Methods for gene editing in soybean using cas12i

Abstract

The application provides a method for gene editing in soybean using Cas12i, the method comprising the step of using Cas12i and gRNA for gene editing in soybean, the gRNA comprising a backbone region combined with Cas12i and a guide sequence hybridized with a target sequence, the gRNA targeting GmFAD2-1A gene and GmFAD2-1B gene of soybean.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for gene editing in soybeans, and more particularly to a method for gene editing in soybeans using Cas12i. Background Technology

[0002] Soybeans are a major source of oil and protein for humans, one of the world's most important economic crops, and a primary source of plant oils and plant-based proteins. With rising living standards and improved dietary habits, the demand for high-quality soybean oil is increasing, making the cultivation of high-quality soybeans a key objective of soybean breeding.

[0003] The CRISPR / Cas9 system is the most commonly used type II CRISPR system. It recognizes the 3'-NGG PAM motif and performs blunt-end cleavage on the target sequence. Site-specific editing of the target gene is achieved through guide RNA-mediated cleavage by the Cas9 protein. This technology not only provides new insights into gene function research but also has wider applications in biomedical research and development and crop genetic improvement. Currently, the CRISPR / Cas9 system has been successfully applied in plants such as Arabidopsis thaliana, rice, maize, wheat, and soybean.

[0004] CRISPR / Cas Type V systems are a newly discovered class of CRISPR systems that possess a 5'-TTN motif and perform sticky end cleavage of target sequences, such as Cpf1, C2c1, CasX, and CasY. However, the different CRISPR / Cas systems currently available each have their own advantages and disadvantages. For example, Cas9, C2c1, and CasX all require two guide RNAs, while Cpf1 only requires one and can be used for multiplex gene editing. CasX is 980 amino acids in size, while the common Cas9, C2c1, CasY, and Cpf1 are typically around 1300 amino acids in size. Furthermore, the PAM sequences of Cas9, Cpf1, CasX, and CasY are relatively complex and diverse, while C2c1 recognizes the strict 5'-TTN, making its target site easier to predict than other systems and thus reducing potential off-target effects.

[0005] Cas12i also belongs to the type V CRISPR / Cas system. Chinese patent (CN111757889B, publication date: 20210525) discloses a type V Cas enzyme (Cas12f.4). In this invention, Cas12f.4 is defined as Cas12i. As described in CN111757889B, this Cas enzyme (Cas12f.4) exhibits certain editing activity in monocotyledonous maize. However, soybeans, unlike maize, are dicotyledonous plants. When the inventors studied the editing activity of this enzyme in dicotyledonous plants (e.g., Arabidopsis thaliana, soybeans, etc.), they found that the enzyme's editing efficiency in dicotyledonous plants was low, and it even failed to exhibit editing activity at certain sites. Summary of the Invention

[0006] The purpose of this invention is to provide a method for gene editing in soybeans using Cas12i.

[0007] On one hand, the present invention provides a method for gene editing in soybeans using Cas12i, the method comprising the steps of gene editing in soybeans using Cas12i and gRNA, wherein the gRNA targets the GmFAD2-1A and GmFAD2-1B genes of soybeans.

[0008] In one embodiment, the amino acid sequence of Cas12i is selected from any one of the following I-III:

[0009] I. The amino acid sequence of Cas12i has at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID No. 1, and essentially retains the biological function of SEQ ID No. 1;

[0010] II. The amino acid sequence of Cas12i, compared with SEQ ID No. 1, has one or more amino acid substitutions, deletions or additions (e.g., substitutions, deletions or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids), and essentially retains the biological function of SEQ ID No. 1.

[0011] III. Cas12i contains the amino acid sequence shown in SEQ ID No. 1 or the amino acid sequence of Cas12i is shown in SEQ ID No. 1.

[0012] In one embodiment, the amino acid sequence of the Cas12i, compared to SEQ ID No. 1, has mutations at amino acids 369 and 433 corresponding to the sequence shown in SEQ ID No. 1; preferably, amino acid 369 is mutated to arginine (Arg, R), and amino acid 433 is mutated to arginine (Arg, R). The aforementioned Cas12i is a mutant Cas12i, a mutant protein in which amino acids 369 and 433 of SEQ ID No. 1 are simultaneously mutated (both mutated to R). Compared to the wild-type Cas12i shown in SEQ ID No. 1, the aforementioned mutant Cas12i protein significantly enhances editing activity.

