Preparation method and application of 3α-steroid dehydrogenase

Abstract

This application discloses a preparation method and application of 3α-steroid dehydrogenase. The present invention provides a method for expressing 3α-steroid dehydrogenase based on a prokaryotic expression system. This method, through source screening combined with synonymous codon preference optimization, increases soluble protein expression and maintains high expression product activity, making it suitable for industrial production.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a preparation method and application of 3α-steroid dehydrogenase. Background Art

[0002] 3α-Hydroxysteroid dehydrogenase (3α-HSD) is a steroid dehydrogenase secreted by Pseudomonas testis. It acts on a variety of substrates and reversibly catalyzes the redox reaction of the 3-hydroxyl / keto group of C19-27 steroids. Clinically, 3α-HSD is used to measure total bile acids (TBA) in human serum. Bile acids are important components of bile, primarily found in the enterohepatic circulation, where they play a crucial role in fat metabolism. Only a small portion of bile acids enters the peripheral circulation, promoting gallbladder contraction and small intestinal peristalsis. Serum total bile acid levels can sensitively reflect the presence of hepatocyte lesions and liver function impairment. Elevated levels are commonly seen in various diseases, including acute and chronic hepatitis, hepatitis B virus carriers, and alcoholic hepatitis. They can also be seen in conditions such as cirrhosis, obstructive jaundice, and cholestatic jaundice. In disease diagnosis, TBA is the only serum marker that can simultaneously reflect the state of liver secretion, synthesis and extraction, and hepatocyte damage.

[0003] Currently, the enzyme cycling assay for measuring serum bile content is suitable for routine testing due to its simplicity, low cost, high sensitivity, non-contaminating reaction products, and strong anti-interference ability. According to the principle of the enzyme cycling assay for serum bile testing, 3α-steroid dehydrogenase is a key reactant. Bile acids are specifically oxidized by 3α-steroid dehydrogenase and thio-oxidized coenzyme I (Thio-NAD) to produce 3-ketosteroids and thio-reduced coenzyme I (Thio-NADH). 3-Ketosteroids, under the action of 3α-HSD and reduced coenzyme I (NADH), form bile acids and oxidized coenzyme I (NAD). Bile acids are amplified during multiple cycles, and the generated Thio-NADH is also amplified. Total bile acid content can be calculated by measuring the change in the absorbance of Thio-NADH at 405 nm.

[0004]

[0005]

[0006] However, the extraction process for natural 3α-HSD is complex, and the extract is high in impurities. Purification requires multiple steps of chromatography and preparative isoelectric focusing electrophoresis, resulting in tedious steps, low yields, and loss of enzyme activity during the purification process. More importantly, 3α-HSD is difficult to separate from β-HSD, and the resulting 3α-HSD is expensive, limiting its widespread clinical application. Therefore, a method for genetically engineered expression of 3α-steroid dehydrogenase is needed to achieve stable, large-scale production. Summary of the Invention

[0007] The object of the present invention is to provide a method for preparing 3α-steroid dehydrogenase.

[0008] Another object of the present invention is to provide a polynucleotide sequence encoding 3α-steroid dehydrogenase.

[0009] Another object of the present invention is to provide a vector compatible with the polynucleotide sequence encoding 3α-steroid dehydrogenase.

[0010] Another object of the present invention is to provide a kit containing a polynucleotide sequence encoding 3α-steroid dehydrogenase.

[0011] To solve the above technical problems, the first aspect of the present invention provides a polynucleotide encoding 3α-steroid dehydrogenase, wherein the polynucleotide is codon-optimized and selected from any one of the following:

[0012] (i) a polynucleotide having a sequence as shown in SEQ ID NO.1 or SEQ ID NO.3;

[0013] (ii) a polynucleotide having a homology of greater than 95% to the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 3; and

[0014] (iii) a polynucleotide complementary to the polynucleotide sequence described in (i) or (ii).

[0015] In a second aspect, the present invention provides an expression vector comprising the polynucleotide provided in the first aspect of the present invention.

[0016] In some preferred embodiments, the expression vector is an Escherichia coli expression vector, more preferably pET-28a(+).

[0017] The third aspect of the present invention provides a host cell, wherein the host cell comprises the expression vector provided in the second aspect of the present invention; or

[0018] The polynucleotide provided in the first aspect of the present invention is integrated into the genome of the host cell.

[0019] In some preferred embodiments, the host cell is Escherichia coli.

[0020] In some preferred embodiments, the host cell is Escherichia coli BL21 (DE3) strain.

