A BTA transposon, sugar transporter allele and application thereof
By inserting the BTA transposon into the target gene to form a uORF, the translation efficiency was changed, and a new sugar transporter allele smk was provided, which solved the problem of abnormal corn kernel development caused by the ZmSWEET4c mutation, achieved normal kernel growth and demonstrated a dosage effect.
Patent Information
- Application Number
- CN202211582161.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-09
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2042-12-09
AI Technical Summary
In the existing technology, the ZmSWEET4c mutation causes abnormal development of corn kernels, which cannot grow and develop normally, and there is a lack of effective allele editing methods.
BTA transposon is used to insert into the target gene to form a hairpin structure and generate an upstream open reading frame (uORF), which changes the translation efficiency of the gene and provides a new sugar transporter allele smk. Gene editing is achieved through PCR amplification and gene editing kits.
The normal growth and development of corn kernels was achieved, and a quantitative mutation pathway other than promoter editing was provided. By manipulating the BTA transposon to change translation efficiency, a partially functional sugar transporter allele smk was generated, showing a dosage effect.
Smart Images
Figure CN116218847B_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of biotechnology, and in particular to a BTA transposon, a sugar transporter allele, and applications thereof. Background Art
[0002] Transposons, also known as transposable elements, can jump from one chromosome site to another. This hopping across the genome can cause changes in chromosomal or genetic structure, thereby affecting gene expression and producing a variety of genetic effects. Hence, transposons are also called "jumping genes." Transposons can insert themselves into genes and regulate gene expression, making them a useful tool for transgenic manipulation.
[0003] ZmSWEET4c encodes a hexose transporter that transports glucose or fructose produced by starch hydrolysis into the endosperm to provide nutrients for kernel development. ZmSWEET4c is not only crucial for BETL differentiation but also plays an important role in maize kernel development.
[0004] Existing mutations in ZmSWEET4c all exhibit strong phenotypic changes and prevent normal germination. Therefore, there is an urgent need to construct a new ZmSWEET4c allele that can edit the sugar transporter and enable normal grain growth and development. Summary of the Invention
[0005] In order to address the deficiencies of the prior art, the present application provides a transposon, a sugar transporter allele constructed by the transposon, and applications thereof.
[0006] In the first aspect, the present application provides a BTA transposon, whose nucleotide sequence is shown in SEQ ID NO: 1, wherein the BTA transposon is derived from the smk allele of the naturally mutated ZmSWEET4c gene; the BTA transposon has a 15bp terminal inverted repeat sequence at the end; and after the BTA transposon is inserted into the target gene, an 8bp target site repeat sequence is generated.
[0007] Furthermore, the nucleotide sequence of the BTA transposon forms a hairpin-like structure.
[0008] Furthermore, the BTA transposon generates an upstream open reading frame (uORF) after being inserted into the target gene.
[0009] In a second aspect, the present application provides a method for PCR amplification of a BTA transposon, wherein the nucleotide sequence of the BTA transposon is as shown in SEQ ID NO: 1, and the method comprises the steps of performing PCR amplification using a DNA molecule with the nucleotide sequence shown in SEQ ID NO: 1 as a template and a DNA molecule with the nucleotide sequence shown in SEQ ID NO: 2 and 3 as a primer pair.
[0010] In a third aspect, the present application provides a gene editing kit for changing the translation efficiency of a target gene, wherein the gene editing kit comprises the BTA transposon as described in the first aspect.
[0011] Furthermore, the target gene is selected from at least one of the Zm00001d015912 gene, the TB1 gene, the FEA2 gene, the ZmCCT10 gene, and the ZmDREB1D gene in corn.
[0012] In a fourth aspect, the present application provides a gene editing method, comprising the step of inserting the BTA transposon described in the first aspect into the first exon of a target gene, at a position 5 to 40 bp from the target start codon, preferably 5 to 20 bp. Insertion of the BTA transposon into the target gene terminates translation of the original target gene's start codon ATG and provides a new start codon ATG to initiate translation of the target gene. Optionally, the target gene is selected from at least one of the maize genes Zm00001d015912, TB1, FEA2, ZmCCT10, and ZmDREB1D.
[0013] In the fifth aspect, the present application provides a DNA molecule of a sugar transporter allele smk, wherein the sugar transporter allele smk is obtained by inserting the BTA transposon into the target gene in the first aspect, and the nucleotide sequence of the sugar transporter allele smk is shown in SEQ ID NO: 4.
