KASP markers for allelic variation of the wheat low-affinity nitrate transporter gene TaNPF7.6-1A and their application

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to a wheat low-affinity nitrate transporter gene. TaNPF7.6‑1A KASP markers and their applications. The present invention discovered a site polymorphism at chr1A:355628042 based on the Chinese Spring reference genome v1.0, with a T / G single nucleotide polymorphism. This site can serve as a molecular marker for the wheat low-affinity nitrate transporter gene. Based on this gene sequence information, the present invention developed a KASP molecular marker to detect the SNP polymorphism present in this gene. Specific primers for this KASP marker can effectively genotype germplasms with varying nitrogen efficiency, enabling molecular marker-assisted breeding of nitrogen-efficient germplasms and possessing excellent application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a KASP marker of a wheat low-affinity nitrate nitrogen transporter gene TaNPF7.6-1A and an application thereof. Background Art

[0002] Nitrogen, an essential mineral nutrient for wheat, is a key component of proteins, nucleic acids, hormones, and other nutrients involved in its growth and development. Nitrogen fertilizer has played a significant role in significantly increasing wheat yields. However, excessive nitrogen fertilizer use also poses a problem, particularly in the current cropping model of smallholder farmers, where excessive application of chemical fertilizers is common. Extensive nitrogen fertilizer use has also increased the cost of growing staple crops like wheat and contributed to environmental problems such as soil acidification, groundwater contamination, and increased greenhouse gas emissions. Green, high-yielding, and high-efficiency wheat varieties are key research areas for genetic improvement. Therefore, utilizing nitrogen-efficient genes to provide a theoretical basis and germplasm support for the development of new nitrogen-efficient wheat varieties has become a crucial initiative for the sustainable development of the wheat industry.

[0003] The primary form of nitrogen absorbed by wheat from the soil is nitrate. Nitrate transporters are responsible for absorbing nitrate from the environment and transporting it internally. Four gene families are involved in nitrate transport in plants, including NPF (nitrate transporter 1 / peptide family), NRT2 (nitrate transporter 2), CLC (chloride channel), and SLAC / SLAH (slow anion channel-associated homologues). Comparison with the Chinese spring wheat reference genome identified 46 NRT2 and 331 NPF gene family members in wheat. However, the functions of only a few NRT2 and NPF genes have been studied.

[0004] Most studies on the genetic improvement of wheat nitrogen efficiency have been conducted using transgenic technology, while the discovery and research of superior nitrogen-efficiency genes in wheat itself are relatively rare. This has become a bottleneck restricting the genetic improvement of wheat nitrogen efficiency. Therefore, using candidate gene association analysis methods of the NPF gene family to explore wheat-related nitrogen efficiency genes, develop SNP molecular markers based on the sequence information of candidate genes, and establish a molecular marker-assisted selection process for early hybrid progeny of nitrogen-efficient wheat is of great significance for breeding new nitrogen-efficient wheat varieties and improving breeding efficiency and purpose. Summary of the Invention

[0005] The present invention discovered the wheat low-affinity nitrate transporter gene TaNPF7.6-1A present in the wheat NPF gene family. Based on the gene sequence information, a KASP molecular marker was developed to detect the SNP polymorphism present in the gene. The KASP molecular marker provides technical support for the identification and screening of wheat nitrogen-efficient molecular marker-assisted breeding.

[0006] The present invention adopts the following technical solutions:

[0007] The present invention found that based on the Chinese Spring reference genome v1.0, there is a site polymorphism at chr1A:355628042, and the SNP is T / G. This site can be used as a molecular marker for the wheat low-affinity nitrate transporter gene. In order to apply the SNP allelic variation of this gene to all wheat germplasm resources, it is represented in the present invention as follows: the SNP is located at the 43rd base of the sequence shown in SEQ ID NO:1, and SEQ ID NO:1 is

[0008] 5'-AGAAATGAAACAAAGCTAGCTCCCTCTGTTTGCAGCTGTGCA N ACATCAATACGTCTGAAC-3', where N is T / G.

