An accurate gene editing method with high efficiency and low off-target rate

Abstract

The present invention discloses a precise gene editing method with high efficiency and low by-products. The method of the present invention utilizes an enzyme (such as FnCas12a) that can cleave DNA and generate strict sticky ends, fuses a high-fidelity ligase (such as Human DNA Ligase III), and forms a multimer in the form of (FnCas12a-ligase) n by interacting proteins, co-transfects cells with a donor plasmid capable of generating corresponding sticky ends, achieves efficient and precise gene editing, and simultaneously eliminates accidental insertions or deletions. The method involved in the present invention has extremely low cytotoxicity to cells, can be repeatedly performed in multiple rounds of editing to further improve the efficiency of precise gene editing to a greater extent. The precise gene editing method involved in the present invention is applicable not only to dividing cells but also to non-dividing cells.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering. Specifically, it relates to a precise gene editing method with high efficiency and low off-target rate. Background Art

[0002] The CRISPR-Cas system is the most commonly used gene editing tool at present. The CRISPR-Cas gene editing system is essentially a single-stranded RNA-guided specific endonuclease system. After it cuts at a specific position in the genome and generates a DNA double-strand break (DSB), the cell's own DNA repair system needs to participate in the repair to complete the entire gene editing process. The cell mainly repairs DSB through two DNA repair mechanisms: non-homologous end joining (NHEJ) and homologous recombination repair (HDR). NHEJ is a more major DNA repair pathway and plays a crucial role in the survival of cells. When a DSB occurs in the cell genome, generally the NHEJ pathway will reconnect the broken ends together most quickly and directly. HDR is another indispensable precise repair method in cells. Usually, the HDR pathway is only activated when the cell is in the S / G2 phase. Compared with the NHEJ repair method that can function in most periods of the cell, the precise repair efficiency mediated by the HDR pathway is very low.

[0003] Currently, precise long-fragment gene editing technologies mainly rely on HDR repair to achieve, but the main problems are: the editing efficiency is very low, and accidental insertions or deletions (Indels) are inevitably generated at the editing sites. Additionally, there is a precise knock-in method based on Cas9 and the NHEJ repair pathway: homology-independent targeted integration method (HITI). Although the HITI method greatly improves the gene insertion efficiency, since it uses Cas9 for gene editing and Cas9 generates a blunt-ended DSB after cutting genomic DNA, it is difficult to avoid Indels at the insertion point, seriously affecting the precision of gene editing. Therefore, there is currently no precise gene editing method that can achieve high-efficiency gene editing while avoiding the generation of Indels. Summary of the Invention

[0004] The purpose of the present invention is to provide a new fusion protein and a precise gene editing method, which can avoid the generation of accidental mutations, insertions or deletions while ensuring high-efficiency precise gene editing.

[0005] In the first aspect of the present invention, a fusion protein is provided, and the structure of the fusion protein is shown as formula W1, W2, W3, W4, W5 or W6 as follows:

[0006] C-L (W1)

[0007] L-C(W2)

[0008] A-B-C-L (W3)

[0009] A-C-L-B (W4)

[0010] C-A-L-B (W5)

[0011] C-L-A-B (W6)

[0012] Wherein,

[0013] C is a gene editing protein,

[0014] L is an optional high-fidelity ligase,

[0015] A and B are two interacting proteins. A and B can also be the same protein that can form a homodimer or multimer,

[0016] Each "-" is independently a linker peptide (rigid or flexible linker peptide), peptide bond or non-peptide bond.

[0017] Furthermore, the gene editing protein is selected from the group consisting of: Cas12a, Cas12b, Cas12f, Cas14 or a combination thereof.

[0018] Furthermore, the gene editing protein includes a wild-type or mutant gene editing protein.

[0019] Furthermore, the gene editing protein is selected from the group consisting of: Francisella novicida, Lachnospiraceae bacterium, Acidibacillus sulfuroxidans, Acidaminococcus sp.

[0020] In another preferred example, the amino acid sequence of the wild-type gene editing protein is as shown in SEQ ID NO.: 1.

[0021] In another preferred example, the amino acid sequence of the high-fidelity ligase is as shown in SEQ ID NO.: 2 or 3.