[0014] In the sixth aspect, a recombinant expression vector comprises a recombinant gene produced by gene editing of a target gene by the BTA transposon described in the first aspect.
[0015] In a seventh aspect, the present application provides the application of the BTA transposon described in the first aspect in corn breeding.
[0016] Compared with the prior art, the advantages and positive effects of the present invention are:
[0017] 1. Precise insertion of the BTA transposon can create an open reading frame (uORF) upstream of a gene, altering its translation efficiency rather than its transcription level. Furthermore, deletion or modification of the BTA can provide a range of translational efficiencies. This provides the possibility of altering translational efficiency by manipulating the BTA and offers an alternative approach to generating quantitative variation beyond the widespread use of promoter editing.
[0018] 2. The sugar transporter allele smk, as a new allele of the ZmSWEET4c gene, can produce a protein with 13 amino acid differences compared to other alleles, which has partial functions and changes the translation efficiency of the gene. The grains can grow and develop normally. Alleles with different copy numbers of smk show grains of different sizes, which has a dosage effect. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 LUC vector construction and activity effect diagram provided in the examples of the present application; wherein, A is a schematic diagram of LUC vector construction, B is the significant reduction of LUC activity of the smk gene, the blue rectangular box represents the BTA transposon, and C is the effect of uORFs on smk translation; the bar graph is the average of three biological replicates, and the error bars represent SD, *: p < 0.05; **: p < 0.01; ns: no difference.
[0020] Figure 2 This is a universal verification of the inhibition of gene translation efficiency by BTA transposon insertion provided in the examples of this application; wherein, A is a schematic diagram of vector construction, B is the inhibition of gene translation after BTA transposon insertion, and C is the lack of effect on gene expression after BTA transposon insertion.
[0021] Figure 3 The complex hairpin structure of BTA and its effect on translation provided in the examples of the present application; wherein, A is the predicted RNA secondary structure of the BTA transposon and its flanking sequences, B is the different effects of deleting sequences of different lengths of the secondary structure on smk translation, C is the inhibition of smk translation by mutated ATG2, the bar graph is the average of three biological replicates, the error bars represent SD, *: p < 0.05; **: p < 0.01; ****: p < 0.0001.
[0022] Figure 4The phenotypic differences between the wild type (WT) and mutant (smk) and the positioning and verification results of smk are provided in the examples of this application; wherein A is a representative ear from self-pollination of a heterozygous plant, the black and red arrows represent the grains of the WT and mutant, respectively, B is a comparison of the 100-grain weight and grain size of the WT and mutant, the WT and smk grains are from the WT plant and the homozygous smk plant, respectively, the P value is from two-tailed t-tests, C is the smk gene based on map-based cloning, in the first A hAT insertion (BTA) was found in the exon. D is the DNA sequence of BTA (lowercase) and part of the flanking region (uppercase). The TSD and TIR of this insertion are underlined. ATG1 is the original start codon of the gene. ATG2 represents a putative ATG provided by BTA. Two predicted upstream open reading frames, uORF1 and uORF2, are also shown. E is the genotype of two CRISPR-based knockout lines, -: deletion, and F is a self-pollinated ear of a heterozygous plant whose mutant allele is identical to E.
[0023] Figure 5 The homozygous selfed ear phenotypes after CRISPR / Cas9 knockout of the Zm00001d015912 gene, as provided in the examples of this application, are shown. A represents the knockout ear genotype confirmed by sequencing. DNA from leaves of T0 transgenic plants was used for sequencing. - indicates a base deletion; + indicates a base insertion. B represents the kernel phenotype after Zm00001d015912 knockout. This is a selfed ear from a T0 plant.
[0024] Figure 6 The smk gene provided in the examples of the present application is a verification of a partially functional allele; wherein, A is a schematic diagram of the hybridization scheme of the smk / smk mutant and the heterozygous D168 / + plant, the red triangle represents the insertion of BTA, and the blue fragment represents the deletion of 168bp. B is the self-pollinated ear of A, C and D are the self-pollinated ears of F1 plants and the genotypes of grains with different phenotypes, the red arrows in D indicate two heterozygous grains (smk / D168), E is the self-pollinated grains of smk / D168 and its corresponding genotypes, F is the self-pollinated ear from smk / tsd, the red arrows indicate two heterozygous grains (smk / tsd), G is the self-pollinated grains of smk / tsd and its corresponding genotypes, +, wild-type allele, smk, allele with BTA inserted, D168, allele with 168 bp deleted, tsd, allele with BTA excised from smk.