[0009] The SNP is located on the wheat low-affinity nitrate transporter gene, TaNPF7.6-1A, located on wheat chromosome 1AL. The gene ID is TraesCS1A02G197600. Wheat plants carrying the GG SNP genotype exhibited significantly higher nitrogen efficiency, with significantly higher grain yield, grain nitrogen accumulation, and aboveground nitrogen accumulation compared to plants carrying the TT SNP.

[0010] The present invention provides a product for detecting SNP sites related to the wheat low-affinity nitrate transporter gene TaNPF7.6-1A, the product comprising:

[0011] (1) Detecting molecular markers of SNP sites related to the wheat low-affinity nitrate transporter gene TaNPF7.6-1A; specifically, the KASP molecular marker.

[0012] (2) A primer composition for detecting the molecular marker described in (1); specifically, it may be a KASP primer composition:

[0013] Primer F1, as shown in SEQ ID NO: 2;

[0014] Primer F2, as shown in SEQ ID NO: 3;

[0015] Primer R is shown in SEQ ID NO:4.

[0016] F1: 5'-GAAGGTCGGAGTCAACGGATTGTTCAGACGTATTGATGTA-3';

[0017] F2: 5'-GAAGGTGACCAAGTTCATGCTGTTCAGACGTATTGATGTC-3';

[0018] R: 5'-AGAAATGAAACAAAGCTAGCTCC-3'.

[0019] Among the above primers, 5′-GAAGGTCGGAGTCAACGGATT-3′ is the specific fluorescent sequence HEX;

[0020] 5'-GAAGGTGACCAAGTTCATGCT-3' is the specific fluorescent sequence FAM.

[0021] The KASP primers were used to perform a PCR reaction on the genomic DNA of the wheat material to be tested. The fluorescent color of the PCR amplification product was read to determine the sample genotype. Red represents the genotype GG, and blue represents the genotype TT. The wheat material carrying the GG genotype had significantly higher grain yield, grain nitrogen accumulation, and aboveground nitrogen accumulation than the wheat material carrying the TT genotype. The PCR amplification product of the genotype GG was named TaNPF7.6-1A. GG , whose sequence is shown in SEQ ID NO: 5; the PCR amplification product of genotype TT was named TaNPF7.6-1A TT , whose sequence is shown in SEQ ID NO: 6. The sequence is as follows:

[0022] TaNPF7.6-1A GG :

[0023] 5'-AGAAATGAAACAAAGCTAGCTCCCTCTGTTTGCAGCTGTGCAGACATCAATACGTCTG AAC-3',

[0024] TaNPF7.6-1A TT :

[0025] 5'-AGAAATGAAACAAAGCTAGCTCCCTCTGTTTGCAGCTGTGCATACATCAATACGTCTG AAC-3'.

[0026] (3) A reagent or kit comprising the primer composition described in (2); the reagent or kit contains the KASP primer.

[0027] (4) A probe for a SNP site associated with the wheat low-affinity nitrate transporter gene TaNPF7.6-1A; such as a probe designed based on the SNP site.

[0028] (5) A chip comprising the probe described in (4), such as a wheat liquid phase chip prepared using the above probe.

[0029] The above products can be used in any of the following:

[0030] (1) Identify or assist in identifying nitrogen use efficiency traits in wheat;

[0031] (2) Wheat molecular marker-assisted breeding (can improve breeding accuracy and efficiency);

[0032] (3) Construction of wheat genetic map;

[0033] (4) Analysis of genetic diversity of wheat germplasm resources;

[0034] (5) Identification of wheat germplasm resources.

[0035] The present invention also provides a method for identifying the nitrogen use efficiency trait of wheat, comprising: extracting wheat genomic DNA, using the above-mentioned product to detect the SNP genotype of the wheat material gene TaNPF7.6-1A, and determining the nitrogen use efficiency trait of the wheat based on the genotype; when the SNP genotype of the wheat material gene TaNPF7.6-1A is GG, the wheat material exhibits a nitrogen high efficiency type, and when the SNP genotype of the wheat material gene TaNPF7.6-1A is TT, the wheat material exhibits a nitrogen low efficiency type. Specifically, the extracted wheat genomic DNA can be PCR amplified using the above-mentioned KASP primers to obtain the SNP genotype of the wheat material gene TaNPF7.6-1A.

