Application of transcription factor myc2 in regulating stomatal density and method for obtaining poplar with low stomatal density by overexpressing ppnmyc2

By overexpressing the poplar bHLH transcription factor PpnMYC2, the promoter activity of stomatal density inhibitors EPF2 and EPFL4 was regulated, and the expression of EPFL9 was inhibited. This solved the problem of unclear upstream regulatory genes and achieved the effects of reducing stomatal density and improving water use efficiency.

CN116218901BActive Publication Date: 2025-11-07BEIJING FORESTRY UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310306347.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-27
Publication Date
2025-11-07
Estimated Expiration
2043-03-27

AI Technical Summary

Technical Problem

In the existing technology, the regulatory mechanisms of upstream regulatory genes in the bHLH transcription factor family that affect stomatal density, such as EPF2, EPFL4 and EPFL9, are unclear, making it difficult to effectively regulate plant stomatal density and water use efficiency.

Method used

By overexpressing the poplar bHLH transcription factor PpnMYC2, the promoter activities of stomatal density inhibitors EPF2 and EPFL4 are activated, while the promoter activity of stomatal density promoter EPFL9 is inhibited, thereby regulating stomatal density and water use efficiency.

Benefits of technology

It significantly reduces the stomatal density of poplar trees, improves water use efficiency, and enhances the plant's drought resistance and water resource utilization efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004146867380000011
    Figure HDA0004146867380000011
  • Figure HDA0004146867380000012
    Figure HDA0004146867380000012
  • Figure HDA0004146867380000013
    Figure HDA0004146867380000013
Patent Text Reader

Abstract

The application belongs to the field of plant biotechnology, and relates to application of a bHLH type transcription factor MYC2 in regulation of plant stomatal density and a method for obtaining a plant with reduced stomatal density by overexpression. The transcription factor MYC2 can activate the activity of plant stomatal density inhibitor EPF2 and EPFL4 promoters and inhibit the activity of plant stomatal density promoter EPFL9 in the process of stomatal formation, and regulate plant stomatal density and plant water use efficiency. The application can be applied to reduce the stomatal density of poplar and improve the water use efficiency of poplar by overexpression of the PpnMYC2 transcription factor, and provides a gene resource and a technical method for cultivating a low-water-consumption plant variety.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant biotechnology, and particularly relates to an action mechanism of plant bHLH class transcription factor MYC2 in regulating stomatal density and application of poplar overexpression transformation. BACKGROUND

[0002] Plant stomata is the channel for carbon dioxide and water vapor exchange, and plays a key role in photosynthesis and transpiration of plants. Its formation includes several stages, from meristem cells (MMC) to stomatal lineage ground cells (SLGC), guard cell mother cells (GMC), and finally to guard cells (GC), thereby generating stomata. Stomatal development is regulated by multiple influencing factors, and three transcription factors of the bHLH transcription factor family, SPEECHLESS, MUTE and FAMA, directly regulate stomatal formation. The genes of the EPF / EPFL family indirectly affect stomatal development, such as EPFL9 (STOMAGEN) positively regulating stomatal density, and EPF1, EPF2, EPFL4 and EPFL6 negatively regulating stomatal density. They combine with receptors such as TMM / ER as ligands, thereby affecting the expression of downstream SPEECHLESS. However, the upstream regulatory genes affecting stomatal density such as EPF2, EPFL4 and EPFL9 are not clear.

[0003] The basic helix-loop-helix (bHLH) transcription factor gene family is one of the largest gene families, which plays an important role in regulating plant growth and development, morphological development, response to biological and non-biological stress, etc. The bHLH transcription factor contains a bHLH characteristic domain, and some conserved amino acids determine its recognition of the G-box sequence. With the increase in the number of bHLH genes found in plants, information on the function and regulatory mechanism of bHLH transcription factors is also constantly enriched.

[0004] The stomatal density of the poplar overexpressing the bHLH family transcription factor PpnMYC2 obtained by the method of the application is significantly lower than that of the wild type (WT), and the water use efficiency is improved. Through a series of experiments such as double luciferase reporter gene detection, it is found that MYC2 has the effect of reducing stomatal density by promoting the expression of EPF2 and EPFL4 and inhibiting the expression of EPFL9 in the process of stomatal occurrence, and the overexpression of the transcription factor PpnMYC2 can enhance the water use efficiency of poplar.

[0005] The application discloses that the bHLH class transcription factor MYC2 has the functions of regulating plant stomatal density inhibiting factors EPF2 and EPFL4 and stomatal density promoting factor EPFL9, further influences the molecular mechanism of plant stomatal density and water use efficiency, provides certain theoretical support for analyzing the causes of plant stomatal density variation, and provides an important target gene and technical method for molecular design breeding of water-saving and drought-resistant forest trees. SUMMARY

[0006] In order to reduce the stomatal density of poplar and improve the water use efficiency of poplar, the application provides a plant MYC2 gene and application thereof.The gene codes a plant bHLH class transcription factor MYC2, the transcription factor can activate the activity of stomatal density inhibiting factors EPF2 and EPFL4 promoters, positively regulates the expression of EPF2 and EPFL4, and can inhibit the activity of stomatal density promoting factor EPFL9 promoter, negatively regulates the expression of EPFL9, so as to regulate the formation of stomatal density traits and the water use efficiency in the growth and development process of plants. By using genetic engineering technology, the poplar PpnMYC2 transcription factor is overexpressed in poplar, the stomatal density can be significantly reduced, and the water use efficiency of poplar is improved, which has important significance for germplasm innovation and water-saving variety breeding of poplar.

[0007] In order to realize the purpose of the application, the application provides a bHLH class transcription factor MYC2 action mechanism and application thereof in regulating the stomatal density of poplar by genetic transformation.

[0008] The application provides application of the transcription factor MYC2 in regulating the stomatal density of plants.

[0009] The plant is poplar, locust tree or eucalyptus, preferably poplar, and further preferably silver gland poplar.

[0010] In particular, in the process of plant stomatal formation, the transcription factor MYC2 activates the activity of stomatal density inhibiting factors EPF2 and EPFL4 promoters, and can inhibit the activity of stomatal density promoting factor EPFL9 promoter, so as to regulate the plant stomatal density traits.