[0025] Figure 7Verification that the smk allele provided in the examples of the present application encodes a protein similar to the WT allele; wherein A is the amino acid alignment between WT and smk, B is the IGV view showing that BTA is translated in smk, the red box indicates the position of BTA, and RPKM is used for normalization, C is the Ribo-seq sequences in WT and smk mutants derived from translations of different open reading frames, the number before " / " indicates the number of Ribo-seq reads starting from the indicated ATG, the number after " / " indicates the total number of Ribo-seq reads mapped to ZmSWEET4c, NA, not applicable, it is worth noting that in the smk mutant, most ribosome-protected reads are in the same open reading frame as the predicted start codon within the transposon, and D is the subcellular localization of proteins encoded by WT and smk alleles.
[0026] Figure 8 Verification of the reduced translation efficiency of smk provided in the examples of the present application; wherein A is the relative expression of ZmSWEET4c in WT and smk mutants detected by qRT-PCR (left) and RNA-seq (right), FPKM: fragments per thousand bases of transcription per million mapped reads, B is IGV showing the splicing of ZmSWEET4c in WT and smk mutants, C is the gene translation efficiency in WT and smk mutants, D is sucrose gradient centrifugation to separate WT and smk mutant grain ribosomes, A260: absorbance at 260nm light, E is the proportion of polyribosome-bound mRNA, Origin Graph software was used to calculate the 80S monoribosome and polyribosome peak areas. *, P < 0.05. F is the relative expression level of ZmSWEET4c gene in WT and smk mutant grains detected by Polysome-qPCR. The error bars represent SD. *, P < 0.05. G, WB detection of SMK protein in maize protoplasts. H, WB detection of SMK protein in WT and smk mutant. B73 leaves were used as negative control.
[0027] Figure 9 The mRNA levels of various vectors used in the LUC experiments provided in the examples of this application; P values were obtained by performing two-tailed t-tests by comparing each vector with WT.
[0028] Figure 10 The germination of mutant (smk) and wild type (WT) seeds and plant morphology observations provided in the examples of this application; A is the normal germination of WT and smk mutants; B is the appearance morphology of WT and smk mutant plants. DETAILED DESCRIPTION
[0029] In order to make the purpose, technical solutions and advantages of this application more clearly understood, the present application is further described in detail below with reference to the following examples. It should be understood that the specific examples described herein are merely for the purpose of explaining this application and are not intended to limit this application. Reagents not described in detail in this application are all conventional reagents and can be obtained from commercial channels; methods not specifically described in detail are all conventional experimental methods and can be obtained from the prior art.
[0030] BTA transposon
[0031] 1. Structure and Discovery
[0032] A 156 bp hAT transposon was identified from a naturally mutated material and named BTA (B73 active TE hAT) transposon. The transposon has a 15 bp TIR (terminal inverted repeat) at the end. Figure 4 As shown in the TIR underlined sequence in C, BTA generates an 8 bp TSD (target site repeat sequence) after insertion into the genome. Figure 4 The TSD sequence is shown as the underlined sequence in C, and the BTA sequence is shown as SEQ ID NO: 1.
[0033] 2. Cloning and identification of BTA
[0034] In the present embodiment, the BTA transposon can be obtained by PCR amplification. This method includes extracting genomic DNA from smk material, performing PCR amplification of BTA using the DNA as a template, and sequencing to verify the correctness of the sequence. The primer pairs used in the PCR process are:
[0035] BTA-F: as shown in SEQ ID NO: 2;
[0036] BTA-R: as shown in SEQ ID NO:3.
[0037] In certain embodiments, the BTA transposon sequence can be directly prepared by chemical synthesis.
[0038] In certain embodiments, if the BTA transposon is used for genetic modification, recombinant transformation can be used. To detect BTA transposon insertion, conventional PCR amplification can be performed using primers designed to flank the insertion site. Primers are recommended to amplify a PCR product between 200 and 500 bp. The PCR product of a successful BTA transposon insertion is approximately 160 bp larger than the control without the insertion.