[0021] The fourth aspect of the present invention provides a method for preparing 3α-steroid dehydrogenase, the method comprising the steps of: culturing the host cell according to the third aspect of the present invention to express the target protein; and

[0022] separating the target protein to obtain the 3α-steroid dehydrogenase;

[0023] In some preferred embodiments, the host cell is obtained by transforming Escherichia coli with a plasmid containing the polynucleotide described in the first aspect of the present invention.

[0024] In some preferred embodiments, the host cells are cultured using SB, TB, LB, or SOC culture medium, and more preferably, the host cells are cultured using TB culture medium.

[0025] In some preferred embodiments, the host cells are cultured in a shaking environment.

[0026] In some preferred embodiments, the host cells are cultured at a temperature of 16 to 19°C or 35 to 39°C, more preferably at a temperature of 16 to 19°C.

[0027] In some preferred embodiments, when culturing the host cell, the culture medium used contains a kanamycin resistance gene.

[0028] In some preferred embodiments, when culturing the host cells, IPTG is used for induction to express the target protein.

[0029] In some preferred embodiments, when culturing the host cells, the cells are cultured until the OD600 is between 0.6 and 0.8, and then induced with IPTG to express the target protein.

[0030] In some preferred embodiments, the step of separating the target protein comprises:

[0031] The supernatant of the crushed target protein is eluted through the chromatography column simultaneously with the mobile phase, and the eluate is collected.

[0032] In some preferred embodiments, the chromatography column is a Ni-column affinity chromatography column (Ni-NTA).

[0033] The fifth aspect of the present invention provides a kit, which comprises: the polynucleotide provided in the first aspect of the present invention; or

[0034] The expression vector provided in the second aspect of the present invention; or

[0035] The host cell according to the third aspect of the present invention; or

[0036] Or the 3α-steroid dehydrogenase prepared by the method according to the fourth aspect of the present invention.

[0037] Compared with the prior art, the present invention has at least the following advantages:

[0038] The present invention provides a method for expressing 3α-steroid dehydrogenase based on a prokaryotic expression system. The method improves the expression amount of soluble protein and maintains high activity of the expression product through source screening combined with synonymous codon preference optimization, and is suitable for industrial production.

[0039] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] One or more embodiments are exemplarily described by the figures in the corresponding drawings, and these exemplified descriptions do not constitute limitations on the embodiments.

[0041] Figure 1 This is an SDS-PAGE identification image of the product of 3α-steroid dehydrogenase derived from Pseudomonas in TB medium according to an embodiment of the present invention (the recombinant plasmid contains optimized codon I);

[0042] Figure 2 This is an SDS-PAGE identification diagram of the product of human 3α-steroid dehydrogenase expressed in TB culture medium according to an embodiment of the present invention;

[0043] Figure 3 Electrophoresis diagram of 3α-steroid dehydrogenase derived from Pseudomonas according to an embodiment of the present invention;

[0044] Figure 4 This is an electrophoretic diagram of human 3α-steroid dehydrogenase according to an embodiment of the present invention;

[0045] Figure 5 This is a standard curve diagram for measuring the activity of 3α-steroid dehydrogenase according to an embodiment of the present invention;

[0046] Figure 6 This is an SDS-PAGE identification diagram of the 3α-steroid dehydrogenase expression product derived from Pseudomonas according to an embodiment of the present invention (the recombinant plasmid contains optimized codon III). DETAILED DESCRIPTION

[0047] After extensive and in-depth research, the inventors screened a wide range of bacterial species for expression of soluble 3α-steroid dehydrogenases, including recombinant 3α-steroid dehydrogenases from Pseudomonas and human sources. Activity testing yielded recombinant 3α-steroid dehydrogenases with excellent activity. Furthermore, based on the gene sequences of these soluble 3α-steroid dehydrogenase-expressing bacteria, they optimized synonymous codon preferences in various ways, resulting in increased soluble protein expression.

[0048] Obtain target gene / target protein related nucleic acid sequence

[0049] The full-length nucleotide sequence or fragments of the target protein or its components in the present invention can generally be obtained by PCR amplification, recombinant methods, or synthetic methods. For PCR amplification, primers can be designed based on publicly available nucleotide sequences, particularly open reading frame sequences, and amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates to obtain the relevant sequences. Long sequences often require two or more PCR amplifications, followed by splicing the fragments amplified in the correct order.

[0050] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods.

[0051] In addition, the sequences can also be synthesized by artificial synthesis, especially when the fragment length is shorter. Usually, a long fragment can be obtained by synthesizing multiple small fragments and then connecting them.

[0052] Methods using PCR technology to amplify DNA / RNA are preferably used to obtain the genes of the present invention. Primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein and can be synthesized using conventional methods. Amplified DNA / RNA fragments can be separated and purified using conventional methods, such as by gel electrophoresis.