[0011] In particular, overexpression of the transcription factor MYC2 can activate the activity of plant stomatal density inhibiting factors EPF2 and EPFL4 promoters, and inhibit the activity of stomatal density promoting factor EPFL9 promoter, so as to reduce the stomatal density of transgenic plants and improve the water use efficiency of plants.

[0012] The present application is based on the mechanism of transcription factor MYC2 in regulating stomatal density, and in one aspect provides a method for obtaining poplar with low stomatal density by overexpressing transcription factor PpnMYC2, comprising the following steps:

[0013] 1) Obtain Agrobacterium engineering bacteria containing overexpression vector of PpnMYC2 gene

[0014] Using freeze-thaw method, plant overexpression vector pBI121-PpnMYC2 containing PpnMYC2 gene is transformed into Agrobacterium, and Agrobacterium engineering bacteria containing overexpression vector of PpnMYC2 gene is obtained;

[0015] 2) Differentiation culture of explants

[0016] Place the poplar explants in the differentiation medium for differentiation culture to obtain pretreated explants;

[0017] 3) Preparation of Agrobacterium infection bacterial solution

[0018] The plant overexpression vector pBI121-PpnMYC2 is transformed into Agrobacterium competent cells by freeze-thaw method, and after colony PCR detection, the positive single colony is inoculated into liquid suspension medium for liquid suspension culture to prepare Agrobacterium infection bacterial solution containing plant overexpression vector pBI121-PpnMYC2;

[0019] 4) Infection treatment

[0020] After the pretreated explants after differentiation culture are soaked in the Agrobacterium infection bacterial solution containing plant overexpression vector pBI121-PpnMYC2 for 10-15 min, the explants are inoculated into the infection-co-culture medium for infection treatment in dark conditions to obtain infection-treated explants;

[0021] 5) Resistant bud screening treatment

[0022] The infection-treated explants are inoculated into the selection differentiation medium for resistant bud screening treatment to screen resistant buds;

[0023] 6) Resistant bud rooting treatment

[0024] When the resistant buds grown on the selection differentiation medium grow to 1-2 cm, they are cut off with sterile scissors and then inoculated into the selection rooting medium for rooting culture, and the plants that are positive after DNA detection are overexpression plants, i.e., poplar plants with low stomatal density are obtained.

[0025] MYC2 is a representative transcription factor in plants, and PpnMYC2 is a transcription factor in poplar.

[0026] Particularly, the overexpression vector pBI121-PpnMYC2 is transformed into Agrobacterium by freeze-thaw method in step 1).

[0027] Particularly, the Agrobacterium is selected from Agrobacterium GV3101, EHA105 or LBA4404, preferably Agrobacterium GV3101.

[0028] Particularly, the freeze-thaw method comprises the following steps: placing the Agrobacterium in an ice water mixture in a ice bath, then adding the plant overexpression vector pBI121-PpnMYC2 containing PpnMYC2 gene into the Agrobacterium and mixing, and then sequentially standing on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and in an ice bath for 5 min; wherein the amount of the plant overexpression vector pBI121-PpnMYC2 containing PpnMYC2 gene added into 100 μl of Agrobacterium competence is 0.01-1 μg; then adding 700 μl of LB medium or YEB liquid medium without antibiotics and culturing at 28℃ for 2-3 h; then centrifuging, discarding part of the supernatant, and taking about 100 μl of supernatant after centrifugation of the precipitate after gentle blowing, resuspending the precipitate, and then coating the resuspended bacterial liquid on an LB or YEB plate containing antibiotics and placing in a 28℃ incubator for 2-4 days until the plate is covered with colonies, to obtain the Agrobacterium engineering bacteria containing the overexpression vector pBI121-PpnMYC2 containing PpnMYC2 gene.

[0029] Particularly, the LB or YEB plate medium containing antibiotics is: LB or YEB plate medium containing 50 μg / ml Kan (kanamycin) or containing 50 μg / ml Kan and 20 μg / ml Rif (rifampicin) or containing 50 μg / ml Rif; wherein when the plate only contains 50 μg / ml Kan, it can be cultured at 28℃ for 48 h; when the plate contains 50 μg / ml Kan and 20 μg / ml Rif, it needs to be cultured at 28℃ for 60 h; and if the plate used contains 50 μg / ml Rif, it needs to be cultured at 28℃ for 72-90 h.

[0030] Particularly, the plant overexpression vector pBI121-PpnMYC2 containing PpnMYC2 gene is constructed according to the following method:

[0031] 1A) cloning poplar bHLH transcription factor PpnMYC2;

[0032] 1B) using the transcription factor PpnMYC2 as a template, performing PCR cloning to obtain the PpnMYC2 transcription factor containing the pBI121-GFP vector linker primer, wherein the forward primer for PCR cloning is PpnMYC2-F and the reverse primer is PpnMYC2-R;

[0033] 1C) The PpnMYC2 transcription factor containing the pBI121-GFP vector linker primer is connected to the plant overexpression empty vector pBI121-GFP by the method of seamless cloning, and then the ligation product is transformed into E. coli DH5a competent cells by freeze-thaw method, and the positive bacteria are extracted to obtain the overexpression vector pBI121-PpnMYC2 containing PpnMYC2.

[0034] In particular, the transcription factor PpnMYC2 in step 1A) is cloned according to the following method: cloning forward / reverse primers F / R are designed according to the nucleotide sequence of the PpnMYC2 gene, and PCR amplification is performed with poplar cDNA as a template to obtain the transcription factor PpnMYC2.

[0035] In particular, the cloning forward / reverse primers F / R are as follows:

[0036] Forward primer F: ATGGAAGAGATACTGTCCTCC (SEQ ID NO. 1);

[0037] Reverse primer R: TTAGTTCTGCATTCTTTGAAAAAT (SEQ ID NO. 2).

[0038] In particular, the cDNA obtained by reverse transcription of total RNA extracted from poplar leaf tissue is used as a template for PCR amplification.

[0039] In particular, in step 1B), an XbaI enzyme digestion site is introduced into the forward primer PpnMYC2-F; and a SalI enzyme digestion site is introduced into the reverse primer PpnMYC2-R.

[0040] In particular, in step 1B), the forward primer PpnMYC2-F is: CGGGGGACTCTAATGGAAGAGATACTGTCCTC (SEQ ID NO. 4); and the reverse primer PpnMYC2-R is: ACTAGTCAGTCGACTGTTCTGCATTCTTTGAAAAAT (SEQ ID NO. 5).