[0039] 3. Functions and uses of BTA transposons
[0040] In the mutant material smk, BTA was inserted into the first exon of the Zm00001d015912 gene, 16 bp downstream of the start codon.
[0041] 3.1 BTA transposon regulates gene translation efficiency
[0042] The present invention provides a dual-luciferase reporter system for exploring the effects of BTA transposon insertion into genes.
[0043] In the embodiment of this application, Figure 1 As shown in A, different alleles of the target gene are inserted into the 35S mini promoter before the sequence encoding luciferase (LUC) to generate a fusion protein; the specific method is:
[0044] The wild-type (WT) and mutant (smk) alleles were ligated into the 35Smini_pGreen_luc_0800 vector, transformed into maize protoplasts, and treated with firefly luciferase and Renilla luciferase. The absorbance was measured to obtain the LUC / RLUC levels of the gene. mRNA was extracted from the protoplasts transformed with the above vectors and subjected to qRT-PCR to obtain the LUC / RLUC mRNA levels of the gene. Results: Figure 1 As shown in B, the LUC / RLUC levels of the smk allele decreased by approximately 24.5-fold compared with the WT allele; Figure 9 As shown in Table 1, the LUC / RLUC mRNA levels showed no significant changes, indicating that the insertion of BTA inhibited the translation efficiency of the gene. The primer pairs used in the qRT-PCR process are shown in Table 1 below.
[0045] Table 1
[0046] Primer name sequence RLuc_qF ggatgataactggtccgcag, as shown in SEQ ID NO: 5 RLuc_qR gcctgatttgcccataccaa, as shown in SEQ ID NO: 6 Luc_qF ttgtggatctggataccggg, as shown in SEQ ID NO: 7 Luc_qR agccacctgatagcctttgt, as shown in SEQ ID NO: 8
[0047] In addition, in the examples of the present application, to verify the effect of BTA transposon insertion on the translation efficiency of other genes, the BTA transposon was inserted into the coding regions of four genes; these four genes are: TB1 regulates maize tiller number and is involved in maize domestication (Studer et al., 2011); FEA2 encodes a protein whose activity is negatively correlated with maize ear row number (Bommert et al., 2013); ZmCCT10 regulates maize flowering time and stalk rot resistance (Yang et al., 2013; Wang et al., 2017); and ZmDREB1D (Zm00001d002618), a homologous gene of Arabidopsis CBF3, is involved in maize cold tolerance (Zeng et al., 2021). The insertion method is similar to that of the smk gene, as follows:
[0048] (1) The insertion site is located in the first exon, close to the start codon ATG of the original gene;
[0049] (2) After the BTA transposon is inserted, the original gene terminates translation prematurely inside the BTA transposon;
[0050] (3) After insertion, Figure 2 As shown in Figure A, the original gene was translated again from the start codon (ATG2) provided by the BTA transposon without changing the original gene's open reading frame. The CDS sequences of these four genes (-BTA) and the CDS sequences after insertion of the BTA transposon (+BTA) were respectively ligated into the 35Smini_pGreen_luc_0800 vector and transformed into maize protoplasts. The LUC / RLUC levels were detected, and mRNA was extracted from the transformed protoplasts for qRT-PCR to detect LUC / RLUC mRNA levels.
[0051] Results: As Figure 2 As shown in Figures B and 2C, after the insertion of the BTA transposon into these four genes, the LUC / RLUC levels were significantly reduced, while the LUC / RLUC mRNA levels did not change significantly. This suggests that the reduction in LUC / RLUC levels is not due to changes in mRNA levels, but rather to reduced translation efficiency.
[0052] The above results indicate that BTA transposons can be used to manipulate the translation of other genes and achieve regulation of host genes at the translation level.
[0053] 3.2 Regulation of protein translation rate by controlling the hairpin structure of BTA and the generated uORF
[0054] BTA affects gene translation mainly in two ways. One factor is that the uORF it produces inhibits gene translation. The other factor is the complex hairpin structure of BTA (such as Figure 3 shown).
[0055] In the examples of this application, the effect of the uORF generated by the insertion of the BTA transposon on the gene was verified; Figure 4 As shown in D, the insertion of the BTA transposon in the smk gene generated two uORFs, and the effects of the two uORFs on the gene were detected.