[0053] Identical proteins from different biological sources have different amino acid sequences. Gene sequences derived from target proteins from different sources often result in recombinant expression products with unpredictable functional activities. In one embodiment of the present invention, the amino acid sequences of target proteins from a large number of different sources are analyzed using the NCBI database to obtain target gene sequence information from these sources. In some examples, 3α-steroid dehydrogenases from Pseudomonas and humans were analyzed using the NCBI database to obtain the corresponding 3α-steroid dehydrogenase gene sequence information.

[0054] Synonymous codon preference optimization

[0055] In order to overcome the potential problem of reduced yield when expressing heterologous proteins in Escherichia coli, the present invention relates to a polynucleotide sequence optimized for synonymous codon preference. The obtained target gene sequence is subjected to synonymous codon preference optimization, and the target gene sequence optimized for synonymous codon preference can express the same amino acid sequence as the target protein. In some embodiments of the present invention, several optimized codons are obtained by optimizing the synonymous codon preference of the 3α-steroid dehydrogenase gene sequence from Pseudomonas, exemplified by the optimized codon I shown in SEQ ID NO: 1 and the optimized codon III shown in SEQ ID NO: 3. In another embodiment, several optimized codons are obtained by optimizing the synonymous codon preference of the 3α-steroid dehydrogenase gene sequence from human, exemplified by the optimized codon II shown in SEQ ID NO: 2.

[0056] For target protein genes from the same species, several optimized codons obtained through synonymous codon preference optimization in different ways generally express target proteins with comparable activity in host cells, but at varying levels of expression. In some embodiments of the present invention, codons obtained by optimizing the synonymous codon preference of the 3α-steroid dehydrogenase gene sequence from Pseudomonas sp. in Escherichia coli exhibited significant inclusion body expression, with some soluble expression, exemplified by optimized codons I and III. Under identical conditions, optimized codons that exhibited soluble expression also exhibited significant differences in soluble protein expression, exemplified by optimized codons I and III, where optimized codon I exhibited significantly higher soluble protein expression in E. coli than optimized codon III.

[0057] After optimizing synonymous codon preference, target protein genes from different species exhibit significant differences in activity when introduced into host cells. In one embodiment, the expression products of Pseudomonas-derived optimized codon I and human 3α-steroid dehydrogenase with optimized codon II, after optimization of synonymous codon preference in E. coli, showed significant differences in activity in E. coli, with only the Pseudomonas-derived optimized codon I exhibiting enzymatic activity.

[0058] The present invention also relates to polynucleotides having a homology greater than 80%, preferably greater than 85%, more preferably greater than 90%, more preferably greater than 91%, and more preferably greater than 95% to the sequences shown in SEQ ID NOs: 1-3; and polynucleotides complementary to the sequences shown in SEQ ID NOs: 1-3.

[0059] Target gene vector

[0060] The present invention also relates to vectors comprising the polynucleotides of the present invention. As used herein, "vector" refers to a linear or circular DNA molecule comprising a segment encoding a protein of interest operably linked to other segments that provide for its transcription. Such additional segments may include promoter and terminator sequences and may optionally include one or more origins of replication, one or more selectable markers, enhancers, polyadenylation signals, vectors, and the like. The vector segment may be derived from a host organism, another organism, a plasmid, or viral DNA, or may be synthetic. The vector may be synthetic or any expression vector that is readily amenable to recombinant DNA manipulations, the choice of vector generally depending on the host cell into which the vector is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity whose replication is independent of chromosomal replication, such as a plasmid. Alternatively, the vector may be one that, when introduced into a host cell, integrates into the host cell genome and replicates along with the chromosome into which it is integrated. In one embodiment, the vector of the present invention is an expression vector. In one embodiment of the present invention, pET-28a(+) was selected as the vector to achieve more efficient expression efficiency.

[0061] Methods well known to those skilled in the art can be used to construct expression vectors containing the coding DNA sequence of the protein of the present invention and appropriate transcription / translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, etc. The DNA sequence can be effectively linked to an appropriate promoter in the expression vector to guide mRNA synthesis. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Illustratively, a DNA endonuclease is used to cut the vector DNA molecule into a linear molecule that can be connected to the exogenous gene, and then the codon-optimized target gene fragment is connected to the vector. The insertion of the exogenous DNA fragment can be achieved by selectively ligating the exogenous DNA fragment with a single restriction endonuclease, directional cloning of double restriction endonuclease fragments, ligating the exogenous DNA fragment with different restriction endonuclease sites, blunt end ligation, artificial linker ligation, or oligonucleotide end ligation.