[0013] In one embodiment, the gRNA includes a first segment and a second segment; the first segment is also referred to as a "backbone region", "protein binding region", "protein binding sequence", or "direct repeat sequence"; the second segment is also referred to as a "target sequence for targeting nucleic acid", "target segment for targeting nucleic acid", or "guide sequence for targeting target sequence".

[0014] The first segment, "backbone region," "protein-binding segment," "protein-binding sequence," or "homogeneous repeat sequence" of the gRNA can interact with the Cas12i protein of the present invention, thereby forming a complex between the Cas12i protein and the gRNA. The gRNA of the present invention guides the interacting Cas12i protein to a specific nucleotide sequence within the target nucleic acid through the targeting sequence of the target nucleic acid.

[0015] The target sequence or target region of the nucleic acid targeted by this invention comprises a nucleotide sequence complementary to a sequence in the target nucleic acid. In other words, the target sequence or target region of the nucleic acid targeted by this invention interacts with the target nucleic acid in a sequence-specific manner through hybridization (i.e., base pairing). Therefore, the target sequence or target region of the nucleic acid targeted by this invention can be altered or modified to hybridize with any desired sequence within the target nucleic acid.

[0016] Preferably, the gRNA comprises a first segment and a second segment in the 5' to 3' direction.

[0017] In this invention, the second segment can also be understood as a guide sequence for hybridization with the target sequence.

[0018] In one embodiment, the guide sequence for the target sequence in the gRNA is ccucauugcauggccaaucuauu (SEQ ID No. 2); the unidirectional repeat sequence in the gRNA is agagaaugugugcauagucacac (SEQ ID No. 3) or cucugaccac cugagagaau gugugcauag ucacacgguauaacaacuuc gacgagcucu (SEQ ID No. 4).

[0019] In other embodiments, the homologous repeat sequence of the gRNA may have base deletions, substitutions, or additions based on SEQ ID No. 3, as long as it can ensure the binding ability with Cas12i, for example, “agagaaugugugcauagucaacac”, “agagaaugugugcauagucuacac”, “agagaaugugugcauaguccacac”, or “agagaaugugugcauagucgacac” as described in Chinese patent application (CN113337502A).

[0020] In one embodiment, the gene editing method of the present invention includes the steps of delivering Cas12i and gRNA into soybean plant cells, soybean seeds, soybean plants, soybean plant tissues, or soybean plant parts.

[0021] The above delivery can be performed using any method known in the art. Such methods include, but are not limited to, transformation, transfection, electroporation, lipid transfection, microinjection, acoustic pore effect, gene gun, calcium phosphate-mediated transfection, cationic transfection, liposome transfection, dendritic transfection, heat shock transfection, nuclear transfection, magnetic transfection, lipid transfection, puncture transfection, optical transfection, reagent-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, viral particles, vectors, viral vectors, artificial viruses, etc.

[0022] In some implementations, one or more AAV vectors, lentiviral vectors, nanoparticles, or combinations thereof are used to deliver one or more components of Cas12i and gRNA.

[0023] In one embodiment, Cas12i and gRNA are delivered to soybean plant cells, soybean seeds, soybean plants, soybean plant tissues, or soybean plant parts via Agrobacterium transformation.

[0024] On the other hand, the present invention provides an engineered, non-naturally occurring vector system, or a CRISPR-Cas system, comprising the Cas12i protein or a nucleic acid sequence encoding the Cas12i protein and a nucleic acid encoding the aforementioned guide RNA (gRNA).

[0025] In one embodiment, the nucleic acid sequence encoding the Cas12i protein and the nucleic acid encoding the guide RNA are artificially synthesized.

[0026] The aforementioned gRNA targets the GmFAD2-1A and GmFAD2-1B genes in soybean cells. It then guides the Cas12i protein to the genomic locus to modify, edit, or cleave the target sequences, thereby altering or modifying the expression of the GmFAD2-1A and GmFAD2-1B genes.

[0027] The present invention also provides an engineered, non-naturally occurring carrier system, which may include one or more carriers, the one or more carriers comprising:

[0028] a) A first regulatory element and the aforementioned gRNA, wherein the first regulatory element is operatively linked to the gRNA.