[0036] The present invention also provides a wheat breeding method, comprising:

[0037] Detecting the SNP genotype of the wheat material gene TaNPF7.6-1A. When the SNP genotype of the wheat material gene TaNPF7.6-1A is GG, the wheat is a nitrogen-efficient type material. When the SNP genotype of the wheat material gene TaNPF7.6-1A is TT, the wheat is a nitrogen-inefficient type material.

[0038] Then, wheat materials with corresponding genotypes are selected as parents for breeding according to the breeding goals.

[0039] The beneficial effects of the present invention are:

[0040] (1) The present invention conducted candidate gene association analysis on 244 wheat varieties from Henan Province, and analyzed the members of the NPF gene family that were significantly associated with wheat nitrogen efficiency-related traits (grain yield GY, grain nitrogen content GNC, straw nitrogen content SNC, grain nitrogen accumulation GNA, aboveground nitrogen accumulation NAA, and nitrogen harvest index NHI) (p>2e -4 , LOD≥3.0), of which TaNPF7.6-1A phenotypic explanation rate was 13.05-38.51%, confirming that this gene is a low-affinity nitrate transporter gene in wheat.

[0041] (2) Based on the SNP polymorphism of TaNPF7.6-1A gene, the present invention develops KASP marker primers for detecting superior allele variation of the gene, which are used to predict the SNP polymorphism of the gene to distinguish wheat germplasm with different nitrogen efficiency. Amplification analysis of 244 wheat varieties in Henan Province showed that the KASP marker divided the above natural population into two haplotypes, namely TaNPF7.6-1A and TaNPF7.6-1A. GG (Nitrogen efficient type), TaNPF7.6-1A TT (Nitrogen inefficient type). TaNPF7.6-1A in 244 natural populations GG 115 parts, TaNPF7.6-1A TT The SNP polymorphism of the AX-111715806 locus was compared with that of the wheat 660K SNP chip scanning results of 244 natural populations, and the SNP polymorphism was consistent.

[0042] (3) T / A cloning and sequencing of the PCR amplification products of Zhengmai 7698 (nitrogen-efficient) and Zhuganqing (nitrogen-inefficient) were performed. Sequence alignment with the Chinese Spring reference genome v1.0 revealed a T / G allele at 43 bp in the amplified product, which is consistent with the physical location of the AX-111715806 locus. This indicates that the developed KASP marker-specific primers can effectively genotype germplasms with different nitrogen efficiency, enabling molecular marker-assisted breeding of nitrogen-efficient germplasms, and have good application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 KASP marker detection and analysis diagram of 244 natural populations of wheat germplasm resources. Red indicates the nitrogen-efficient haplotype TaNPF7.6-1A GG The blue color represents the nitrogen inefficient haplotype TaNPF7.6-1A TT materials.

[0044] Figure 2(a) Sequence alignment of the PCR amplification products of Zhengmai 7698 and Zhuganqing; (b) Blast alignment of the sequence of the PCR amplification product of Zhengmai 7698 in the EnsemblPlants database; (c) Blast alignment of the sequence of the PCR amplification product of Zhuganqing in the EnsemblPlants database.

[0045] Figure 3 Nitrogen use efficiency-related traits of 244 natural populations of wheat germplasm resources. (a) Grain nitrogen accumulation per unit area (GNA1) under normal nitrogen treatment in 2018; (b) Grain nitrogen accumulation per unit area (GNA3) under normal nitrogen treatment in 2018; (c) Grain yield per unit area (GY1) under normal nitrogen treatment in 2018; (d) Grain yield per unit area (GY1) under normal nitrogen treatment in 2019; (e) Manhattan plot of candidate gene association analysis for nitrogen use efficiency per unit area (NAA3) under normal nitrogen treatment in 2019. The horizontal dotted line indicates the significance threshold (LOD) of the association analysis of 3. TaNPF7.6-1A is a nitrogen-efficient candidate gene detected in the present invention.