[0062] The vector containing the target gene is transformed into the host cell

[0063] The present invention also relates to host cells produced by genetic engineering using the vectors or fusion protein coding sequences of the present invention. A vector containing a codon-optimized target gene can be inserted, transfected, or otherwise transformed into a host cell using known methods, thereby obtaining a transformant containing the codon-optimized target gene of the present invention and capable of expressing the target protein. In the present invention, a "host cell" is a cell into which an exogenous polynucleotide and / or vector has been introduced. The host cell can be a eukaryotic host cell or a prokaryotic host cell. The host cell is preferably a bacterium, and is preferably Escherichia coli, more preferably the Escherichia coli Rosetta (DE3) strain.

[0064] Method for preparing target protein

[0065] The present invention also relates to a method for preparing a target protein, which can be expressed or produced using the polynucleotide sequence of the present invention. Generally, the following steps are involved:

[0066] (1) transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding a protein of the present invention, or a recombinant expression vector containing the polynucleotide;

[0067] (2) host cells cultured in a suitable culture medium;

[0068] (3) Isolate and purify proteins from culture medium or cells.

[0069] Among them, in step (1), the transformation or transduction of a suitable host cell with the recombinant expression vector containing the polynucleotide can be carried out by conventional techniques well known to those skilled in the art. When the host is Escherichia coli, heat shock method and electroporation method can be used.

[0070] The transformant obtained can be cultivated with a conventional method, and expresses the polypeptide encoded by the gene of the present invention. According to the host cell used, the culture medium used in the cultivation can be selected from various conventional culture media, and is preferably SB, TB, LB or SOC culture medium. Under the condition that is suitable for host cell growth, cultivate. After the host cell grows to a suitable cell density, induce the promoter selected with a suitable method (such as temperature conversion or chemical induction), and the cell is cultivated for a period of time. For promoting the expression of the target protein and promoting the expression of soluble protein, a preferred embodiment of the present invention uses the host cell cultivated with TB or LB culture medium, and contains the kanamycin resistance gene in the culture medium used.

[0071] In order to further promote the soluble expression of the target protein, in a preferred embodiment of the present invention, the host cells are cultured to an OD 600After the pH value reaches 0.6-0.8, IPTG is used for induction, and the culture is continued for about 8-12 hours at 17-19° C. or 35-39° C. The soluble expression level is high at a low temperature range, such as 17-19° C.

[0072] The protein in the above method can be expressed in the cell, on the cell membrane, or secreted outside the cell. If necessary, the protein can be separated and purified by various separation methods using its physical, chemical and other properties. Therefore, in the present invention, after successfully culturing to obtain the target protein, it is also related to the steps of separating and purifying it, such as in step (3), separating and purifying the protein from the culture medium to obtain a high-purity target protein. Although the method for purifying the target protein is conventional means well known to those skilled in the art, it includes but is not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultra-treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods. In a preferred embodiment of the present invention, a method for separating a target protein is provided, comprising: eluting the crushed target protein supernatant and a mobile phase simultaneously through a chromatography column, and collecting the eluate; the mobile phase comprises Buffer A, Buffer B and / or Buffer C; wherein Buffer A comprises Tris (50 mM concentration) and NaCl solution (50 mM concentration); Buffer B comprises Tris (50 mM concentration), NaCl solution (50 mM concentration) and imidazole (500 mM concentration); and Buffer C comprises Tris (50 mM concentration) and NaCl solution (1 M concentration).

[0073] Preferably, in the elution step, the elution procedure includes a first stage and a second stage; in the first stage, the mobile phase used is Buffer A; in the second stage, the mobile phase used is a mixture of Buffer A and Buffer B, wherein the volume percentage of Buffer A gradually decreases from 100% to 40%, and the volume percentage of Buffer B gradually increases from 0% to 60%.

[0074] More preferably, the elution procedure further includes a third stage, and in the third stage, the mobile phase used is Buffer B.

[0075] The purified target protein product is dialyzed and the dialyzed sample is collected. The concentration of the dialyzed sample can be measured by BCA assay to calculate the yield.

[0076] In the present invention, any exemplary or exemplary wording (e.g., "") provided for certain embodiments herein is used only to better present the present invention and does not limit the scope of the present invention claimed in other ways. Any wording herein should not be interpreted as indicating an element not described in the claims that is indispensable for the implementation of the present invention.

[0077] If a definition or use of a term in a referenced document is inconsistent or inconsistent with the definition of that term as described herein, the definition of that term as described herein applies and the definition of that term in the referenced document does not apply.

[0078] Various terms are used herein as follows. If a term used in a claim is not defined below, it should be given the broadest definition persons in the art have given that term as reflected in printed publications or issued patents at the time of filing.