[0022] In another preferred example, the two interacting proteins are selected from the group consisting of: Scfv, GCN4, or a combination of multiple GCN4s. The amino acid sequence of Scfv is as shown in SEQ ID NO.: 4; the amino acid sequence of GCN4 is as shown in SEQ ID NO.: 5.

[0023] In another preferred example, the linker peptide has a sequence of n repeats of Gly Gly Gly Gly Ser, where n is 2 - 8, preferably n is 3 - 5.

[0024] In a second aspect of the present invention, there is provided a precise gene editing method with high efficiency and low by-products. The method of the present invention utilizes an enzyme (such as FnCas12a) that can cleave genomic DNA to generate strict sticky ends, fused with a high-fidelity ligase (such as Human DNA Ligase III or vaccinia virus ligase), and forms a (FnCas12a-ligase) n form of multimer, which is co-transfected into cells with a donor plasmid that can generate corresponding sticky ends, achieving efficient and precise gene editing while almost eliminating indels.

[0025] Furthermore, the gene editing is to knock out, insert, mutate, and perform any combination on chromosomal genes using gene editing tools.

[0026] Furthermore, the cell is one of animal cells, plant cells, bacteria, or fungi.

[0027] The method involved in the present invention has extremely low cytotoxicity to cells and can perform multiple rounds of gene editing repeatedly, thereby greatly improving the gene editing efficiency.

[0028] Furthermore, the precise gene editing method involved in the present invention is applicable not only to dividing cells but also to non-dividing cells.

[0029] The present invention provides the following technical solutions.

[0030] 1. Construct the fusion protein expression vector described in the first aspect.

[0031] 2. According to the gene editing purpose, design a donor sequence for the sticky ends generated by cleaving the genome.

[0032] 3. Design two kinds of CrRNAs for cleaving the genome; design another two kinds of CrRNAs for cleaving the donor sequence. It should be noted that the designed CrRNAs should be in opposite directions and the PAM site should be at the excised position.

[0033] 4. Construct the CrRNA cluster transcribed by three types of promoters such as the U6 promoter or H1 promoter and the donor sequence in the donor plasmid.

[0034] 5. Co-import the fusion protein expression vector and the donor plasmid into cells to obtain gene-edited cells.

[0035] 6. Preliminary gene editing efficiency detection can be carried out after 48 - 72 hours, and secondary editing can also be carried out.

[0036] In the third aspect of the present invention, a polynucleotide is provided, and the polynucleotide encodes the fusion protein described in the first aspect of the present invention. Further, the polynucleotide additionally contains auxiliary elements selected from the following group on the flanks of the mutant protein or fusion protein: signal peptide, secretion peptide, tag sequence (such as 6His), or a combination thereof.

[0037] Further, the polynucleotide is selected from the following group: DNA sequence, RNA sequence, or a combination thereof.

[0038] In the fourth aspect of the present invention, a vector is provided, and the vector contains the polynucleotide described in the third aspect of the present invention.

[0039] Further, the vector contains one or more promoters, and the promoter is operably linked to the nucleic acid sequence, enhancer, transcription termination signal, polyadenylation sequence, replication origin, selection marker, nucleic acid restriction site, and / or homologous recombination site.

[0040] Further, the vector includes a plasmid, a viral vector.

[0041] Further, the viral vector is selected from the following group: adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, herpes virus, poxvirus, or a combination thereof.

[0042] In the fifth aspect of the present invention, a gene editing reagent is provided, and the gene editing reagent contains the fusion protein described in the first aspect of the present invention.

[0043] Further, the reagent further includes one or more reagents selected from the following group:

[0044] (a1) gRNA, crRNA, or a vector for generating the gRNA or crRNA;

[0045] (a2) A template for "cut-and-paste" repair: single-stranded nucleotide sequence or plasmid vector.

[0046] In the sixth aspect of the present invention, a kit is provided, including the gene editing reagent described in the fifth aspect of the present invention.

[0047] Further, the kit further includes one or more reagents selected from the following group:

[0048] (a1) gRNA, crRNA, or a vector for generating the gRNA or crRNA;

[0049] (a2) A template for "cut-and-paste" repair: single-stranded nucleotide sequence or plasmid vector.