[0029] b) The second regulatory element and the Cas12i described above, wherein the second regulatory element is operatively linked to the Cas12i protein;

[0030] Components (a) and (b) are located on the same or different carriers in the system.

[0031] The first and second regulatory elements include promoters (e.g., constitutive or inducible promoters), enhancers (e.g., 35S promoters or 35S enhanced promoters), internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and polyU sequences).

[0032] In some implementations, the vector in the system is a viral vector (e.g., a retroviral vector, lentiviral vector, adenovirus vector, adeno-associated vector, and herpes simplex vector), or it can be a plasmid, virus, granule, bacteriophage, or other type known to those skilled in the art.

[0033] In some embodiments, the system provided herein is a delivery system. In some embodiments, the delivery system is a nanoparticle, liposome, exosome, microbubble, or gene gun.

[0034] In one embodiment, the Cas12i protein is linked to one or more NLS sequences. In one embodiment, the NLS sequence is linked to the N-terminus and / or C-terminus of the protein.

[0035] On the other hand, the present invention relates to an engineered CRISPR system comprising the aforementioned Cas12i protein and the aforementioned guide RNA.

[0036] On the other hand, the present invention provides a complex or composition comprising:

[0037] (i) The protein component, which is the aforementioned Cas12i protein; and

[0038] (ii) Nucleic acid components, which are the gRNAs mentioned above.

[0039] The protein components and nucleic acid components combine to form a complex.

[0040] On the other hand, the present invention provides the application of the above-mentioned vector system, CRISPR system, the above-mentioned complex or composition in gene editing of soybeans or in the preparation of high oleic soybean plants.

[0041] On the other hand, the present invention also provides a method for preparing high-oleic soybean plants, the method comprising the step of gene editing in soybean plant cells, soybean seeds, soybean plants, soybean plant tissues or soybean plant parts using the above-mentioned Cas12i and gRNA, thereby obtaining edited high-oleic soybean plants.

[0042] Furthermore, the gene editing involves editing the GmFAD2-1A and GmFAD2-1B genes of soybean.

[0043] In one embodiment, the nucleic acid sequence of the edited GmFAD2-1A gene is shown in SEQ ID No. 5; the nucleic acid sequence of the edited GmFAD2-1B gene is shown in SEQ ID No. 6.

[0044] On the other hand, the present invention also provides a high-oleic soybean plant, which is prepared by the above-mentioned gene editing method or the method for preparing high-oleic soybean plants.

[0045] On the other hand, the present invention also provides a method for preparing high-oleic soybean seeds, the method comprising the step of preparing high-oleic soybean seeds using the above-mentioned high-oleic soybean plants.

[0046] On the other hand, the present invention also provides a high-oleic soybean seed, which is prepared by the above-described method for preparing high-oleic soybean seeds.

[0047] The high-oleic soybeans mentioned in this invention refer to soybean seeds whose oleic acid content in the total fatty acids is at least 50%, at least 60%, at least 70%, or at least 80%.

[0048] The content of oleic acid in the total fatty acids of soybean seeds after the present invention is increased by at least 1, at least 2, at least 3, at least 4, or at least 5 times compared with wild-type soybean seeds.

[0049] On the other hand, the present invention also provides a method for preparing soybean plants, the method comprising the step of hybridizing the above-mentioned high-oleic soybean seeds or high-oleic soybean plants with other soybeans to prepare soybean plants.

[0050] Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0051] The terms “polynucleotide,” “nucleotide sequence,” “nucleic acid sequence,” “nucleic acid molecule,” and “nucleic acid” are used interchangeably and include DNA, RNA, or their hybrids, which can be double-stranded or single-stranded.

[0052] As used herein, the term "identity" refers to the sequence matching between two polypeptides or two nucleic acids. Two compared sequences are identical at a position when the same base or amino acid monomeric subunit occupies the same location (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine). The "percentage identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared × 100. For example, if six out of ten positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (three out of six positions match). Typically, two sequences are compared to produce the maximum identity. Such comparisons can be made using methods readily available, for example, computer programs such as the Align program (DNAstar, Inc.) Needleman et al. (1970) J. Mol. Biol. 48: 443-453. The percentage identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4:11-17 (1988)) integrated into the ALIGN program (version 2.0), which uses a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percentage identity between two amino acid sequences can be determined using the Needleman and Wunsch algorithm (J MoIBiol. 48:444-453 (1970)) in the GAP program integrated into the GCG software package (available at www.gcg.com), which uses a Blossum 62 matrix or a PAM250 matrix, along with gap weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6.