[0041] In particular, step 1-A) is further included, in which single colony bacteria of E. coli transformed by freeze-thaw method are subjected to positive screening detection, and PCR detection is performed with single colony as a template; if the band size is about 1500 bp, the single colony is extracted to obtain plasmid, which is then sequenced, and the sequencing results are compared with the sequence of the target gene; if the comparison results are completely consistent, it indicates that the vector transformation is successful, and a positive vector plasmid is obtained, i.e., the overexpression vector plasmid containing the PpnMYC2 gene.

[0042] In particular, the freeze-thaw method in step 1C) is transformed into E. coli, which comprises the following steps:

[0043] a) The centrifuge tube containing the DH5a competent cells is inserted into ice, and after the bacterial mass is melted, the ligation product is added, mixed, and then placed in ice for 25 minutes.

[0044] b) 42°C water bath heat shock for 45 seconds, quickly put back on ice and stand for 2 minutes, shaking will reduce the transformation efficiency.

[0045] c) 700 μL of sterile medium (LB liquid medium) without antibiotics is added to the centrifuge tube, mixed, and then incubated at 37°C, 200 rpm for 60 minutes.

[0046] d) 5000 rpm centrifugation for 1 minute to collect the bacterial mass, and about 100 μl of supernatant is taken to resuspend the bacterial mass by gently blowing and plated on LB medium containing kanamycin.

[0047] e) The plate is inverted and placed in a 37°C incubator for overnight culture, and then single colony E. coli is obtained.

[0048] In particular, step 1C-1) further comprises PCR detection of single colony E. coli on the plate after transformation, using single colony bacteria as template, gel electrophoresis, and compared with Maker, the band size is about 1500 bp, which is positive bacteria; then the positive bacteria are added to LB liquid medium added with kanamycin for expansion culture, and then the plasmid is extracted, thereby obtaining the positive plasmid, forming the overexpression vector pBI121-PpnMYC2 containing PpnMYC2.

[0049] In particular, the differentiation culture in step 2) is carried out under the following conditions: temperature is 25±2°C, illumination is 2000 lx, illumination cycle is 16 h light / 8 h dark; and the differentiation culture time is 2-4 days.

[0050] In particular, the explant is the leaf of poplar, preferably the leaf of 4-week-old Populus alba×Populus tremula 84K tissue culture seedlings.

[0051] In particular, the leaf is cut and then subjected to the differentiation culture.

[0052] In particular, the differentiation culture medium is MS basic medium+NAA 0.05 mg / L+6-BA 0.5 mg / L+agar 6 g / L+sucrose 30 g / L.

[0053] In particular, the liquid suspension medium in step 3) is YEB liquid medium containing kanamycin and rifampicin.

[0054] In particular, the concentration of kanamycin in the liquid suspension medium is 50 mg / L, and the concentration of rifampicin is 25 mg / L.

[0055] In particular, the suspension culture conditions are: temperature 27-29℃; rotation speed 180-200rpm.

[0056] In particular, the OD600 of the Agrobacterium infection liquid containing the plant overexpression vector pBI121-PpnMYC2 is 0.6-0.8.

[0057] In particular, the colony PCR detection is: picking single colony Agrobacterium, using 35S on the expression vector pBI121 as the upstream primer F (CTATCCTTCGCAAGACCCTTC) and a sequence on the target gene PpnMYC2 as the downstream primer R (TTAGTTCTGCATTCTTTGAAAAAT) to perform colony PCR amplification, and there is a positive band of 1500bp in gel electrophoresis, which is a positive single colony.

[0058] In particular, the infection-co-culture medium in step 4) is: MS basic medium+NAA 0.05mg / L+6-BA 0.5mg / L+agar 6g / L+sucrose 30g / L.

[0059] In particular, the co-culture conditions are: co-culture temperature is 25±2℃; dark culture for 2-3 days.

[0060] In particular, step 5A) is further included, which is: rinsing the immersion-treated explants in distilled water containing cephalosporin for 20-30min, then rinsing with distilled water for 3-5 times, and then performing the resistant bud screening treatment after absorbing the water.

[0061] In particular, the selection and differentiation medium in step 5) is: MS basic medium+NAA 0.05mg / L+6-BA 0.5mg / L+Kan 30mg / L+Tim 200mg / L+agar 6g / L+sucrose 30g / L.

[0062] In particular, the culture conditions of the resistant bud screening treatment are: culture temperature is 25±2℃, illumination is 2000lx, and light cycle is 16h light / 8h dark.

[0063] In particular, the selection and rooting medium in step 6) is: 1 / 2MS basic medium+NAA 0.02mg / L+IBA 0.05mg / L+Kan 30mg / L+Tim 200mg / L+agar 6g / L+sucrose 30g / L.

[0064] In particular, the culture conditions of the rooting culture are: culture temperature is 25±2℃, illumination is 2000lx, and light cycle is 16h light / 8h dark.

[0065] In another aspect of the present application, a method for proving that the transcription factor PpnMYC2 has the function of regulating the stomatal density of poplar is provided, comprising the following steps:

[0066] A, constructing a stomatal density inhibitor EPF2 report vector, i.e. constructing a stomatal density inhibitor EPF2 plant dual luciferase detection report vector

[0067] According to the sequence information of the stomatal density inhibitor EPF2, EPF2 promoter primers EPF2-F and EPF2-R are designed, and HindIII and NcoI enzyme cutting sites are added upstream and downstream of the EPF2 promoter primers; then, the EPF2 promoter sequence is obtained by PCR amplification with poplar genomic DNA as a template; then, the EPF2 promoter is connected to the pGreenII0800 vector by a seamless cloning method, and then the ligation product is transformed into E. coli DH5α competent cells by a freeze-thaw method; single colony bacteria on the plate after transformation are subjected to PCR detection, and at this time, the single colony bacteria are used as a template. If the band size is about 2000 bp compared with Maker, the bacteria are positive bacteria. Then, the positive bacteria are added into LB liquid medium added with kanamycin for expansion culture, and then the plasmid is extracted, and at this time, the positive plasmid is obtained, forming the plant dual luciferase detection report vector pGreenII0800-ProEPF2 containing the EPF2 promoter, which is abbreviated as EPF2 vector;

[0068] B, constructing a stomatal density inhibitor EPFL4 report vector, i.e. constructing a stomatal density inhibitor EPFL4 plant dual luciferase detection report vector