[0050] The seventh aspect of the present invention provides a use of the fusion protein described in the first aspect of the present invention for preparing a reagent or a kit, and the reagent or the kit is used for improving gene editing efficiency while reducing Indels.

[0051] The eighth aspect of the present invention provides a pharmaceutical composition, comprising:

[0052] (a) The fusion protein described in the first aspect of the present invention, or its coding gene, or its expression vector;

[0053] (b) A pharmaceutically acceptable carrier.

[0054] Further, the expression vector includes a viral vector.

[0055] Further, the viral vector is selected from the group consisting of: adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, herpes virus, poxvirus, or a combination thereof.

[0056] Further, the dosage form of the pharmaceutical composition is selected from the group consisting of: freeze-dried preparation, liquid preparation, or a combination thereof.

[0057] Further, the dosage form of the pharmaceutical composition is an injection dosage form.

[0058] Further, the pharmaceutical composition further includes other drugs for gene therapy.

[0059] Further, the other drugs for gene therapy are selected from the group consisting of: antisense nucleotide drugs, EDIT 101 drugs, CTX001, or a combination thereof.

[0060] Further, the pharmaceutical composition is a cell preparation.

[0061] The ninth aspect of the present invention provides a medicine box, comprising:

[0062] (a1) A first container, and the fusion protein described in the first aspect of the present invention, its coding gene, or its expression vector, or a drug containing the fusion protein described in the first aspect of the present invention, located in the first container.

[0063] Further, the medicine box further includes:

[0064] (a2) A second container, and other drugs for gene therapy, or a drug containing other drugs for gene therapy, located in the second container.

[0065] Further, the first container and the second container are the same or different containers.

[0066] Further, the drug in the first container is a single-agent preparation containing the fusion protein described in claim 1.

[0067] Further, the drug in the second container is a single-agent preparation containing other drugs for gene therapy.

[0068] Further, the dosage form of the drug is selected from the group consisting of: freeze-dried preparation, liquid preparation, or a combination thereof.

[0069] Further, the dosage form of the drug is an injection dosage form.

[0070] The tenth aspect of the present invention provides a use of the fusion protein described in the first aspect of the present invention for preparing a drug for gene therapy.

[0071] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as in the examples) can be combined with each other to form new or preferred technical solutions. Description of the Drawings

[0072] Figure 1 It is a schematic diagram of the basic principle of this method.

[0073] Figure 2 It is a comparison of the editing efficiency and the accidental insertion and deletion efficiency after the first round of precise editing by four different methods: HDR, FnCas12a-HITI, FnCas12a-Ligase (this method), and Cas9-HITI. It shows that the gene editing efficiency of this method is the highest and the off-target (Indels) rate is almost 0.

[0074] Figure 3 It is a comparison of the editing efficiency and the accidental insertion and deletion efficiency after the second round of precise editing by four different methods: HDR, FnCas12a-HITI, FnCas12a-Ligase (this method), and Cas9-HITI. It shows that the gene editing efficiency of this method is further greatly improved and the Indels rate is still undetectable.

[0075] Figure 4 It is a comparison of the editing efficiency and the accidental insertion and deletion efficiency after the third round of precise editing by four different methods: HDR, FnCas12a-HITI, FnCas12a-Ligase (this method), and Cas9-HITI. It shows that the gene editing efficiency of this method is much higher than other methods and the Indels rate is much lower than other methods. Detailed Embodiments

[0076] After extensive and in - depth research, the present inventor obtained an enhanced fusion protein including but not limited to the sequence shown in SEQ ID NO.: 6. Compared with the wild - type gene - editing protein, the enhanced fusion protein of the present invention can significantly improve the efficiency of precise gene editing. Moreover, the present invention also found that through multiple rounds of editing, the efficiency of precise gene editing can be further greatly improved, and few accidental insertions and deletions are introduced. In addition, the fusion protein of the present invention can be used for gene therapy.

[0077] The term

[0078] The term "CrRNA" refers to the guide RNA that binds to and guides the Cas12a protein to specifically cleave DNA.