[0056] In the present application example, the start codons of uORF1 and uORF2 in the smk gene were mutated to TTG (respectively, uORF1 and uORF2), and the start codons of uORF1 and uORF2 were mutated to TTG (respectively, uORF1 and uORF2), and they were connected to the 35Smini_pGreen_luc_0800 vector, and the corn protoplasts were transformed and treated with firefly luciferase and Renilla luciferase, and the absorbance was detected to obtain the LUC / RLUC level of the gene. The mRNA of the protoplasts after the above vector transformation was extracted and qRT-PCR was performed to obtain the LUC / RLUC mRNA level of the gene; the results are shown in FIG. Figure 1 As shown in C, after mutation of uORF1, the level of LUC / RLUC increased significantly, while mutation of uORF2 did not change significantly, and uORF1-2 was similar to uORF1; Figure 9 As shown, there was no significant change in the LUC / RLUC mRNA levels of uORF1, uORF2, and uORF1-2. These results indicate that uORF1 can inhibit the translation of the smk gene.
[0057] In the embodiment of this application, Figure 3 As shown, since the BTA transposon and its flanking sequences have complex secondary structures, which seriously affect the translation of the target gene, in order to verify it, in some embodiments, part of the sequence of the hairpin structure is deleted to detect its effect on the translation of the smk gene. Figure 3 B. Figure 9 As shown in the figure, starting from ATG1 of the smk gene, a 39bp sequence was deleted and named JD1-39, a 120bp sequence was deleted and named JD1-120, and a 129bp sequence was deleted and named JD1-129; compared with smk, the translation efficiency of JD1-39, JD1-120, and JD1-129 was significantly improved; the longer the deleted sequence, the higher the translation efficiency, which indicates that the secondary structure of the BTA transposon can inhibit the translation efficiency of the gene; based on JD1-39 and JD1-120, ATG2 was mutated to TTG (named JD1-39-TTG and JD1-120-TTG, respectively), and the results are shown in the figure. Figure 3 As shown in C, compared with before mutation, the translation efficiency of JD1-39-TTG and JD1-120-TTG decreased after ATG2 mutation.
[0058] These results suggest that BTA transposon insertions generate uORFs and complex secondary structures that affect gene translation efficiency and phenotypic diversity. Furthermore, it is noteworthy that different mutations / deletions can result in a range of translation efficiencies (from 0.1 to 0.7) relative to the original WT allele. This provides the possibility of altering translation efficiency by manipulating BTA and offers an alternative approach to generating quantitative variation besides the widespread use of promoter editing.
[0059] Sugar transporter alleles smk
[0060] This application provides a Sugar transporter alleles smk, which is the ZmSWEET4c allele, the Sugar conversion transporter alleles The sequence of smk is shown in SEQ ID NO:4.
[0061] 1. SMK gene mutation process
[0062] smk is a new allele of the Zm00001d015912 gene. The BTA transposon is inserted into the first exon of the Zm00001d015912 gene, 16 bp away from the start codon. This insertion leads to premature termination of translation of the Zm00001d015912 gene.
[0063] In the embodiment of this application, Figure 4 As shown in D, the BTA transposon provides a new start codon ATG2 to reinitiate translation. Figure 7 As shown in A, the amino acid sequence of the reinitiated translation from ATG2 has 13 amino acid differences at the N-terminus compared to WT, while the rest of the sequence is exactly the same, and the translation efficiency is reduced.
[0064] 2. Verification of smk gene function
[0065] The smk gene is a new allele of the Zm00001d015912 gene. In the examples of this application, Figure 4 As shown in A, a mutant (smk) with smaller grains was found during the breeding process of the inbred line B73; Figure 4 As shown in B, compared with the wild-type (WT) grains, the mutant grains were smaller, the 100-grain weight was significantly reduced, the grain length was significantly shortened, and the grain width was significantly narrowed. Figure 10 As shown in A and B, they can germinate and grow normally.
[0066] In the examples of this application, it was found that Figure 4As shown in A, the segregation ratio of WT and mutant grains in the self-pollinated ears of heterozygous plants was 3:1 (308:81, χ2=3.13, P>0.05), indicating that the small-grain phenotype was caused by a single recessive mutation.
[0067] In the present application, in order to identify the gene of the smk mutant, the smk mutant was mated with the inbred line Mo17 into an F2 segregating population, and the BSR-seq method was used for preliminary positioning; the preliminary positioning results showed that the candidate gene was located between 51,590,060 and 168,226,276 bp on chromosome 5; Figure 4 As shown in C, using 971 mutant kernels in F2, the gene was finely mapped to a 14 Mb region between 118 Mb and 132 Mb.