[0069] According to the sequence information of the stomatal density inhibitor EPFL4, EPFL4 promoter primers EPFL4-F and EPFL4-R are designed, and HindIII and NcoI enzyme cutting sites are added upstream and downstream of the EPFL4 promoter primers; then, the EPFL4 promoter sequence is obtained by PCR amplification with poplar genomic DNA as a template; then, the EPFL4 promoter is connected to the pGreenII0800 vector by a seamless cloning method, and then the ligation product is transformed into E. coli DH5α competent cells by a freeze-thaw method; single colony bacteria on the plate after transformation are subjected to PCR detection, and at this time, the single colony bacteria are used as a template. If the band size is about 2000 bp compared with Maker, the bacteria are positive bacteria. Then, the positive bacteria are added into LB liquid medium added with kanamycin for expansion culture, and then the plasmid is extracted, and at this time, the positive plasmid is obtained, forming the plant dual luciferase detection report vector pGreenII0800-ProEPFL4 containing the EPFL4 promoter, which is abbreviated as EPFL4 vector;

[0070] C. Constructing stomatal density promoting factor EPFL9 report vector, namely constructing stomatal density promoting factor EPFL9 plant dual-luciferase detection report vector

[0071] According to the sequence information of the stomatal density promoting factor EPFL9, EPFL9 promoter primers EPFL9-F and EPFL9-R are designed, and HindIII and NcoI enzyme digestion sites are added upstream and downstream of the EPFL9 promoter primers, respectively; then, the EPFL9 promoter sequence is obtained by PCR amplification with poplar genomic DNA as a template; then, the EPFL9 promoter is connected to the pGreenII0800 vector by a seamless cloning method, and then the ligation product is transformed into E. coli DH5α competent cells by a freeze-thaw method, and the single colony bacteria on the plate after transformation are subjected to PCR detection, at this time, the single colony bacteria are used as a template. If the band size is about 2000 bp compared with Maker, the bacteria are positive bacteria. Then, the positive bacteria are added to LB liquid medium added with kanamycin for expansion culture, and then the plasmid is extracted, at this time, the positive plasmid is obtained, and the plant dual-luciferase detection report vector pGreenII0800-ProEPFL9 containing the EPFL9 promoter is formed, which is abbreviated as EPFL9 vector;

[0072] D. Constructing plant expression vector pGWB17-PpnMYC2 containing PpnMYC2 gene

[0073] According to the sequence information of the PpnMYC2 transcription factor, forward and reverse primers pGWB17-PpnMYC2-F and pGWB17-PpnMYC2-R are designed, and XbaI and PacI enzyme digestion sites are added upstream and downstream of the primers, respectively; then, the PpnMYC2 transcription factor sequence with a pGWB17 vector adapter is obtained by PCR amplification with the PpnMYC2 transcription factor as a template; then, the PpnMYC2 transcription factor with the pGWB17 vector adapter is connected to the plant expression vector pGWB17 by a seamless cloning method, and then the ligation product is transformed into E. coli DH5α competent cells by a freeze-thaw method, and the single colony bacteria on the plate after transformation are subjected to PCR detection, at this time, the single colony bacteria are used as a template. If the band size is about 1500 bp compared with Maker, the bacteria are positive bacteria. Then, the positive bacteria are added to LB liquid medium added with kanamycin for expansion culture, and then the plasmid is extracted, at this time, the positive plasmid is obtained, and the expression vector pGWB17-PpnMYC2 containing the PpnMYC2 transcription factor is formed;

[0074] E. Plant expression empty vector pGWB17, plant expression vector pGWB17-PpnMYC2, EPF2 vector, EPFL4 vector, and EPFL9 vector were transformed into Agrobacterium using the freeze-thaw method to obtain five Agrobacterium engineered strains containing pGWB17 empty vector, pGWB17-PpnMYC2 vector, EPF2 vector, EPFL4 vector, and EPFL9 vector, respectively.

[0075] F. Add acetylsuccione to the bacterial culture of the five Agrobacterium engineered bacteria obtained in step E, with a final concentration of 200 μmol / L and 10 mmol / L of buffer 2-morpholine ethanesulfonic acid, respectively, to obtain five Agrobacterium engineered bacteria transformation solutions containing pGWB17 empty vector, pGWB17-PpnMYC2 vector, EPF2 vector, EPFL4 vector, and EPFL9 vector.

[0076] G. The transformation solutions of Agrobacterium-derived bacteria containing the empty pGWB17 vector and the pGWB17-PpnMYC2 vector were respectively mixed with the transformation solutions of Agrobacterium-derived bacteria containing the EPF2 vector, the EPFL4 vector, and the EPFL9 vector at a 1:1 ratio to obtain mixed transformation solutions of six types of Agrobacterium-derived bacteria. These solutions include: a mixed transformation solution containing the empty pGWB17 vector and the EPF2 vector (referred to as pGWB17+ProEPF2), a mixed transformation solution containing the empty pGWB17 vector and the EPFL4 vector (referred to as pGWB17+ProEPFL4), and a mixed transformation solution containing pG... The following are examples of bacterial transformation solutions: a mixed transformation culture containing empty WB17 vector and EPFL9 vector (pGWB17+ProEPFL9), a mixed transformation culture containing pGWB17-PpnMYC2 vector and EPF2 vector (ppnMYC2+ProEPF2), a mixed transformation culture containing pGWB17-PpnMYC2 vector and EPFL4 vector (ppnMYC2+ProEPFL4), and a mixed transformation culture containing pGWB17-PpnMYC2 vector and EPFL9 vector (ppnMYC2+ProEPFL9).

[0077] H. A mixed transformation solution of six Agrobacterium-mediated transformation bacteria was injected into plant leaves. Three days after injection, the corresponding leaves were collected and soaked in a 150 μg / ml luciferase buffer. Luciferase activity was then detected using a Night Shade LB 985 system. The injected leaves were then ground, and LUC and REN enzyme activities were measured. Finally, the LUC / REN ratio was compared.

[0078] If the ratio of LUC / REN of the leaf injected with PpnMYC2+ProEPF2 mixed transformation bacterial liquid is higher than that of the leaf injected with pGWB17+ProEPF2 mixed transformation bacterial liquid, it indicates that PpnMYC2 has an activating effect on ProEPF2, promotes its expression, and reduces the stomatal density of the leaf; otherwise, it is an inhibitory effect.