[0053] The term "encoding" refers to the inherent characteristics of a specific nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, which serves as a template for the synthesis of other polymers and macromolecules in biological processes that have defined nucleotide sequences (i.e., rRNA, tRNA, and mRNA) or defined amino acid sequences and the biological characteristics they produce. Therefore, if the transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, then that gene encodes that protein.

[0054] The term "regulatory element," as used herein, is intended to include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences), for detailed description in Goeddel, *Gene Expression Technology: Methods in Enzymology*, 185, Academic Press, San Diego, California (1990). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of that nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can primarily direct expression in the desired tissue of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or specific cell types (e.g., lymphocytes). In some cases, regulatory elements can also direct expression in a time-dependent manner (e.g., cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue- or cell type-specific. In some cases, the term "regulatory element" encompasses enhancer elements such as WPRE; CMV enhancer; the R-U5' fragment in the LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), pp. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), pp. 1527-31, 1981).

[0055] As used herein, the term "promoter" has the meaning known to those skilled in the art, referring to a non-coding nucleotide sequence located upstream of a gene that initiates the expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when the cell is a cell of the tissue type corresponding to that promoter.

[0056] A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein to allow it to be transported to the cell nucleus via nuclear transport; that is, a protein with an NLS is transported to the cell nucleus. Typically, an NLS contains positively charged Lys or Arg residues exposed on the protein surface. Exemplary nuclear localization sequences include, but are not limited to, NLS from the following: SV40 large T antigen, EGL-13, c-Myc, and TUS protein.

[0057] As used herein, the term “operably linked” is intended to mean that the nucleotide sequence of interest is linked to one or more regulatory elements in a manner that allows the expression of that nucleotide sequence (e.g., in an in vitro transcription / translation system or in the host cell when the vector is introduced into the host cell).

[0058] The term "vector" refers to an element that allows the vector to integrate into the host cell's genome or to replicate autonomously within the cell independently of the genome. The vector may contain any element that guarantees self-replication. It typically carries a gene that is not part of the cell's central metabolism and is usually in the form of double-stranded DNA. The choice of vector generally depends on its compatibility with the host cell to which it is to be introduced. If a vector is used, the choice of vector depends on methods well-known to those skilled in the art for transforming host cells. For example, plasmid vectors may be used.

[0059] The term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant callus, plant masses, as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, spikes, roots, root tips, anthers, etc.

[0060] The term “plant cell” should be understood as any cell that is derived from or found in a plant and is capable of forming, for example: undifferentiated tissues such as callus, differentiated tissues such as embryos, components of a plant, or seeds.

[0061] The nucleic acid sequences, nucleic acid constructs, or expression vectors of the present invention can be introduced into host cells through a variety of techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti-plasmid-mediated gene delivery, as well as calcium phosphate transfection, DEAE-glucan-mediated transfection, lipid transfection, or electroporation.

[0062] In the production method of the present invention, the cells are cultured on a nutrient medium suitable for the production of the polypeptide using methods well known in the art. If the polypeptide is secreted into the nutrient medium, it can be directly recovered from the medium. If the polypeptide is not secreted into the medium, it can be recovered from cell lysates.

[0063] As used herein, the terms “guide RNA,” “mature crRNA,” and “guide sequence” are used interchangeably and have the meanings commonly understood by those skilled in the art. Generally, a guide RNA may comprise a direct repeat sequence and a guide sequence, or consist essentially of or comprise of a direct repeat sequence and a guide sequence (also referred to as a spacer in the context of an endogenous CRISPR system).