[0079] As used herein, the term "isolated" refers to a nucleic acid or polypeptide that is separated from at least one other component (e.g., nucleic acid or polypeptide) present in its natural source. In one embodiment, the nucleic acid or polypeptide is found only in the presence of solvents, buffers, ions, or other components that are normally present in a solution thereof, if any. The terms "isolated" and "purified" do not include nucleic acids or polypeptides that are present in their natural source.

[0080] As used herein, the terms "polynucleotide" and "polynucleotide sequence" may be in the form of DNA or RNA. Forms of DNA include cDNA, genomic DNA, or synthetic DNA. DNA may be single-stranded or double-stranded. DNA may be a coding strand or a non-coding strand.

[0081] The present invention also relates to variants of the aforementioned polynucleotides, which encode protein fragments, analogs, and derivatives having the same amino acid sequence as the present invention. These polynucleotide variants may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide, which may contain one or more nucleotide substitutions, deletions, or insertions that do not substantially alter the function of the encoded polypeptide.

[0082] As used herein, the term "codon optimization" refers to a method for improving gene synthesis efficiency by avoiding the use of low-utilization or rare codons based on the differences in codon usage exhibited by organisms actually expressing or producing proteins (including Escherichia coli, yeast, mammalian blood cells, plant cells, insect cells, etc.).

[0083] As used herein, the terms "homology" and "identity" are used interchangeably and refer to the percentage of identical (i.e., identical) nucleotides or amino acids between two or more polynucleotides or polypeptides. The sequence identity between two or more polynucleotides or polypeptides can be measured by the following method. The nucleotide or amino acid sequence of a polynucleotide or polypeptide is arranged, and the number of positions containing identical nucleotides or amino acid residues in the arranged polynucleotide or polypeptide is scored, and compared with the number of positions containing different nucleotides or amino acid residues in the arranged polynucleotide or polypeptide. A polynucleotide can be different in one position, for example, according to comprising different nucleotides (i.e., replacement or variation) or deletions of nucleotides (i.e., insertion or deletion of one or two nucleotides in a polynucleotide). A polypeptide can be different in one position, for example, by containing an amino acid (i.e., replacement or variation) or deletion of an amino acid (i.e., insertion of an amino acid or amino acid deletion in one or two polypeptides). Sequence identity can be calculated by dividing the number of positions containing identical nucleotides or amino acid residues by the total number of amino acid residues in a polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the identical nucleotide or amino acid residue by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

[0084] As used herein, the terms "sequence complement" and "reverse sequence complement" are used interchangeably to refer to a sequence that is in the opposite direction of the original polynucleotide sequence and is complementary to the original polynucleotide sequence. For example, if the original polynucleotide sequence is ACTGAAC, then its reverse complement sequence is GTTCAT.

[0085] As used herein, the term "expression" includes any step involved in the production of a polypeptide in a host cell, including but not limited to transcription, translation, post-translational modification, and secretion. After expression, the host cells or expression products may be harvested, i.e., recovered.

[0086] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are usually based on conventional conditions or the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight. The experimental materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.

[0087] Unless otherwise specified, the technical and scientific terms used herein have the same meaning as commonly understood by ordinary technicians in the technical field to which this application belongs. It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments of this application.

[0088] Example 1

[0089] In this example, plasmids containing optimized codons encoding 3α-steroid dehydrogenases from Pseudomonas and human were synthesized and introduced into Escherichia coli to obtain single clones.

[0090] (1) Construction of 3α-steroid dehydrogenase plasmid

[0091] The gene sequence of Pseudomonas 3α-steroid dehydrogenase was obtained and optimized for the synonymous codon preference of Escherichia coli to obtain optimized codon I (SEQ ID NO.1), which was ligated into the pET-28a(+) vector and commissioned to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis.

[0092] The gene sequence of human 3α-steroid dehydrogenase was obtained and optimized for synonymous codon preference in Escherichia coli to obtain optimized codon II (SEQ ID NO. 2). This was then ligated into the pET-28a(+) vector and synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.

[0093] (2) Introduction of recombinant plasmid into host Escherichia coli

[0094] Take 1 μL of the expression plasmid prepared in step (1) above and add it to 30 μL of competent E. coli BL21 (DE3) in an ice bath. Place it on ice for 30 minutes, then in a 42°C water bath for 45 seconds. Immediately place it on ice for 2 minutes, add 400 μL of antibiotic-free SOC medium, and culture it at 37°C with shaking at 230 rpm for 45 minutes. Take 100 μL of the bacterial solution and evenly spread it on an LB plate containing 100 μg / mL kanamycin resistance and culture it in a 37°C incubator overnight.