[0079] If the ratio of LUC / REN of the leaf injected with PpnMYC2+ProEPFL4 mixed transformation bacterial liquid is higher than that of the leaf injected with pGWB17+ProEPFL4 mixed transformation bacterial liquid, it indicates that PpnMYC2 has an activating effect on ProEPFL4, promotes its expression, and reduces the stomatal density of the leaf; otherwise, it is an inhibitory effect.

[0080] If the ratio of LUC / REN of the leaf injected with PpnMYC2+ProEPFL9 mixed transformation bacterial liquid is lower than that of the leaf injected with pGWB17+ProEPFL9 mixed transformation bacterial liquid, it indicates that PpnMYC2 has an inhibitory effect on ProEPFL9, inhibits its expression, and reduces the stomatal density of the leaf; otherwise, it is a promoting effect.

[0081] In particular, the primer EPF2-F in step A) is: CGGTATCGATAAGCTATTGAGGTTTGGTAGAGACG (SEQ ID NO. 7); and the primer EPF2-R is: TTGGCGTCTTCCATGAAAGAAGTTGCTGAGTGGAG (SEQ ID NO. 8).

[0082] In particular, the seamless cloning method is a conventional method in the art. Seamless cloning means that the ends of the vector and the ends of the primers have 15-20 homologous bases, so that the PCR products obtained have 15-20 bases at both ends which are homologous to the sequence of the vector, and rely on the complementary pairing force between bases to form a ring, without the need for enzyme connection, and can be directly used for transforming host bacteria, and the linear plasmid (circular) in the host bacteria relies on its own enzyme system to repair the gap.

[0083] In particular, the primer EPFL4-F in step B) is: CGGTATCGATAAGCTAACTTCAGATAATGGCATAGTACTC (SEQ ID NO. 10); and the primer EPFL4-R is: TTGGCGTCTTCCATGGTGGAGTTGCTGCAAGTTAG (SEQ ID NO. 11).

[0084] In particular, the primer EPFL9-F in step C) is: CGGTATCGATAAGCTATTGTTTCTTGGTCCAC AGTGC (SEQ ID NO. 13); the primer EPFL9-R is: TTGGCGTCTTCCATGTTCTAATTCCCTTT GTATCAAGG (SEQ ID NO. 14).

[0085] In particular, the seamless cloning in steps A), B), C) is to incubate the EPF2 / EPFL4 / EPFL9 promoter and the vector pGreenII0800 in Infusion seamless cloning enzyme at 50°C for 15 minutes, so as to obtain the corresponding ligation product.

[0086] In particular, steps A1), B1), C1) further comprise positive detection of the single clone bacteria obtained by the freeze-thaw method, PCR detection with a single colony as a template, and if the band size is about 2000bp, it indicates that the vector construction is successful and a positive plasmid is obtained.

[0087] In particular, steps A1), B1), C1) further comprise positive detection of the single clone bacteria obtained by the freeze-thaw method, PCR detection with a single colony as a template, and if the band size is about 2000bp, it indicates that the vector construction is successful and a positive plasmid is obtained.

[0088] In particular, the primer pGWB17-PpnMYC2-F in step D) is: CACGGGGGACTCTAGATGGAAGAGATACTGTCCTCC (SEQ ID NO. 16); the primer pGWB17-PpnMYC2-R is: TTTT GTTCACCGTTAGTTCTGCATTCTTTGAAAAAT (SEQ ID NO. 17).

[0089] In particular, the seamless cloning in step D) is to incubate the PpnMYC2 transcription factor with the pGWB17 vector linker and the pGWB17 vector in Infusion seamless cloning enzyme at 50°C for 15 minutes, so as to obtain the corresponding ligation product.

[0090] In particular, step D1) further comprises positive strain screening, positive detection of the single clone bacteria obtained by the freeze-thaw method, and PCR detection with a single colony as a template, and if the band size is about 1500bp, it indicates that the vector construction is successful and a positive bacteria is obtained.

[0091] In particular, the single colony extraction plasmid with a band size of 1500bp is sequenced, and the sequencing result is compared with the sequence of the target gene PpnMYC2 transcription factor; if the comparison result is completely consistent, the vector construction is successful, and a positive plasmid is obtained.

[0092] In particular, the LUC and REN enzyme activities are detected by using a dual luciferase reporter gene detection kit in step H).

[0093] The present application is realized by the following technical solutions:

[0094] In a first aspect, the present application provides a recombinant expression vector comprising a nucleotide sequence of a poplar bHLH transcription factor PpnMYC2.

[0095] In a second aspect, the present application discloses an application of the poplar bHLH transcription factor PpnMYC2 in regulating stomatal density, wherein the transcription factor PpnMYC2 can activate the promoter activity of the stomatal density inhibitor EPF2 and EPFL4 and inhibit the promoter activity of the stomatal density promoter EPFL9 in the stomatal development process.

[0096] Further, overexpression of the PpnMYC2 gene can reduce the stomatal density of the transgenic plants and improve the water use efficiency of the plants.

[0097] Further, the method comprises the following steps:

[0098] Step one, connecting the nucleotide sequence of the poplar bHLH transcription factor PpnMYC2 to the regulatory sequence of the plant expression empty vector pGWB17 to construct an expression vector pGWB17-PpnMYC2 containing the PpnMYC2 nucleotide sequence;

[0099] Step two, cloning the promoters ProEPF2, ProEPFL4 and ProEPFL9 of the stomatal density inhibitor EPF2, EPFL4 and the stomatal density promoter EPFL9 to construct plant dual luciferase detection reporter vectors pGreenII0800-ProEPF2, pGreenII0800-ProEPFL4 and pGreenII0800-ProEPFL9;

[0100] Step three, respectively transforming the pGWB17 empty vector, the pGWB17-PpnMYC2 plant expression vector and the plant dual luciferase detection reporter vectors pGreenII0800-ProEPF2, pGreenII0800-ProEPFL4 and pGreenII0800-ProEPFL9 into the agrobacterium strain GV3101 with a pSoup19 auxiliary plasmid to obtain agrobacterium strains containing the target vectors, respectively;

[0101] Step four, the Agrobacterium engineering strains containing the pGWB17 empty vector, pGWB17-PpnMYC2 plant expression vector were mixed with the Agrobacterium engineering strains containing the pGreenII0800-ProEPF2 or pGreenII0800-ProEPFL4 or pGreenII0800-ProEPFL9 plant dual luciferase detection reporter vector at a ratio of 1:1, and then injected into the tobacco leaves grown for 4-5 weeks by injection infection, dark culture for one day, and light culture for one day;

[0102] Step five, the leaves were collected on the third day after injection infection, and infiltrated with 150 μg / ml luciferin. The Night SHADE LB 985 system was used to detect luciferase activity. At the same time, the leaves injected with the bacterial solution were ground, and the Biyun Tian dual luciferase reporter gene detection kit (Beyotime, RG027) was used to detect the activities of LUC and REN enzymes, and the ratio was calculated to determine the activation of the stomatal density inhibitor EPF2 and EPFL4 promoters by the transcription factor PpnMYC2, and the inhibition of the stomatal density promoter EPFL9.