[0064] In some cases, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence to hybridize with the target sequence and guide the specific binding of the CRISPR / Cas complex to the target sequence. In one embodiment, when optimal alignment is achieved, the complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining the optimal alignment is within the capabilities of a person skilled in the art. For example, publicly available and commercially available alignment algorithms and programs exist, such as, but not limited to, ClustalW, the Smith-Waterman algorithm in MATLAB, Bowtie, Geneious, Biopython, and SeqMan. The sequences involved in this invention are as follows:

[0065] Serial Number (SEQ ID No.) Sequence Description 1 Cas12i wild-type amino acid sequence 2 gRNA guide sequence 3 gRNA direct repeat sequence 4 gRNA direct repeat sequence 5 Edited GmFAD2-1A gene sequence 6 Edited GmFAD2-1B gene sequence 7 Cas12i wild-type DNA sequence

[0066] The main advantages of this invention are:

[0067] This invention successfully achieved the editing of the GmFAD2-1A / B gene in soybeans using CRISPR gene editing technology based on Cas12i, and the oleic acid content in the edited soybean seeds was significantly increased. Attached Figure Description

[0068] Figure 1 A schematic diagram of a vector containing Cas12i and gRNA.

[0069] Figure 2 Edit the comparison chart of oleic acid content in soybean seeds of plants and wild-type control soybeans.

[0070] Figure 3 . Validation of Cas12i protein editing efficiency, where 1 is wild-type Cas12i and 2 is Cas12i protein with combined mutations of N369R and S433R. Implementation

[0071] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make equivalent modifications to the disclosed technical content to create equivalent embodiments. Any simple modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the invention are all within the protection scope of the present invention.

[0072] Example 1: Gene editing in soybeans using CRISPR gene editing technology based on Cas12i.

[0073] 1. Construction of gene editing vectors

[0074] In this embodiment, Cas12i (amino acid sequence as shown in SEQ ID No. 1) was used to perform gene editing in soybeans.

[0075] Based on the coding sequences of the GmFAD2-1A, GmFAD2-1B, and GmFT5α genes in soybean, gRNAs targeting Cas12i were designed. The designed gRNA sequences are as follows:

[0076] gRNA gRNA guide sequence (5' to 3') PAM Target genes gRNA 1 cuguaccaauacacgcccuucuc ttc GmFAD2-1A / B gRNA 2 ccucauugcauggccaaucuauu ttc GmFAD2-1A / B gRNA 3 ucuccacagugccuuguaaaaug ttc GmFAD2-1A / B gRNA 4 caaacacaaagccaccauucacu ttc GmFAD2-1A / B gRNA 5 uggacggauugcauucauag tta GmFT5α

[0077] The direct repeat sequence of the above gRNA is agagaaugugugcauagucacac (5' to 3'). The above gRNA1-gRNA5, from 5' to 3', successively include the above direct repeat sequence and their respective guide sequences.

[0078] Annealing primers are designed based on the target. Taking gRNA2 as an example: the upstream primer 5' to 3' is... acacgaatgcttccaagatctcca, downstream primer 5' to 3' is ggcc tggagatcttggaagcattc. After primer annealing, the gene editing backbone vector is ligated using the Golden Gate method to obtain the gene editing vector. A schematic diagram of the vector is shown below. Figure 1 As shown. The gene editing vector contains the Cas12i protein and the aforementioned gRNA, wherein the promoter for the Cas12i protein is the EF1α promoter, and the promoter for the gRNA is the U6 promoter.

[0079] 2. Obtaining recombinant bacteria

[0080] 1) Transformation of Escherichia coli

[0081] The gene-editing vector from step 1 is transformed into E. coli. The transformed E. coli are subjected to bacterial culture PCR. The amplified products with the correct PCR band size are sequenced. The E. coli with the correct sequencing results are recombinant E. coli containing the gene-editing vector.

[0082] 2) Transformation of Agrobacterium

[0083] After culturing the recombinant E. coli containing the gene editing vector in step 1), plasmid DNA was extracted, added to Agrobacterium competent cells, and placed in an ice bath for 5 min, liquid nitrogen for 5 min, a 37°C water bath for 5 min, and then placed on ice for 5 min.

[0084] Remove the centrifuge tube, add 700 μl of culture medium (antibiotic-free), and incubate at 28°C with shaking for 2–4 hours;

[0085] Take out the bacterial culture and spread it onto a medium plate containing the corresponding antibiotic. Incubate it upside down in an incubator. Colonies will be visible after about 2 days. Perform PCR on the colonies according to the method in step 1), and sequence the amplified products. Agrobacterium with correct sequencing results is recombinant Agrobacterium containing the gene editing vector.