[0095] SEQ ID NO.1

[0096] TCTGTAATCGCTATTACCGGTTCTGCATCTGGCATCGGTGCAGCCCTGAAAGAACTGCTGGGCGTGCTGGTCACACCGT

[0097] CATCGGTATCGATCGCGGCCAGGCGGATATTGAAGCAGACCTGTCCACTCCAGGCGGTCGTGAAACCGCTGTTGCGGCTG

[0098] TTCTGGATCGCTGTGGTGGTGTACTGGACGGCCTGGTCTGCTGTGCTGGTGTAGGTGTTACCGCGGCTAACTCCGGCCTG

[0099] GTGGTTGCTGTGAACTACTTCGGTGTGTCTGCACTGCTGGACGGTCTGGCTGAAGCACTGAGCCGTGGTCAACAGCCGGC

[0100] AGCTGTAATCGTAGGCTCTATCGCAGCTACCCAGCCGGGTGCTGCTGAACTGCCTATGGTTGAAGCTATGCTGGCCGGCG

[0101] ACGAAGCACGTGCAATCGAACTGGCGGAACAACAGGGTCAGACCCACCTGGCATACGCAGGTTCTAAATACGCAGTCACC

[0102] TGTCTGGCGCGCCGTAACGTTGTTGACTGGGCGGGTCGTGGTGTTCGCCTGAACGTAGTAGCTCCGGGTGCTGTTGAAAC

[0103] TCCACTGCTGCAGGCTTCTAAAGCGGATCCGCGCTATGGTGAAAGCACTCGTCGTTTCGTAGCTCCGCTGGGTCGTGGCT

[0104] CTGAACCACGTGAAGTTGCTGAAGCGATTGCTTTCCTGCTGGGTCCGCAGGCCTCTTTCATTCATGGCTCCGTGCTGTTC

[0105] GTTGACGGCGGCATGGATGCTCTGATGCGTGCAAAAACGTTC

[0106] SEQ ID NO.2

[0107] ATGGACTCCAAACATCAGTGCGTAAAGCTGAACGACGGTCACTTTATGCCTGTTCTGGGCTTCGGCACTTATGCCCCAGC

[0108] GGAAGTGCCTAAAAGCAAAGCACTGGAGGCAACTAAACTGGCAATCGAGGCAGGCTTTCGCCACATTGATAGCGCGCACC

[0109] TGTATAACAACGAAGAACAGGTCGGCCTGGCAGTTCGTAGCAAAATCGCTGACGGTAGCGTTAAACGTGAAGATATCTTC

[0110] TACACCTCTAAACTGTGGTGCAACTCTCATCGTCCGGAGCTGGTTCGTCCGGCTCGGAACGTTCTCTGAAAAAGCGCA

[0111] GCTGGACTACGTTGACCTGTACCTGATCCACTCTCCGATGAGCCTGAAACCTGGTGGAAGAGCTGAGCCCGACCGACGAAA

[0112] ACGGTAAAGTGATCTTCGACATTGTGGATCTGTGCACCACTTGGGAGGCGATGGAAAAATGCAAGGACGCTGGTCTGGCG

[0113] AAATCTATTGGCGTATCTAACTTCAATCGTCGTCAGCTGGAAATGATTCTGAACAAACCAGGTCTGAAATATAAACCGGT

[0114] GTGCAACCAGGTAGAATGCCACCCGTATTTCAACCGTTCTAAACTGCTGGACTTCTGCAAATCCAAAGACATCGTACTGG

[0115] TTGCTTATTCCGCCCTGGGCAGCCAACGTGACAAACGCTGGGTAGATCCGAACAGCCCGGTTCTGCTGGAAGACCCGGTA

[0116] CTGTGCGCTCTGGCGAAAAAACATAAACGTACTCCGGCGCTGATTGCACTGCGTTATCAGCTGCAGCGTGGTGTGGTGGT

[0117] TCTGGCAAAAAGCTACAACGAACAGCGTATCCGCCAGAACGTTCAAGTATTCGAATTCCAGCTGACCGCTGAAGACATGA

[0118] AAGCGATTGATGGCCTGGATCGTAACCTGCACTACTTCAACTCTGACTCCTTTGCCAGCCACCCGAATTATCCGTACTCT

[0119] GACGAATAC

[0120] Example 2

[0121] In this example, two different monoclonal clones prepared in Example 1 were separately inoculated into TB medium containing 100 μg / mL kanamycin resistance aseptically, cultured at 37°C with shaking at 220 rpm until the OD600 reached between 0.6 and 0.8, induced with IPTG, and cultured at 37°C and 18°C ​​with shaking overnight. Samples were ultrasonically broken and identified by SDS-PAGE. The identification results are shown in Figure 2. Figure 1 and Figure 2 .