[0103] In particular, the target vectors in step three are pGWB17-PpnMYC2, pGreenII0800-ProEPF2, pGreenII0800-ProEPFL4 and pGreenII0800-ProEPFL9, four vectors containing target genes and one pGWB17 empty vector.

[0104] In particular, Agrobacterium strains containing target vectors pGWB17-PpnMYC2, pGreenII0800-ProEPF2, pGreenII0800-ProEPFL4 and pGreenII0800-ProEPFL9 and pGWB17 empty vector were obtained, respectively.

[0105] The GV3101 Agrobacterium transformation (freeze-thaw method) steps are as follows:

[0106] Firstly, the Agrobacterium competent cells stored at -80°C were taken to room temperature, and then partially thawed, and the Agrobacterium in ice water mixed state was inserted into ice;

[0107] Then: add 0.01-1 μg plasmid DNA (i.e. empty vector or vector plasmid with target gene fragment obtained after constructing target gene to vector, with higher transformation efficiency, and the amount of plasmid added should be determined by pre-experiment before first use) to each 100 μl Agrobacterium competent cells;

[0108] Especially, the plasmid is pGWB17 empty vector, expression vector pGWB17-PpnMYC2 containing PpnMYC2 nucleotide sequence, plant dual luciferase reporter vector pGreenII0800-ProEPF2, plant dual luciferase reporter vector pGreenII0800-ProEPFL4, plant dual luciferase reporter vector pGreenII0800-ProEPFL9.

[0109] Then: 700 μl of LB medium (5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, add water to 1 L, sterilize at 121 ℃ for 15 min) or YEB liquid medium (10 g / L yeast extract, 10 g / L peptone, 5 g / L sodium chloride, add water to 1 L, sterilize at 121 ℃ for 15 min) without antibiotics is added, and the culture is shaken at 28 ℃ for 2-3 h.

[0110] Then: 6000 rpm centrifugation for 1 min, discard part of the supernatant, take about 100 μl of supernatant, and gently blow the precipitate after centrifugation to resuspend the precipitate, then spread on LB or YEB plate containing antibiotics, and invert in a 28 ℃ incubator for 2-4 days until the plate is covered with colonies; wherein:

[0111] Especially, the LB or YEB plate medium containing antibiotics is: LB or YEB plate medium containing 50 μg / ml Kan (kanamycin) or containing 50 μg / ml Kan and 20 μg / ml Rif (rifampicin) or containing 50 μg / ml Rif.

[0112] Especially, when the plate medium contains only 50 μg / ml Kan, it can be cultured at 28 ℃ for 48 h; when the plate medium contains 50 μg / ml Kan and 20 μg / ml Rif, it needs to be cultured at 28 ℃ for 60 h; if the plate medium used contains 50 μg / ml Rif, it needs to be cultured at 28 ℃ for 72-90 h.

[0113] In a third aspect, the present application provides an application of using overexpression of PpnMYC2 to reduce the stomatal density of poplar and enhance water use efficiency, comprising the following steps:

[0114] Step one, cloning poplar bHLH transcription factor PpnMYC2;

[0115] Step two, connecting PpnMYC2 transcription factor to plant overexpression vector pBI121-GFP to form an overexpression vector containing PpnMYC2 transcription factor;

[0116] Step three, the PpnMYC2 transcription factor containing overexpression vector in step two was transformed into Agrobacterium GV3101 strain to obtain Agrobacterium strain GV3101 containing the overexpression vector;

[0117] Step four, the Agrobacterium containing the overexpression vector in step three was transformed into 84K poplar, and resistant seedlings were obtained through kanamycin screening. Then, plant DNA was extracted and positive detection was performed by PCR to obtain transgenic poplar plants;

[0118] Step five, the stomatal phenotype of the transgenic plants obtained in step four and the wild type plants was observed under a scanning electron microscope, and the stomatal density of the wild type plants and the transgenic plants was counted;

[0119] Step six, the net CO2 assimilation rate (A) and transpiration rate (Tr) of the wild type plants (WT) and the overexpression plants (PpnMYC2-OE) obtained in step four were detected under greenhouse conditions (16h light / d; temperature: 25℃; relative humidity: 40-45%) using a portable photosynthesis meter (Li-Cor 6400; Lincoln, NE, USA), and the water use efficiency of the wild type plants (WT) and the overexpression plants (PpnMYC2-OE) was calculated.

[0120] Further, the specific steps are as follows:

[0121] Step one, cloning the poplar bHLH transcription factor PpnMYC2;

[0122] Step two, connecting the transcription factor PpnMYC2 obtained by cloning to the plant overexpression empty vector pBI121-GFP to form the overexpression vector pBI121-PpnMYC2-GFP;

[0123] Step three, transforming the overexpression vector pBI121-PpnMYC2-GFP into Agrobacterium GV3101 strain to obtain Agrobacterium strain GV3101 containing the overexpression vector pBI121-PpnMYC2-GFP;

[0124] Step four, transforming Agrobacterium containing the overexpression vector pBI121-PpnMYC2-GFP into 84K poplar, then obtaining resistant seedlings through kanamycin screening, then extracting plant DNA and performing positive detection by PCR to obtain positive transgenic poplar plants (i.e. overexpression plants (PpnMYC2-OE));

[0125] Step five, observing and analyzing the stomatal phenotype of the positive transgenic poplar plants under a scanning electron microscope, and counting the stomatal density of the transgenic plants; at the same time, observing and analyzing the stomatal phenotype of the wild type poplar plants, and counting the stomatal density of the wild type plants;

[0126] Step six, using a portable photosynthesis tester (Li-Cor 6400; Lincoln, NE, USA) under room temperature conditions (16h light / d; temperature: 25℃; relative humidity: 40-45%) to detect the net CO2 assimilation rate (A) and transpiration rate (Tr) of the positive transgenic plants (i.e. overexpression plants (PpnMYC2-OE)) obtained in step four, and according to formula (1), the water use efficiency of the overexpression plants (PpnMYC2-OE) is calculated, wherein formula (1) is as follows:

[0127] Water use efficiency = A / Tr (1);

[0128] Step seven, using a portable photosynthesis tester to detect the net CO2 assimilation rate (A) and transpiration rate (Tr) of the wild type plants (WT) under room temperature conditions, and according to formula (1), the water use efficiency of the wild type plants (WT) is calculated.