[0046] Figure 4 Nitrogen-efficient haplotype TaNPF7.6-1A GG and nitrogen-low efficiency haplotype TaNPF7.6-1A TT Comparison of grain yield (GY), grain nitrogen accumulation per unit area (GNA) and aboveground nitrogen accumulation (NAA) under different nitrogen treatments (normal nitrogen treatment NPK, low nitrogen treatment PK). DETAILED DESCRIPTION

[0047] The present invention is described in more detail below through specific implementation methods to facilitate understanding of the technical solution of the present invention, but is not intended to limit the scope of protection of the present invention.

[0048] 1. Identification of the wheat low-affinity nitrate transporter gene TaNPF7.6-1A

[0049] A total of 244 wheat germplasm resources (including 134 local varieties in Henan Province and 110 modern bred varieties) were used as research materials (the 244 wheat germplasms in Henan Province were provided by the molecular breeding team of Henan Institute of Crop Molecular Breeding, and the public can obtain them from the molecular breeding team of Henan Institute of Crop Molecular Breeding). After scanning the wheat 660K SNP chip (Zhongyu Gold Marker (Beijing) Biotechnology Co., Ltd.) to determine the genotyping information, based on the previous chromosomal physical locations of 331 NPF gene family members (see Wang, H., Wan, Y., Buchner, P., King, R., Ma, H., and Hawkesford, MJ (2020). "Phylogeny and gene expression of the complete NITRATE TRANSPORTER 1 / PEPTIDE TRANSPORTER FAMILY in Triticum aestivum." Journal of Experimental Botany, 71(15), 4531-4546.), SNP markers within 2000bp upstream and downstream of each member of the NPF gene family were analyzed and selected, and a total of 1053 effective SNPs were screened out to construct the whole-genome genetic map of the NPF gene family members. Nitrogen absorption-related traits, including grain yield (GY), grain nitrogen content (GNC), straw nitrogen content (SNC), grain nitrogen accumulation (GNA), aboveground nitrogen accumulation (NAA), and nitrogen harvest index (NHI), were investigated under different nitrogen levels in 2018 and 2019. Combining the above-mentioned genotype information and phenotypic traits, candidate gene association analysis was performed using the IIIVmrMLM association analysis method (for methods, see the reference Li, M., Zhang, YW, Xiang, Y., Liu, MH, and Zhang, YM (2022). "IIIVmrMLM: The R and C++ tools associated with 3VmrMLM, a comprehensive GWAS method for dissecting quantitative traits." Mol Plant, 15(8), 1251-1253.) to detect the effects of major quantitative trait loci (QTNs). The results of association analysis revealed 12 stably expressed significant loci, including one significant locus AX111715806 on chromosome 1AL, mapped to the gene TaNPF7.6, with phenotypic explanatory effect values ranging from 13.06 to 32.94%, suggesting that the gene is a wheat low-affinity nitrate transporter gene ( Figure 3 ).

[0050] Table 1. 244 wheat germplasm resources

[0051]

[0052]

[0053]

[0054] Note: The origins of the different varieties of the same name in the farm varieties are marked in Table 1.

[0055] 2. Genotyping of 244 natural populations of wheat germplasm using KASP markers

[0056] 2.1. Development of KASP-specific primers using the SNP polymorphism AX111715806

[0057] Based on the polymorphism of the significant SNP site AX111715806 and its physical location in the Chinese Spring reference genome v1.0, we selected 50 bp of sequence upstream and downstream of the SNP site and used this sequence to design specific KASP marker primers. The KASP marker primers were synthesized by Sangon Biotech Co., Ltd.

[0058] The KASP primer sequences are as follows:

[0059] Primer F1, as shown in SEQ ID NO: 2;

[0060] Primer F2, as shown in SEQ ID NO: 3;

[0061] Primer R is shown in SEQ ID NO:4.

[0062] F1: 5'-GAAGGTCGGAGTCAACGGATTGTTCAGACGTATTGATGTA-3';

[0063] F2: 5'-GAAGGTGACCAAGTTCATGCTGTTCAGACGTATTGATGTC-3';

[0064] R: 5'-AGAAATGAAACAAAGCTAGCTCC-3'.