[0079] The term "EDIT 101 drug" belongs to gene - therapy drugs and is a type of cell. Specifically, EDIT 101 is a drug for treating hereditary retinal degeneration disease (LCA10 disease) using CRISPR gene - editing technology. EDIT 101 is administered by subretinal injection, delivering the gene - editing system directly into photoreceptor cells to achieve the therapeutic effect.

[0080] The term "CTX001" belongs to gene - therapy drugs and is a type of cell. Specifically, CTX001 is based on CRISPR gene - editing technology and achieves the therapeutic purpose by cleaving the BCL11A gene of patients with β - thalassemia.

[0081] "Wild - type gene - editing protein" refers to a naturally occurring, unmodified gene - editing protein, the nucleotide of which can be obtained through genetic engineering techniques such as genome sequencing, polymerase chain reaction (PCR), etc., and its amino - acid sequence can be deduced from the nucleotide sequence.

[0082] As used herein, the term "high - fidelity DNA ligase" is a double - strand DNA ligase with good fidelity and no sequence specificity. In theory, it can function well only when the sticky ends are completely matched, thereby ensuring the accuracy of gene editing. The sequence of a preferred high - fidelity DNA ligase is shown in SEQ ID NO.: 2 or 3.

[0083] As used herein, the term "fusion protein" also includes variant forms having the above activities and shown in SEQ ID NO.: 6. These variant forms include (but are not limited to): deletion, insertion, and / or substitution of 1 - 3 (usually 1 - 2, more preferably 1) amino acids, and addition or deletion of one or several (usually within 3) amino acids at the C - terminus and / or N - terminus.

[0084] For example, in the art, when substituting amino acids with similar or comparable properties, the function of the protein is generally not altered. Also, adding or deleting one or several amino acids at the C-terminus and / or N-terminus usually does not change the structure and function of the protein.

[0085] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the exemplified embodiments do not limit the present invention.

[0086] Example: Precisely insert the P2A-EGFP gene at the last exon of the GAPDH gene in HEK293T cells and successfully express green fluorescent protein (GFP).

[0087] (1) Design and construct an expression plasmid for the FnCas12a-ligase fusion protein and a donor-CrRNA plasmid. Construct the expression plasmid for the FnCas12a-ligase fusion protein: Construct the fusion protein of FnCas12a-ligase (SEQ ID NO.: 6) in pcDNA3.1. Construct the donor-CrRNA plasmid: According to the sequence at the end position of the CDS region of the GAPDH gene and the design principle of CrRNA, select two appropriate cleavage sites and design the corresponding CrRNA sequences (SEQ ID NO.: 7) AATTTCTACTGTTGTAGATctccttggaggccatgtggg and (SEQ ID

[0088] NO.: 8) AATTTCTACTGTTGTAGATtcatgtaccatcaataaagt. Based on the cleavage sites and the cleavage characteristics of FnCas12a, design the corresponding donor sequence to ensure the continuity of the reading frame. The gene synthesis sequence is as shown in SEQ ID NO.: 9. Based on the donor sequence and the cleavage characteristics of FnCas12a, design the CrRNA for cleaving and processing the donor sequence: (SEQ ID NO.: 10) AATTTCTACTGTTGTAGATcctAagcactctgccatggc and (SEQ ID NO.: 11) AATTTCTACTGTTGTAGATgtgatggtccatgtctgggt. Add the DR sequence between the above CrRNA sequences to facilitate the four CrRNAs transcribed by a single U6 promoter to be processed into four single CrRNAs by the FnCas12a nuclease. Design 3 pairs of corresponding primers covering the four CrRNAs, which are 1f (SEQ ID NO.: 12) ggAATTTCTACTGTTGTAGATctccttggaggccatgtgggAATTTCTACT

[0089] 1r (SEQ ID NO.: 13) CAACAGTAGAAATTcccacatggcctccaaggagATCTACAACAGTAGAAATTccgc

[0090] 2f (SEQ ID NO.: 14) GTTGTAGATtcatgtaccatcaataaagtAATTTCTACTGTTGTAGATcctAagcact

[0091] 2r (SEQ ID NO.: 15) gcagagtgctTaggATCTACAACAGTAGAAATTactttattgatggtacatgaATCTA