[0122] As shown in the figure, both Pseudomonas-derived and human-derived 3α-steroid dehydrogenases with optimized codons were expressed in the supernatant at 18°C. (3α-steroid dehydrogenase has a molecular weight of 25.8 kDa)

[0123] Example 3

[0124] Single clones of Pseudomonas and human 3α-steroid dehydrogenases were selected for expansion and purification. Approximately 5 g of recombinant cells were weighed and dispersed in 25 ml of Lysis Buffer on ice using a dispersant. Cells were disrupted by sonication using a Φ10 probe, 10% power, 5.5 seconds on, 9.9 seconds off, for 30 minutes. Centrifuge at 20,000 rpm at 4°C for 30 minutes, collect the supernatant, and filter through a 0.22 μm membrane. Purification was performed using 1 ml of Ni-NTA. The mobile phase composition was prepared as shown in Table 2, with a flow rate of 0.5 ml / min. After sample loading, the UV and conductivity sensors were rinsed to baseline with 20 ml of Lysis Buffer. The elution program included the following: Step 1: 0% B, 10 CV, 1.5 ml / min; Step 2: 0–60% B, 15 CV, 2 ml / min; Step 3: 100% B, 10 CV, 1.5 ml / min.

[0125] Table 2

[0126] Reagents BufferA BufferB BufferC Lysis Buffer Tris 50mM 50mM 50mM 50mM NaCl 50mM 50mM 1M 300mM Glycerol - - - - Imidazole - 500mM - - pH 8.0 8.0 8.0 8.0

[0127] After collecting the sample, the electrophoresis results are as follows Figure 3 and Figure 4 shown.

[0128] from Figure 3It can be seen that 3α-steroid dehydrogenase from Pseudomonas can be attached to the column and began to elute at a concentration of 150mM imidazole. According to the SDS results, eluent 2A10-2B4 was selected for dialysis. After dialysis, 9ml of sample was obtained and the concentration was measured by BCA. The result was: R 2 =0.995, its concentration is 7.43 mg / ml, the yield is 66.87 mg, and the yield is 13.84 mg / g bacteria.

[0129] from Figure 4 It can be seen that the human 3α-steroid dehydrogenase samples collected from 14 to 26 were combined and mixed together, a total of 13 ml, and the concentration was measured by BCA, and the result was: R 2 =0.996, its concentration is 2.23 mg / ml, the yield is 28.99 mg, and the yield is 7.24 mg / g bacteria.

[0130] Example 4

[0131] In this example, purified Pseudomonas-derived and human-derived 3α-steroid dehydrogenases were used for subsequent enzyme activity detection experiments. The specific steps are as follows:

[0132] (1) Solution preparation

[0133] 1M Tris-HCl pH 8.2: Weigh 121.14 g of Tris powder into a 1 L beaker and add sterile purified water to 800 mL. Stir thoroughly, then adjust the pH to 8.2 with concentrated hydrochloric acid at 25°C. Bring the volume to 1 L, filter through a 0.22 µm filter, and store at 4°C.

[0134] 17.5 mM DL-Cystathionine: Dissolve 0.0388 g DL-Cystathionine and 0.0605 g Tris in water, adjust the pH to 8.0, and dilute to 10 mL.

[0135] 20 mM androsterone: Weigh 0.03 g of androsterone powder and dissolve it in 5 mL of anhydrous ethanol. Protect from light.

[0136] 100mM NAD+: Weigh 0.066g NAD+ powder and dissolve it in 1mL deionized water. Protect from light.

[0137] Refer to Table 2 for the preparation of 5 mL of working solution.

[0138] Table 2

[0139] Reagents Add volume Final concentration 1M Tris-HCl 0.1mL 20mM 20 mM androstenone 16.7μL 0.07mM 100mM NAD+ 50 μL 1mM ddH2O 4833.3μL

[0140] Preparation of positive enzyme: Dissolve the positive enzyme (3α-steroid dehydrogenase at a concentration of 63 U / mg) in PBS pH 7.4 buffer to prepare 1 U / μL enzyme solution, and then dilute it stepwise according to a gradient. The diluent is PBS pH 7.4 buffer.

[0141] (2) Instrument detection

[0142] Preheat the microplate reader for 30 minutes, add 100 μL of reaction solution, and detect the absorbance at 340 nm. Add 1 μL of enzyme diluent to the blank group, add 1 μL of enzyme solution of each concentration, shake and mix for 5 seconds, react for 1 minute, and detect the absorbance at 340 nm. Draw the standard curve. Figure 5 The blank group is marked as A1 and the test group is marked as A2. Calculate the OD difference between the sample and the blank, A2-A1, and calculate the sample concentration based on the difference. The results are shown in Table 3

[0143] Table 3

[0144]

[0145] The purified recombinant 3α-steroid dehydrogenase from Pseudomonas aeruginosa has a concentration of 7.43 mg / mL and an average activity of 0.0645 U / μL, resulting in a specific activity of (0.0645*1000) / 7.43 = 8.68 U / mg. However, human recombinant 3α-steroid dehydrogenase showed no enzyme activity.