[0065] Among the above primers, 5′-GAAGGTCGGAGTCAACGGATT-3′ is the specific fluorescent sequence HEX;

[0066] 5'-GAAGGTGACCAAGTTCATGCT-3' is the specific fluorescent sequence FAM.

[0067] 2.2. Typing of TaNPF7.6-1A haplotypes using KASP technology

[0068] The KASP reaction system was carried out according to the instructions of the KASP TF V4.0 2× Master Mix kit. The components of KASP Assay Mix were mixed in the following proportions: F1 Primer: F2 Primer: R Primer: ddH2O in a 100 μM solution at a ratio of 12:12:30:46.

[0069] 5uL reaction system: contains 2.5μL wheat genomic DNA template (50~100ng·μL -1 ), 2.5 μL of 2×KASP Master Mix, and 0.07 μL of KASP Assay Mix.

[0070] PCR reactions were performed in an LGC Hydrocycler instrument using the following procedure:

[0071]

[0072] After the PCR reaction, the fluorescence color was read in the OMega software of Fluostar Omega SNP, and the KASP marker typing results were viewed in the KlusterCaller software.

[0073] According to the above steps, the SNP polymorphism of 244 natural populations of wheat germplasm resources was analyzed using the developed KASP markers ( Figure 1 ), and the specific genotyping results are shown in Table 2.

[0074] Red indicates the nitrogen-efficient haplotype TaNPF7.6-1A GG , containing 115 materials;

[0075] The blue color represents the nitrogen-inefficient haplotype TaNPF7.6-1A TT , containing 129 materials.

[0076] According to the KASP detection of TaNPF7.6-1A corresponding SNP site polymorphism and nitrogen use efficiency related phenotypic data, the results showed that the nitrogen high efficiency haplotype TaNPF7.6-1A GG The grain yield (GY), grain nitrogen accumulation per unit area (GNA) and aboveground nitrogen accumulation (NAA) under different nitrogen treatments were significantly higher than those of the nitrogen-inefficient haplotype TaNPF7.6-1A. TT ( Figure 4). This indicates that the KASP marker can detect the SNP polymorphism on the TaNPF7.6-1A gene to distinguish nitrogen-efficient and nitrogen-inefficient materials.

[0077] Table 2. KASP genotyping results of 244 wheat germplasm resources

[0078]

[0079]

[0080]

[0081] 3. Sequencing of PCR amplification products

[0082] 3.1 PCR amplification primer design

[0083] Based on the 50 bp sequences upstream and downstream of the SNP site described in 2.1, PCR-specific amplification primers were designed. The primer sequences are shown in SEQ ID NO: 4 and SEQ ID NO: 7. The PCR amplification primers were synthesized by Sangon Biotech Co., Ltd.

[0084] Primer F3, as shown in SEQ ID NO:7;

[0085] Primer R is shown in SEQ ID NO:4.

[0086] F3: 5'-GTTCAGACGTATTGATGT-3';

[0087] R: 5'-AGAAATGAAACAAAGCTAGCTCC-3'. The amplified product sequence size is 61 bp.

[0088] 3.2 PCR reaction system

[0089] A reaction system (Table 3) was established using 2×Tks Gflex DNA Polymerase (TaRaKa) and specific PCR primers. PCR amplification conditions were as follows: 94°C for 1 min, followed by 30 cycles (98°C for 10 s, 55°C for 15 s, and 68°C for 30 s), and 72°C for 10 min. PCR products were electrophoresed on a 3% agarose gel in 1×TBE running buffer, stained with DNA green nucleic acid stain, and photographed on a Bio-Rad gel imaging system.

