortex mixer to mix well; using a tabletop centrifuge, centrifuge at 9000 rpm (revolutions per minute) at 25 °C for 10 minutes; discard the upper phase (n-butanol) to obtain concentrated PCR amplification products. Add TBE / urea denaturing buffer in a volume ratio of 1:1, and boil for 15 minutes to denature the DNA. Subsequently, perform urea-denaturing polyacrylamide gel electrophoresis on all samples. Electrophorese at 400 V until the bromophenol blue reaches the bottom of the gel to separate the extended Cy5-labeled strand from the reverse strand. The formulation of the denaturing polyacrylamide gel is shown in Table 3.

[0085] Table 3 Formulation of denaturing polyacrylamide gel

[0086] Component Dosage Urea 3.78g 40% Polyacrylamide 1.8 mL 5*TBE 1.8 mL <![CDATA[ddH 2 O]]> 2.25 mL 10% APS 60 μl TEMED 15 μl

[0087] Excise and recover the Cy5-labeled strand: Take out the gel and place it on a plastic film. Detect the Cy5-labeled ssDNA with Ex (nm): 650 and Em (nm): 670; use a clean blade to directly cut the target band, transfer the gel strip to a 1.5 mL EP tube and crush it. Add 1 mL of ddH 2 O and boil in a water bath for 10 minutes to transfer the ssDNA in the gel to the solution. Centrifuge to remove the gel fragments and keep the supernatant. The supernatant was purified with n-butanol using the same method as the "purification of amplified products" step. The obtained single-stranded DNA was dialyzed overnight using a 3KD dialysis bag and could be used as the library for the next round of screening.

[0088] During the screening process, qPCR was used to detect the change in the enrichment level of the single-stranded DNA library. When the enrichment level of the single-stranded DNA library meets the requirements, target protein fishing and determination can be carried out. The target protein obtained in this experiment is IGFBP2; then SPR was used to detect the change in the recognition ability of the single-stranded DNA library for the IGFBP2 protein. When the recognition ability of the single-stranded DNA library for the IGFBP2 protein meets the requirements, that is, the binding ability of the screened single-stranded DNA library to the target is higher than that of the library input at the beginning of the screening. The obtained product was analyzed by clone sequencing, and finally, aptamers were obtained.

[0089] In the described screening method, the screening pressure can be gradually increased to enhance the enrichment level of the aptamer screening and shorten the screening process. The increase in screening pressure includes reducing the amount of the input single-stranded DNA library and the incubation time.

[0090] 3. Identification of aptamers

[0091] Analyze and identify the aptamers obtained after multiple screenings. After analyzing the enriched library products by clone sequencing, select several sequences to be synthesized by Sangon Biotech (Shanghai) Co., Ltd. to detect the affinity.

[0092] In subsequent detections, it was determined that 1 sequence had strong binding ability. After truncating this sequence, the aptamer SEQ ID NO.1 was obtained:

[0093] TGCTGGATGTTCCACACTGCCACTCATTTGCCTCTCTCACCACGACTGACACATCCAGC, and after verification, it had an ideal affinity for binding to IGFBP2 protein, and it was named IGFBP2-L21.

[0094] Experimental Example 1

[0095] Detection of Aptamer Affinity

[0096] Suzhou Genechem Co., Ltd. was commissioned to synthesize the aptamer IGFBP2-L21, which was diluted to 500 nM with DPBS buffer.

[0097] 1. Couple the IGFBP2 protein to Channel 2 on the surface of the CM5 chip. The specific method is as follows: First, wash the chip with 50 mM NaOH, inject 20 μL with a flow rate of 10 μL / minute. Then, mix equal volumes of two reagents, EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1 M aqueous solution), and inject 50 μL to activate the chip with a flow rate of 5 μL / minute. Dilute the IGFBP2 protein with 10 mM sodium acetate at pH 3.6 to a final concentration of 50 μg / mL and then inject it. The injection volume is 50 μL and the flow rate is 5 μL / minute. The coupling amount of the IGFBP2 protein is 3000 Ru. After the injection is completed, inject ethanolamine to block the chip with a flow rate of 5 μL / minute and an injection volume of 50 μL. Channel 1 is processed according to the above steps for coupling the his peptide. The activation and blocking steps are exactly the same, serving as a control channel.

[0098] 2. Detection: Use a surface plasmon resonance instrument (GE Healthcare, model: Biacore 8K) to set the detection parameters. The diluted aptamer sample flows through the channel. The aptamer program is as follows: inject 30 μL / minute for 3 minutes, dissociate at 30 μL / minute for 3 minutes, regenerate with 1 M NaCl at 30 μL / minute for 30 seconds, and then inject the diluted nucleic acid aptamer.

[0099] The detection data of the affinity between the aptamer IGFBP2-L21 and the IGFBP2 protein are shown in Figure 2 , and the KD value is shown in Table 4, which illustrates the binding ability of the corresponding nucleic acid aptamer to the target protein IGFBP2. The affinity data indicate that the aptamer IGFBP2-L21 has a strong binding to the IGFBP2 protein.

[0100] Table 4 Affinity between nucleic acid aptamer and IGFBP2 protein

[0101] Aptamer Affinity KD (nM) with IGFBP2 Protein IGFBP2-L21 205 nM

[0102] 3. Binding of nucleic acid aptamer to cells

[0103] The binding and selectivity of IGFBP2-L21 to target cells were characterized by flow cytometry. It was found that the binding ability of IGFBP2-L21 to primary ovarian cancer cell line (PDC3) was better than that to normal ovarian epithelial cells (IOSE80) as a control.

[0104] The conventional operations in the operation steps of the present invention are well known to those skilled in the art and will not be described in detail herein.

[0105] The above-described embodiments have described the technical solutions of the present invention in detail. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, supplements, or substitutions in a similar manner within the scope of the principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A nucleic acid aptamer that binds to IGFBP-2 protein, characterized in that, the nucleic acid aptamer sequence is as shown in SEQ ID NO.1; SEQ ID NO.1: TGCTGGATGTTCCACACTGCCACTCATTTGCCTCTCTCACCACGACTGACACATCCAGC.

2. The use of the nucleic acid aptamer according to claim 1, including at least one of the following: (1) Detecting IGFBP-2 protein; (2) Locating and imaging cells, tissues or living organisms expressing IGFBP-2; (3) Capturing cells or exosomes expressing IGFBP-2; (4) Coupling drugs; (5) Targeted delivery of drugs to tumor cells; (6) Regulating the function of IGFBP-2 protein; (7) Preparing a reagent for detecting IGFBP-2 protein; (8) Preparing an imaging agent; (9) Preparing a drug carrier; (10) Preparing an anti-tumor drug.

Images