[0086] 3. Plant genetic transformation

[0087] 1) Sterilization of soybean seeds:

[0088] Place the selected soybean seeds in a petri dish within a desiccator. Slowly add 10 ml of concentrated hydrochloric acid along the wall of a beaker containing 150 ml of sodium hypochlorite within the desiccator, and quickly close the desiccator lid. Sterilize with the chlorine gas generated from the sodium hypochlorite and concentrated hydrochloric acid for 16 hours.

[0089] 2) Seed germination:

[0090] Insert the sterilized seeds from step 1) downwards into MS medium, with the insertion depth covering 1 / 3 to 1 / 2 of the seed width, and incubate overnight at 25°C in the dark or under light.

[0091] 3) Preparation of Agrobacterium bacterial culture:

[0092] Take the bacterial culture stored at -80℃ and streak it on a YEP plate containing antibiotics (step 2, 2) containing recombinant Agrobacterium containing gene editing vector. Incubate at 28℃ for 2 days. Pick colonies and inoculate them into 5ml of YEP liquid medium in a 50ml centrifuge tube. Shake overnight at 28℃. Take 300μl of bacterial culture and add it to 250ml of YEP liquid medium. Incubate overnight until OD600 = 0.6. Centrifuge at 4000rpm for 10min. Dilute with infection solution to OD600 = 0.6 for later use.

[0093] 4) Cotyledon node laceration, infection, and co-culture:

[0094] One day after the seeds in step 2) germinate, make a horizontal cut 3-5 mm from the cotyledon node on the hypocotyl. Then make a longitudinal cut along the middle of the two cotyledons, being careful not to damage the cotyledons. Cut the hypocotyl longitudinally, remove the apical bud, and make 1-5 light longitudinal cuts at the cotyledon node. Quickly place the seeds into the Agrobacterium infection solution prepared in step 3) and infect for about 1-4 hours. Remove the seeds and place them on a co-culture medium lined with filter paper. Co-culture at 22°C for 3-5 days.

[0095] 5) Resume culture:

[0096] After co-culturing, the explants were inserted into the recovery medium. The culture dish was sealed with 3M breathable tape and placed under light. The culture was then restored at around 25°C for 5-7 days.

[0097] 6) Screening and cultivation:

[0098] After recovery, the explant wounds were inserted into the selection medium and selected under light at around 25°C. Subculture was performed every 10 days, for a total of 3 to 5 subcultures.

[0099] 7) Bud elongation culture:

[0100] After screening, the cotyledons of the explants were removed, and the parts with clustered buds were transferred to the bud elongation medium. The explants were subcultured every 10 days, with the same light and temperature conditions as the screening culture.

[0101] 8) Rooting and transplanting:

[0102] Once the plantlets in the bud elongation medium have grown to 3 cm (or have two trifoliate leaves), cut them off at the base and insert them into sterilized nutrient soil, then water them with rooting nutrient solution to promote rooting. After roots have grown, transplant them into well-watered soil, cover them with plastic film, and cut off the plastic film after one week to harden off the seedlings. If new leaves grow after two weeks, completely remove the plastic film to obtain E0 generation transformation seedlings.

[0103] 4. Detection and phenotypic observation of soybean transformants

[0104] Edited seedlings were screened and detected by PCR and sequencing in E0 generation transformed seedlings, then grown in a climate chamber with wild-type seedlings as a control to observe phenotypic changes. After 2-3 generations of self-pollination propagation, the mutant population was increased to obtain homozygous edited seedlings without foreign gene insertion.

[0105] 5. Results

[0106] The results of testing soybean edited plants using gRNA1-gRNA5 showed that no editing events were detected in soybeans using gRNA1, gRNA3, gRNA4, and gRNA5. Only gRNA2, which targets GmFAD2-1A / B, was detected, with an editing efficiency of 1%-2%.

[0107] The GmFAD2-1A / B gene type of soybean plants edited with gRNA2 is:

[0108] Compared with the wild-type GmFAD2-1A gene, the GmFAD2-1A gene of the edited plant lacks bases at positions 262-288. The gene sequence of the GmFAD2-1A gene of the edited plant is shown in SEQ ID No. 5.