[0129] PpnMYC2 is a bHLH type transcription factor cloned from poplar, and overexpression of PpnMYC2 in poplar can significantly reduce the stomatal density and improve the water use efficiency, so cloning the gene has important significance for genetic engineering breeding of poplar. Through the search of the prior art documents, no report related to the PpnMYC2 gene of the application in reducing the stomatal density has been found. The application and function of the bHLH type transcription factor MYC2 are first proposed in the application.

[0130] In the application, the PpnMYC2 gene is cloned from poplar, an overexpression vector containing the PpnMYC2 gene is constructed, the PpnMYC2 gene overexpression vector is transformed into poplar by using Agrobacterium GV3101 mediation and leaf disc method; the integration of the exogenous target gene PpnMYC2 is detected by PCR, and the stomatal density of the transgenic poplar is observed by scanning electron microscope, indicating that the stomatal density of the obtained PpnMYC2 overexpression transgenic poplar is significantly reduced.

[0131] In the application, various vectors known in the art can be selected, such as commercially available vectors, including plasmids, cosmids and the like.

[0132] In the application, the Agrobacterium is Agrobacterium tumefaciens, and the strains are GV3101 and GV3101 (pSoup19), which can be publicly purchased in the market.

[0133] Compared with the prior art, the advantages of the present application are as follows: the transcription factor PpnMYC2 which negatively regulates stomatal density is found to have significant activation effect on stomatal density inhibitor EPF2 and EPFL4 and significant inhibition effect on stomatal density promoter EPFL9, overexpression of PpnMYC2 can significantly reduce the stomatal density of plants and improve the water use efficiency of plants. The present application changes the expression of corresponding genes in poplar plants by using genetic engineering means, reduces the stomatal density, and provides a new strategy for improving the water use efficiency of poplar.

[0134] The present application will be further described below in combination with the drawings to fully illustrate the purposes, technical features and technical effects of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0135] Figure 1A is the fluorescence graph of tobacco transiently transformed PpnMYC2 and EPF2 promoter.

[0136] Figure 1B is the LUC / REN value after tobacco transiently transformed PpnMYC2 and EPF2 promoter.

[0137] Figure 2A is the fluorescence graph of tobacco transiently transformed PpnMYC2 and EPFL4 promoter.

[0138] Figure 2B is the LUC / REN value after tobacco transiently transformed PpnMYC2 and EPFL4 promoter.

[0139] Figure 3A is the fluorescence graph of tobacco transiently transformed PpnMYC2 and EPFL9 promoter.

[0140] Figure 3B is the LUC / REN value after tobacco transiently transformed PpnMYC2 and EPFL9 promoter.

[0141] Figure 4 is the agarose gel electrophoresis graph of overexpression poplar positive plants. 1-10 are positive plants, P is a positive control, and WT is a non-transformed wild type plant, i.e. a negative control.

[0142] Figure 5A is the scanning electron microscope graph of stomata of overexpression PpnMYC2 poplar (PpnMYC2-OE) and wild type (WT) poplar.

[0143] Figure 5B is the statistical graph of stomatal density of overexpression PpnMYC2 poplar (PpnMYC2-OE) and wild type (WT).

[0144] Figure 6Water use efficiency statistics of overexpressing PpnMYC2 poplar (PpnMYC2-OE) and wild type (WT). DETAILED DESCRIPTION

[0145] The following detailed description of the embodiments of the present application is made on the premise of the technical solutions of the present application, and detailed implementation manners and specific operation processes are given, but the protection scope of the present application is not limited to the following examples. The experimental methods not specified in the following examples are usually carried out according to the conventional conditions or the conditions recommended by the manufacturers.

[0146] Example 1 Cloning of PpnMYC2 gene of poplar

[0147] 1. Extraction of total RNA of poplar genome

[0148] The total RNA of plant explants (poplar leaf tissue) was extracted according to the method of the TIANGEN kit instructions. The quality of the total RNA was identified by agarose gel electrophoresis, and the RNA concentration was determined on a spectrophotometer.

[0149] In this example, the total RNA of poplar leaf tissue was extracted, and the RNA concentration was 568 ng / μL.

[0150] 2. Cloning of PpnMYC2 gene of poplar

[0151] 2A. The cDNA reverse transcribed from the extracted total RNA of poplar was used as a template, and the amount of 1.76 μL was calculated according to the RNA concentration, and the cDNA was obtained under the action of reverse transcriptase;

[0152] 2B. The specific primers (cloning primers F / R) of PpnMYC2 gene were designed according to the nucleotide sequence of PpnMYC2 gene:

[0153] The cloning forward primer F is ATGGAAGAGATACTGTCCTCC (SEQ ID NO. 1);

[0154] The cloning reverse primer R is TTAGTTCTGCATTCTTTGAAAAAT (SEQ ID NO. 2);

[0155] 2C. The PpnMYC2 gene was amplified from the total cDNA by PCR amplification, and the PCR amplification program and reaction system were as follows:

[0156] The PCR amplification program was as follows: 94℃ pre-denaturation for 4 min, and then enter the cycle amplification stage: 94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, cycle for 30 times; 72℃ for 5 min for incubation, and then end the reaction, and the PCR product was stored at 4℃.

[0157] PCR reaction system: 10 μL Taq enzyme, 8 μL ddH2O, 0.5 μL primer F / R, 1 μL DNA, total volume 20 μL.

[0158] 2D, PCR products were recovered and purified for sequencing (Kaike Biological Co., Ltd.), and the PpnMYC2 transcription factor sequence in poplar (SEQ ID NO. 3) was obtained.