[0068] In the present application, according to the reference genome of B73 (version 4), there are 102 genes in this region. Figure 4 As shown in C, among the genes specifically expressed in maize kernels, embryos, and endosperms, there was no difference between the Zm00001d015860 gene and the Zm00001d015868 gene, but a BTA insertion was found in the first exon of the Zm00001d015912 gene in the smk mutant. Figure 4 As shown in Figure D, insertion of the BTA transposon leads to premature translation termination of the Zm00001d015912 gene. The Zm00001d015912 gene encodes the ZmSWEET4c protein, a glucose and fructose transporter previously shown to affect grain development in maize and rice (Sosso et al., 2015). Therefore, the results of this example indicate that the Zm00001d015912 gene is a candidate gene for the smk mutant.
[0069] In the embodiment of this application, Figure 4 As shown in Figure E, in order to verify the Zm00001d015912 gene, two guide RNA sequences were designed on its third exon, and a CRISPR vector was constructed to transform the maize inbred line B104; six Zm00001d015912 gene knockout events were obtained, of which two events were heterozygous and four events were homozygous; as shown in Figure E Figure 4 As shown in F, the ears of the two heterozygous plants showed a phenotype of separation between normal kernels and empty pericarp kernels, and the segregation ratio was consistent with 3:1 (184:70, χ2=0.89, P>0.05; 141:57, χ2=1.52, P>0.05). However, the ears of the four homozygous knockout materials showed a phenotype of completely empty pericarp and severe developmental defects, as shown in Figure 5The above results indicate that Zm00001d015912 is the key gene controlling the grain development of the smk mutant.
[0070] In the examples of this application, to further prove that the smk gene is an allele of the Zm00001d015912 gene, such as Figure 6 As shown in Figures A and 6B, a homozygous smk mutant (smk / smk) was hybridized with a heterozygous CRISPR-edited material (D168 / +). According to Mendel's law of inheritance, the F1 generation of fruit ears will have two genotypes, smk / + and smk / D168, in a ratio of 1:1. In addition, the grains will be separated into large and small grains. Figure 6 As shown in Figure B, segregation between large and small kernels was observed in the F1 ear, with a segregation ratio of 1:1 (large kernels: small kernels = 85:88, χ² = 0.82, P > 0.05). The large kernels were genotyped as smk / +, while the small kernels were genotyped as smk / D168. This indicates cosegregation of genotype and phenotype, further confirming that the smk gene is a novel allele of the Zm00001d015912 gene.
[0071] 3. SMK has some functions and dosage effects
[0072] Both the newly constructed homozygous CRISPR / Cas9 mutant and the previously established homozygous uniform-Mu mutant (Sosso et al., 2015) exhibit severely developmentally defective kernels with empty pericarps. Compared to other homozygous mutants, the homozygous smk mutant exhibits small kernels with intact embryos and endosperms, and normal growth and development, suggesting that the smk gene is partially functional. To test whether the smk allele is partially functional, the present examples employed two methods.
[0073] The first method provided in the embodiment of the present application is to plant two types of grains, smk / + and smk / D168, and perform self-pollination. Figure 6 As shown in C, the segregation ratio of large and small grains in the self-pollinated ears of smk / + plants was 3:1 (523:158, χ2=1.18, P>0.05); the genotyping results showed that large grains were of the smk / + or + / + genotype, and small grains were of the smk / smk genotype; Figure 6As shown in Figures D and 6E, in contrast, the three types of kernels in the panicles of the selfed smk / D168 plants segregated in a 1:2:1 ratio (58:100:59, χ2 = 1.34, P > 0.05). Genotyping results showed that small kernels and empty pericarp were genotypes of smk / smk and D168 / D168, respectively, while the intermediate phenotype of small kernels was genotyped by smk / D168. This suggests that the smk allele is allelic to the D168 mutation and that the smk gene is a partially functional allele rather than a loss-of-function allele. Furthermore, two copies of the smk allele can produce larger kernels than one copy, and there may be a dosage effect of the smk allele.