[0109] Compared with the wild-type GmFAD2-1B gene, the GmFAD2-1B gene of the edited plant has a partial deletion and a partial insertion at positions 258-286. The gene sequence of the GmFAD2-1B gene of the edited plant is shown in SEQ ID No. 6.

[0110] Phenotypic identification of the above-mentioned soybean edited plants:

[0111] 2g of soybean seeds from the E1 generation of the edited plants were pulverized and their oleic acid content was determined by gas chromatography. The results are as follows: Figure 2 As shown, oleic acid accounts for more than 80% of the total fatty acids in soybean seeds of the above-mentioned edited plants, while oleic acid accounts for only about 20% of the total fatty acids in soybean seeds of wild-type plants.

[0112] Example 2: Gene editing in soybeans using optimized Cas12i

[0113] Although the Cas12i in Example 1 can detect editing events in gRNA2, its editing efficiency is only about 1%-2%, which is not high. The applicant used bioinformatics methods to perform site-directed mutagenesis on the amino acids that bind to the target sequence in potential Cas12i3. The nucleic acid sequence of wild-type Cas12i is shown in SEQ ID No. 7. The site-directed mutagenesis method follows commonly used methods in the art. In this example, PCR-based site-directed mutagenesis was used to generate variants of the Cas protein. Specifically, the DNA sequence of the Cas12i3 protein was designed to be divided into two parts centered on the mutation site. Two pairs of primers were designed to amplify these two DNA sequences respectively, while the sequence to be mutated was introduced onto the primers. Finally, the two fragments were loaded into the pcDNA3.3-eGFP vector using Gibson cloning. The combination of mutants was achieved by splitting the Cas12i3 protein DNA into multiple segments and constructing them using PCR and Gibson cloning. Fragment amplification kit: TransStart FastPfu DNA Polymerase (containing 2.5mM dNTPs), detailed experimental procedures are available in the instruction manual. Gel recovery kit: The Gel DNA Extraction Mini Kit is described in the instruction manual for detailed experimental procedures. The vector construction kit used was the pEASY-BasicSeamless Cloning and Assembly Kit (CU201-03), also described in the instruction manual for detailed experimental procedures. The mutated amino acid sites and primer sequences used in this embodiment are shown in the table below:

[0114]

[0115] In this embodiment, a mutant protein of Cas12i with simultaneous mutations of N369R and S433R was obtained through site-directed mutagenesis. Compared with SEQ ID No.1, the amino acid sequence of the mutant protein has N mutated to R at position 369 and S mutated to R at position 433.

[0116] The gene-editing activity of the mutated Cas12i protein was verified in animal cells. A target was designed for the FUT8 gene in Chinese hamster ovary cells (CHO), namely FUT8-Cas-XX-g3. CAGCCAAGGTTGTGGACGGATCAThe italicized portion represents the PAM sequence, and the underlined area represents the target region. The vector pcDNA3.3 was modified to carry EGFP fluorescent protein and the PuroR resistance gene. The SV40 NLS-Cas-XX fusion protein was inserted via the XbaI and PstI restriction sites; the U6 promoter and gRNA sequence were inserted via the Mfe1 restriction site. The CMV promoter initiates the expression of the SV40 NLS-Cas-XX-NLS-GFP fusion protein. The Cas-XX-NLS protein and the GFP protein are linked using the linker peptide T2A. The EF-1α promoter initiates the expression of the puromycin resistance gene. Plating: CHO cells were plated when the confluence reached 70-80%, with a cell number of 8*10^4 cells / well in 12-well plates. Transfection: Transfection was performed 24 hours after plating, adding 6.25 μl of Hieff Transfection to 100 μl opti-MEM. TM Mix the liposome nucleic acid transfection reagent thoroughly; add 2.5 μg of plasmid to 100 μL of Hieff Transfection MEM and mix thoroughly. TM The liposome nucleic acid transfection reagent was mixed thoroughly with the diluted plasmid and incubated at room temperature for 20 min. The incubated mixture was then added to cell-coated culture medium for transfection. Puromycin was added for selection: 24 h after transfection, puromycin was added at a final concentration of 10 μg / ml. After 24 h of puromycin treatment, the medium was replaced with normal medium and cultured for another 24 h.