[0090] Table 3. PCR reaction system

[0091] 2×Gflex PCR buffer 25 μL F3 Primer (100 μM) 1.5 μL RPrimer (100 μM) 1.5 μL Wheat genomic DNA 2.0 μL Tks Gflex DNA Polymerase 1.0μL <![CDATA[dd H2O]]> 19 μL Total volume 50 μl

[0092] According to the above steps, the designed PCR specific primers were used to amplify and electrophoretically analyze one material (Zhengmai 7698 and Zhuganqing) carrying nitrogen high-efficiency and nitrogen low-efficiency haplotypes in 2.2. After confirming the presence of the target band, the PCR reaction solution was subjected to T / A cloning sequencing. The results showed that the amplification product of the primer pair shown in SEQ ID NO: 4 and SEQ ID NO: 7 in Zhengmai 7698 was: 5'-AGAAATGAAACAAAGCTAGCTCCCTCTGTTTGCAGCTGTGCAGACATC AATACGTCTGAAC-3', and the amplification product in Zhuganqing was: 5'-AGAAATGAAACAAAGCTAGCT CCCTCTGTTTGCAGCTGTGCATACATCAATACGTCTGAAC-3'. The sequencing results were aligned with the corresponding Chinese Spring reference genome Chinese Spring v1.0 sequence using DNAMAN software ( Figure 2 ), the sequencing results further verified the SNP polymorphism of TaNPF7.6-1A gene and the effectiveness of developing KASP markers.

[0093] The embodiments described above are only preferred embodiments of the present invention and do not limit the scope of implementation of the present invention. Therefore, any equivalent changes or modifications made according to the structure, characteristics and principles described in the patent scope of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. Used to detect low-affinity nitrate transporter genes in wheat TaNPF7.6-1A The product of the SNP site is characterized by The SNP site is located at the 43rd base of the sequence shown in SEQ ID NO: 1, and SEQ ID NO: 1 is AGAAATGAAACAAAGCTAGCTCCCTCTGTTTGCAGCTGTGCA N ACATCAATACGTCTGAAC, where N is T or G; The products include: (1) Used to detect low-affinity nitrate transporter genes in wheat TaNPF7.6-1A A primer composition for a SNP site; the primer composition comprises: Primer F1 as shown in SEQ ID NO: 2; Primer F2 as shown in SEQ ID NO: 3; Primer R as shown in SEQ ID NO:4; (2) A reagent or kit comprising the primer composition described in (1).

2. The product according to claim 1, characterized in that In the primer composition, 5'-GAAGGTCGGAGTCAACGGATT-3' is the sequence of the HEX fluorescent group; 5'-GAAGGTGACCAAGTTCATGCT-3' is the sequence of the FAM fluorescent group.

3. Use of the product according to claim 1 in any of the following: (1) Identify or assist in identifying nitrogen use efficiency traits in wheat; (2) Wheat molecular marker-assisted breeding, the breeding trait is nitrogen use efficiency difference; (3) Identification of wheat germplasm resources, with the identified trait being differences in nitrogen use efficiency; In (1), (2) or (3), when the wheat material gene TaNPF7.6-1A When the genotype of the SNP site is GG, it shows nitrogen high efficiency type. TaNPF7.6-1A When the genotype of the SNP site is TT, it exhibits a nitrogen inefficient type.

4. A method for identifying nitrogen use efficiency traits in wheat, characterized in that: include: Extract wheat genomic DNA and use the product described in claim 1 to detect wheat material genes TaNPF7.6-1A The genotype of the SNP site is determined according to the genotype, and the nitrogen use efficiency trait of wheat is determined; when the wheat material gene TaNPF7.6-1A When the genotype of the SNP site is GG, it shows nitrogen high efficiency type. TaNPF7.6-1A When the genotype of the SNP site is TT, it exhibits a nitrogen inefficient type.

5. The method according to claim 4, characterized in that Utilizing the method for detecting the low-affinity nitrate transporter gene in wheat as claimed in claim 1 TaNPF7.6-1A The extracted wheat genomic DNA was amplified by PCR using the primer combination of the SNP site to obtain the wheat material gene TaNPF7.6-1A The genotype of the SNP site.

6. A wheat breeding method, characterized in that: include: Detecting wheat material genes using the product according to claim 1 TaNPF7.6-1A Genotype of SNP loci, wheat material gene TaNPF7.6-1A When the genotype of the SNP site is GG, the wheat is a nitrogen-efficient type material. TaNPF7.6-1A When the genotype of the SNP site is TT, the wheat is a nitrogen-low-efficiency type material; According to the breeding objectives, wheat materials with corresponding genotypes are selected as parents for breeding.

Images