[0074] In the second method provided in the examples of the present application, BTA transposon excision is screened from the smk allele; Figure 6 During the propagation of smk plants, a separate ear with small, empty kernels was found; genotyping of the empty pericarp kernels showed that BTA was excised from the smk allele, leaving a 7-bp footprint that resulted in a frameshift of the original protein (designated the "tsd" allele). This further supports that the smk allele is partially functional; Figure 6 As shown in F and 6G, an intermediate phenotype was also observed between small kernels and empty kernels in this ear, similar to the self-cross of smk / D168; small kernels, intermediate kernels, and empty kernels segregated in a ratio of 1:2:1 (76:131:63, χ2=1.49, P>0.05); Figure 6 As shown in G, the genotyping results showed that their genotypes were smk / smk, smk / tsd and tsd / tsd, respectively, which indicated that there was a dosage effect of the smk allele.
[0075] 4. The smk gene encodes a protein similar to WT but with reduced translation efficiency
[0076] In the examples of this application, in order to gain a deeper understanding of the reasons why the smk allele has partial function, the insertion of the BTA transposon was carefully analyzed. The original ATG protein (ATG1) of the Zm00001d015912 gene ends in BTA, but a new ATG (ATG2) was found in BTA, such as Figure 4 As shown in D; Figure 7 As shown in A, the first 13 amino acids of the predicted protein starting from ATG2 differ from those of ZmSWEET4c encoded by Zm00001d015912.
[0077] In the present application, in order to detect whether this hypothetical protein exists, Figure 7As shown in B, Ribo-seq, which can detect translated mRNA, was performed in the kernels 14 and 20 days after pollination; read coverage of the BTA transposon in the smk mutant was detected at 14 and 20 DAP, indicating that smk can be translated.
[0078] Since the smk allele has two ATGs ( Figure 4 D) are located in two different reading frames. In the present embodiment, the ATG used for read translation was determined; the A-site of each read was determined, and the distance between the site and the start codon ATG was 3n (n is an arbitrary integer); this analysis showed that Figure 7 As shown in C, Ribo-seq reads in the smk gene mainly come from ATG2 (14DAP: 152 / 209, 20DAP: 63 / 202); in contrast, Figure 7 As shown in C, in the WT sample, most reads were derived from ATG1 translation (14 DAP: 1482 / 1816, 20 DAP: 246 / 299).
[0079] The above results further prove that the smk allele can be translated into protein; in addition, Figure 7 Subcellular localization analysis showed that the protein encoded by smk was localized to the plasma membrane, which is consistent with the subcellular localization of WT. Together, these results support that the smk allele is translationally and functional.
[0080] In the examples of this application, in order to explore the specific molecular mechanism by which the smk mutant grains are smaller than the wild-type grains, the expression level and splicing differences of mRNA were studied; the results are as follows Figure 8 As shown in A, both RNA-seq and qRT-PCR showed that the smk mutant had similar RNA expression levels to the WT; in addition, as Figure 8 As shown in B, no difference in RNA splicing was observed between WT and SMK genes; the above indicates that the small granule phenotype is not caused by reduced mRNA levels or abnormal mRNA splicing; another possibility is that the protein level is reduced in the SMK mutant.
[0081] In the present example, to investigate this possibility, two vectors were constructed to express fusion proteins containing the UBI promoter driving the WT or smk allele and the 3xFlag tag, and transiently expressed them in maize protoplasts. Figure 8 As shown in G, as expected, the smk allele produced less protein than the WT allele (the molecular weights of the proteins of WT-3xFlag and SMK-3xFlag are 31.64 kD and 32.41 kD, respectively;).
[0082] In the present application, in order to study whether the smk allele reduces protein abundance compared with WT in vivo, Figure 8 As shown in Figure H, an antibody was generated that can simultaneously detect both WT and SMK proteins. This antibody detected endogenous WT and SMK proteins (molecular weights of 28.28 kD and 29.05 kD, respectively) in maize kernels at 14 days post-translational change (DAP), but no protein was detected in leaves where no mRNA was expressed. SMK protein levels were significantly reduced compared to WT. Taken together, these results indicate that the smk allele produces less protein than the WT allele.
[0083] In the examples of this application, based on the fact that the expression level of the above-mentioned smk was not reduced but the translation level was reduced, it was speculated that its translation efficiency might be reduced. To verify the reduced translation efficiency in smk, RNA-seq at 14DAP and 20DAP was used to calculate the expression level, and Ribo-seq was used to calculate the translation level. The translation efficiency is the translation level divided by the expression level. In fact, Figure 8 As shown in C, the translation efficiency of the smk gene was reduced, especially at 14 DAP.