[0092] 3f (SEQ ID NO.: 16) ctgccatggcAATTTCTACTGTTGTAGATGtgatggtccatgtctgggtTTTTTTTTC

[0093] 3r (SEQ ID NO.: 17) TCGAGAAAAAAAAacccagacatggaccatcaCATCTACAACAGTAGAAATTgccatg

[0094] Anneal separately to form three dimers with different sticky ends. After phosphorylation with T4PNK, they are ligated to the donor plasmid. Transform competent Escherichia coli, spread on a kanamycin-resistant plate, pick 3 - 5 monoclonal colonies for shaking culture, extract the plasmid for sequencing and compare with the designed recognition sequence to obtain the donor - CrRNA plasmid with correct sequencing. Similarly, use the above similar vector construction method to obtain the FnCas12a plasmid without ligase, the donor plasmid for HDR repair, the Cas9 expression plasmid, and the donor plasmid required for the HITI method. Finally, obtain each plasmid with correct sequencing.

[0095] (2) Co - transfect HEK293T cells with the fusion protein plasmid and the donor - CrRNA plasmid. Seed HEK293T cells in a 24 - well plate. When the cell density reaches 50%, co - transfect the cells with 100 ng of the fusion protein plasmid and 600 ng of the donor - CrRNA plasmid using Lipofectamine 2000. Change the medium after 12 h and continue culturing. Transfect other control groups in the same way as above.

[0096] (3)Detection of the efficiency of the target sequence inserted into the genome and the Indels rate. Cells were harvested 72 h after transfection and divided into three equal parts. The first part was plated again for the second editing. The second part was used for flow cytometry analysis, and the FITC channel was used to analyze the precise editing efficiency. The genomic DNA of the cells was extracted using a genomic DNA extraction kit in the third part. The target region was amplified using the forward primer (SEQ ID NO.:18) GTGGTCTCCTCTGACTTCAAC and the reverse primer (SEQ ID NO.:19) CCAGCAAGAATGTCTCACC. PCR amplification was performed and the Indels efficiency was detected by the T7E1 method. The results are as Figure 2 shown. After the first round of editing, the editing efficiency of FnCas12a-ligase (this method) was comparable to that of FnCas12a-HITI and Cas9-HITI, but no obvious off-target (Indels) was detected by this method. The insertion and deletion accidentally generated by the other three methods were very high, especially Cas9-HITI, which was as high as 20%.

[0097] (4)Perform the second editing and analysis according to the same steps 2 and 3. The results are as Figure 3 shown. After the second round of editing, the editing efficiency of FnCas12a-ligase (this method) was significantly higher than the precise editing efficiency of FnCas12a-HITI and Cas9-HITI, and the off-target (Indels) rate of the FnCas12a-ligase method was very low. The insertion and deletion accidentally generated by the other three methods continued to increase significantly.

[0098] (5)Perform the third editing and analysis according to the same steps 2 and 3. The results are as Figure 4 shown: After the third round of editing, the editing efficiency of FnCas12a-ligase was as high as 36.7%, which was significantly higher than the precise editing efficiency of FnCas12a-HITI and Cas9-HITI, and the off-target (Indels) rate of the FnCas12a-ligase method was very low at 0.8%. The insertion and deletion accidentally generated by the other three methods continued to increase significantly, especially the off-target (Indels) rate of Cas9-HITI was as high as 45%.

Claims

1. A fusion protein, characterized in that, The amino acid sequence is as shown in SEQ ID NO.:

6.

2. A polynucleotide, characterized in that, The polynucleotide encodes the fusion protein according to claim 1.

3. A carrier, characterized in that, The vector contains the polynucleotide according to claim 2.

4. A host cell, characterized in that, The host cell contains the vector according to claim 3, or the polynucleotide according to claim 2 is integrated into its genome.

5. A method for producing the fusion protein according to claim 1, characterized in that, The fusion protein is expressed and / or isolated by culturing the host cell according to claim 4.

6. A gene editing method, characterized in that, Based on the fusion protein according to claim 1, co-transfect cells with a donor plasmid capable of generating corresponding sticky ends.

7. Use of the fusion protein according to claim 1, characterized in that, For the preparation of reagents or kits for gene editing.

Images