[0146] Comparative Example 1

[0147] In this comparative example, the optimized codons with the highest expression level were obtained by screening the optimized codons of 3α-steroid dehydrogenase derived from Pseudomonas.

[0148] The 3α-steroid dehydrogenase gene sequence from Pseudomonas was selected and optimized for synonymous codon preference different from that in Example 1 to obtain a large number of optimized codons, exemplified by the optimized codon III shown in SEQ ID NO. 3. A recombinant plasmid was synthesized in the same manner as in Example 1, and the recombinant plasmid was cultured and the expression product was purified by referring to the methods of Examples 2 and 3. The SDS-PAGE image of the expression product of the recombinant plasmid containing the optimized codon III in TB medium is shown in FIG. Figure 6 20 g of bacteria were weighed and purified by 5 mL nickel column. The purified product was collected and the concentration was measured by BCA. The result was: R 2 =0.995, its concentration is 1.22 mg / ml, the volume is 42 mL, the yield is 51.24 mg, and the yield is 2.56 mg / g bacteria.

[0149] SEQ ID NO.3:

[0150] AGTGTGATTGCTATTACCGGATCCGCTTCAGGTATTGGAGCTGCACTGAAAGAACTGTTAGCGAGAGCAGGGCATACGGT

[0151] AATTGGCATAGATCGCGGCCAGGCGGATATCGAAGCCGATCTTAGCACTCCGGGCGGTAGAGAAACAGCCGTAGCTGCGG

[0152] TGTTGGATCGCTGTGGTGGCGTTCTGGACGGCCTTGTATGCTGTGCGGGAGTTGGCGTAACAGCAGCTAATAGTGGCCTC

[0153] GTCGTCGCTGTGAACTATTTTGGCGTATCTGCTTTATTAGATGGATTAGCTGAGGCCTTGTCTAGAGGCCAACAGCCAGC

[0154] CGCAGTCATAGTCGGCTCAATTGCGGCAACACAACCTGGAGCCGCAGAACTCCCGATGGTTGAAGCCATGTTAGCCGGAG

[0155] ATGAGGCTCGTGCAATTGAGTTAGCAGAACAGCAAGGACAGACGCATCTTGCTTACGCAGGAAGCAAGTATGCGGTGACG

[0156] TGTCTTGCGAGACGCAATGTAGTCGATTGGGCTGGTAGAGGCGTTCGGCTTAATGTTGTGGCTCCGGGAGCTGTGGAAAC

[0157] CCCGTTGTTACAGGCATCCAAAGCCGATCCACGCTACGGGGAAAGTACCCGGAGATTTGTTGCTCCATTAGGACGCGGCA

[0158] GTGAACCGCGGGAAGTTGCTGAAGCGATTGCTTTTCTCTTAGGGCCTCAAGCCTCATTCATTCATGGGTCCGTCCTGTTT

[0159] GTGGATGGTGGCATGGATGCATTAATGCGTGCAAAAACATTT

[0160] Those skilled in the art will appreciate that the above-mentioned embodiments are specific examples for implementing the present invention, and that in actual applications, various changes may be made thereto in form and detail without departing from the spirit and scope of the present invention.

Claims

1. An isolated polynucleotide encoding a 3α-steroid dehydrogenase, characterized in that The polynucleotide is codon-optimized and is the polynucleotide shown in SEQ ID NO.

1.

2. An expression vector, characterized in that: The expression vector comprises the polynucleotide according to claim 1, and the expression vector is an Escherichia coli expression vector.

3. The expression vector according to claim 2, characterized in that The expression vector is pET-28a(+).

4. A host cell, characterized in that The host cell is Escherichia coli; and the host cell comprises the expression vector according to claim 2 or 3; or the polynucleotide according to claim 1 is integrated into the genome of the host cell.

5. A method for preparing 3α-steroid dehydrogenase, characterized in that: The method comprises the steps of: Transforming an Escherichia coli host cell with a vector containing the polynucleotide according to claim 1; The host cell is cultured to express the 3α-steroid dehydrogenase.

6. The method according to claim 5, characterized in that The host cells were cultured using TB medium.

7. The method according to claim 5, characterized in that The host cells are cultured at a temperature of 16 to 19°C.

8. The method according to claim 5, characterized in that When the host cells are cultured, they are induced by IPTG to express the target protein.

9. A kit, characterized in that The kit comprises: the polynucleotide according to claim 1; or The expression vector according to claim 2 or 3; or The host cell according to claim 4.

Images