[0084] In order to further support the above possibility, the present invention carried out Polysome Profiling and qRT-PCR on WT and smk mutant 16DAP grains. By continuously measuring RNA absorbance (A260nm), as shown in FIG. Figure 8 As shown in D, ribosomes were separated in a sucrose gradient and separated at different elution times; Figure 8 As shown in Figure E, the peak areas of 80S monoribosomes and polyribosomes in the two materials were calculated using Origin Graph software. The results showed that in WT, the proportion of mRNA bound to polyribosomes was significantly higher than that in smk mutant. mRNA was extracted from ribosomes separated at different times, and qRT-PCR was performed using a primer that can simultaneously amplify the WT gene and smk allele. The results showed that Figure 8 As shown in Figure F, the WT mRNA is significantly more bound to polysomes than the smk gene. In summary, the results of Ribo-seq, Polysome Profiling, and qRT-PCR indicate that the translation efficiency of the smk allele is reduced. The primer pairs used in the qRT-PCR process are shown in Table 2 below:
[0085] Table 2
[0086] Primer name sequence 15912_qRTF3 tcccgcccgatacatttctc, as shown in SEQ ID NO: 9 15912_qRTR3 gggagaggaagagcacaagg, as shown in SEQ ID NO: 10
[0087] The above is only a preferred specific implementation method of the present application, but the scope of protection of the present application is not limited thereto. Any changes or replacements that can be easily thought of by any technician familiar with this technical field within the technical scope disclosed in this application should be covered by the scope of protection of the present application.
Claims
1. A BTA transposon, the nucleotide sequence of which is shown in SEQ ID NO: 1, wherein the BTA transposon is derived from ZmSWEET4c Natural gene mutation smk allele; the BTA transposon has a 15 bp terminal inverted repeat sequence at the end; after the BTA transposon is inserted into the target gene, an 8 bp target site repeat sequence is generated.
2. The BTA transposon according to claim 1, wherein the nucleotide sequence thereof forms a hairpin structure.
3. The BTA transposon according to claim 1, wherein The BTA transposon generates an upstream open reading frame after being inserted into the target gene.
4. A method for PCR amplification of a BTA transposon, wherein: The nucleotide sequence of the BTA transposon is shown in SEQ ID NO:
1. The method comprises the steps of performing PCR amplification using the DNA molecule with the nucleotide sequence shown in SEQ ID NO: 1 as a template and the DNA molecules with the nucleotide sequences shown in SEQ ID NO: 2 and 3 as a primer pair.
5. A gene editing kit for changing the translation efficiency of a target gene, wherein: The gene editing kit comprises the BTA transposon according to claim 1.
6. The gene editing kit according to claim 5, wherein the target gene is selected from Zm00001d015912 Gene, TB1 Gene, FEA2 Gene, ZmCCT10 Gene, ZmDREB1D At least one gene.
7. A gene editing method for changing the translation efficiency of a target gene, the method comprising the step of inserting the BTA transposon according to any one of claims 1 to 3 into the first exon of the target gene, wherein the insertion position is 5 to 40 bp away from the target start codon; after the BTA transposon is inserted into the target gene, the translation of the start codon ATG of the original target gene is terminated, and a new start codon ATG is provided to initiate the translation process of the target gene.
8. The gene editing method according to claim 7, wherein the target gene is selected from Zm00001d015912 Gene, TB1 Gene, FEA2 Gene, ZmCCT10 Gene, ZmDREB1D At least one gene.
9. A sugar transporter allele smk DNA molecules, in which The sugar transporter allele smk The sugar transporter allele is obtained by inserting the BTA transposon according to any one of claims 1 to 3 into the target gene. smk The nucleotide sequence is shown in SEQ ID NO:
4.
10. A recombinant expression vector comprising a recombinant gene produced by gene editing a target gene using the BTA transposon according to any one of claims 1 to 3.
11. The recombinant expression vector according to claim 10, wherein The recombinant expression vector carries a 35S promoter, a Renilla luciferase gene, a 35Smini promoter, a recombinant gene and a luciferase gene connected in sequence; wherein the recombinant gene and the luciferase gene constitute a fusion expression gene, which is driven by the 35Smini promoter.
12. Use of the BTA transposon according to claim 1 in corn breeding.