[0117] DNA extraction, PCR amplification of the area near the editing region, and hiTOM sequencing: Cells were collected after trypsin digestion, and genomic DNA was extracted using a cell / tissue genomic DNA extraction kit (Biotech). Genomic DNA was amplified in the region near the target site. PCR products were sequenced using hiTOM. Sequencing data analysis was performed, and the types and proportions of sequences within a 15nt upstream and 10nt downstream of the target site were statistically analyzed. Sequences with a SNV frequency greater than or equal to 1% or a non-SNV mutation frequency greater than or equal to 0.06% were identified to determine the editing efficiency of the Cas-XX protein at the target site. CHO cell FUT8 gene target sequence: FUT8-Cas-XX-g3: CAGCCAAGGTTGTGGACGGATCA The italicized portion is the PAM sequence, and the underlined area is the target region. The gRNA sequence is: AGAGAAUGUGUGCAUAGUCAaCAC CAGCCAAGGUUGUGGACGGAUCA The underlined area is the target region, and the other areas are DR (directed repeat sequence) regions.

[0118] The results are as follows Figure 3As shown, the N369R and S433R combined mutant Cas12i protein has a significantly improved editing efficiency compared to the wild-type Cas12i protein, which is nearly doubled. The types of gene editing targeted include base deletion, base insertion, and base substitution.

[0119] Gene editing was performed in soybeans using the aforementioned mutated Cas12i proteins (N369R and S433R). The target site for editing was gRNA2, as described in Example 1. The specific operation method was the same as in Example 1, except that the Cas12i proteins were replaced with mutated Cas12i proteins from N369R and S433R. Results showed that editing events were detected in gRNA2 targeting GmFAD2-1A / B using the mutated Cas12i proteins, with an editing efficiency of approximately 11%. Editing types included base deletion, base insertion, and base substitution. Compared to wild-type Cas12i proteins, the mutated Cas12i proteins significantly improved the editing efficiency in soybeans. Furthermore, the oleic acid content in soybean seeds from soybean plants edited with the mutated Cas12i proteins was significantly increased, similar to the effect in Example 1, with oleic acid accounting for over 80% of the total fatty acids.

[0120] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. A method for gene editing in soybean using Casl2i, characterized in that, The method comprises the step of performing gene editing in soybean using Cas12i and gRNA, the gRNA comprising a backbone region binding to Cas12i and a guide sequence hybridizing to a target sequence, the gRNA targeting GmFAD2-1A gene and GmFAD2-1B gene in soybean; the amino acid sequence of the Cas12i is mutated at the 369th amino acid and the 433th amino acid corresponding to the sequence shown in SEQ ID No. 1, wherein the 369th amino acid is mutated to R, and the 433th amino acid is mutated to R, and the guide sequence in the gRNA hybridizing to the target sequence is shown in SEQ ID No.

2.

2. The method of claim 1, wherein, The method comprises the step of delivering the Cas12i and gRNA into a soybean plant cell, a soybean seed, a soybean plant, a soybean plant tissue, or a soybean plant part.

3. A vector system comprising one or more vectors comprising: a) a first regulatory element operably linked to the gRNA of any one of claims 1-2, b) a second regulatory element operably linked to the Cas12i of any one of claims 1-2; wherein components (a) and (b) are located on the same or different vectors of the system.

4. A complex or composition comprising: (i) a protein component that is the Cas12i protein of any one of claims 1-2; and (ii) a nucleic acid component that is the gRNA of any one of claims 1-2.

5. A method of making a high oleic acid soybean plant, the method comprising the step of performing gene editing in a soybean plant cell, a soybean seed, a soybean plant, a soybean plant tissue, or a soybean plant part using the Cas12i and gRNA of any one of claims 1-2, thereby obtaining an edited high oleic acid soybean plant.

6. A method of making a high oleic acid soybean seed, the method comprising the step of making the high oleic acid soybean seed using the high oleic acid soybean plant obtained by the method of claim 5.

7. A method of making a soybean plant, the method comprising the step of making the soybean plant by crossing the high oleic acid soybean plant obtained by the method of claim 5 with another soybean plant.

8. Use of the vector system of claim 3, or the complex or composition of claim 4, in gene editing of soybean, or in making a high oleic acid soybean plant.

Images