[0159] Example 2 Construction of PpnMYC2 gene-containing plant overexpression vector

[0160] The PpnMYC2 transcription factor sequence obtained in Example 1 was constructed on the plant overexpression empty vector pBI121-GFP to obtain the plant overexpression vector pBI121-PpnMYC2 containing the PpnMYC2 gene.

[0161] 1. In order to facilitate the construction of overexpression vector, the forward / reverse primers for cloning PpnMYC2 transcription factor were designed according to the nucleotide sequence of PpnMYC2 gene, and XbaI enzyme cutting site was introduced in the forward primer (PpnMYC2-F), and SalI enzyme cutting site was introduced in the reverse primer (PpnMYC2-R), and the forward / reverse primer sequences are as follows:

[0162] Forward primer PpnMYC2-F: CGGGGGACTCTAATGGAAGAGATACTGTCCTC (SEQ ID NO. 4),

[0163] Reverse primer PpnMYC2-R: ACTAGTCAGTCGACTGTTCTGCATTCTTTGAAAAAT (SEQ ID NO. 5).

[0164] 2. The PpnMYC2 transcription factor obtained in Example 1 was used as a template for PCR amplification to obtain the PpnMYC2 transcription factor containing the pBI121-GFP vector adapter primer, and the PCR amplification program and reaction system are as follows:

[0165] PCR amplification program: 94°C pre-denaturation for 4 min, enter the cycle amplification stage: 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, cycle 30 times; 72°C for 5 min, end the reaction, and store the PCR product at 4°C.

[0166] PCR reaction system: 10 μL Taq enzyme, 8 μL ddH2O, 0.5 μL primer PpnMYC2-F / R, 1 μL DNA, total volume 20 μL system.

[0167] After the PCR product is recovered and purified, the PpnMYC2 transcription factor sequence containing the pBI121-GFP vector linker primer (SEQ ID NO. 6) is obtained.

[0168] 3. The PpnMYC2 transcription factor sequence containing the pBI121-GFP vector linker primer cloned in step 2 is connected to the overexpression empty vector pBI121-GFP using the seamless cloning method, and then the ligation product is transformed into E. coli DH5a competent cells (E. coli DH5a is a commonly used strain for plasmid cloning) using the freeze-thaw method. The single colony bacteria on the plate after transformation are subjected to PCR detection, and the single colony bacteria are used as the template. If the band size is about 1500 bp compared with the Maker, the single colony bacteria are sent to the company for sequencing. If the sequencing results are completely consistent with the sequence of the target gene, the bacteria are positive. The positive bacteria are then added to LB liquid medium containing kanamycin for expansion, and the plasmid is extracted. At this time, the positive plasmid is obtained, the plant overexpression vector is constructed, and the plant overexpression vector containing the PpnMYC2 gene pBI121-PpnMYC2 is obtained.

[0169] PCR amplification procedure: 94°C pre-denaturation for 4 min, then enter the cycle amplification stage: 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, cycle 30 times; 72°C for 5 min for incubation, end the reaction, and store the PCR product at 4°C.

[0170] PCR reaction system: 10 μL Taq enzyme, 8 μL ddH2O, 0.5 μL primer PpnMYC2-F / R, 1 μL DNA, total volume 20 μL system.

[0171] Freeze-thaw method for transformation of E. coli DH5a competent cells

[0172] 1. Take the DH5a competent cells out of -80°C, quickly insert into ice, after 5 minutes, melt the bacterial block, add the ligation product, and gently mix the EP tube bottom with hand (avoid using gun suction). Incubate in ice for 25 minutes.

[0173] 2. 42°C water bath heat shock for 45 seconds, quickly put back on ice and incubate for 2 minutes, shaking will reduce the transformation efficiency.

[0174] 3. Add 700 μl of sterile medium (LB liquid medium) without antibiotics to the centrifuge tube, mix well, then recover at 37°C, 200 rpm for 60 minutes.

[0175] 4. Centrifuge at 5000 rpm for 1 minute to collect the bacterial bodies, take about 100 μl of supernatant, resuspend the bacterial block by blowing gently, and spread on LB medium containing kanamycin.

[0176] 5. The plates were inverted and incubated at 37°C overnight to obtain single colonies.

[0177] The seamless cloning conditions were: Infusion Seamless Cloning Enzyme (purchased from Takara Bio Company), 50°C, incubation for 15 minutes.

[0178] The seamless cloning method is a conventional method in the art. Seamless cloning means that the vector end and the primer end have 15-20 homologous bases, so that the PCR product obtained has 15-20 bases at both ends which are homologous to the sequence of the vector. The bases are complementary to each other by base interaction and form a ring, which can be directly used for transformation of host bacteria without enzyme ligation. The linear plasmid (circular) in the host bacteria relies on its own enzyme system to repair the gap.

[0179] Example 3 Construction of stomatal density suppressor EPF2 promoter dual luciferase reporter vector

[0180] 1. PCR amplification of the promoter of stomatal density suppressor EPF2

[0181] 1A. According to the sequence information of stomatal density suppressor EPF2, design EPF2 promoter amplification specific primers (i.e. EPF2-promoter primers: EPF2-F and EPF2-R); wherein HindIII and NcoI enzyme digestion sites are added upstream and downstream of the EPF2-promoter primers, and the EPF2-promoter primers are as follows:

[0182] Forward primer EPF2-F: CGGTATCGATAAGCTATTGAGGTTTGGTAGAGACG (SEQ ID NO. 7),

[0183] Reverse primer EPF2-R: TTGGCGTCTTCCATGAAAGAAGTTGCTGAGTGGAG (SEQ ID NO. 8).

[0184] 1B. Using poplar genomic DNA as a template, the EPF2 promoter was obtained by PCR amplification, and the PCR amplification program and reaction system are as follows:

[0185] PCR amplification program: 94°C pre-denaturation for 4 min, then enter the cycle amplification stage: 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, cycle for 30 times; 72°C for 5 min for incubation, end the reaction, and store the PCR product at 4°C.

[0186] PCR reaction system: 10 μL Taq enzyme, 8 μL ddH2O, 0.5 μL primer EPF2-F / R, 1 μL DNA, total volume 20 μL.

[0187] 1C, PCR product agarose gel electrophoresis band is the same as Marker molecular band, after recovery and purification, sequencing, the promoter sequence of Populus stomatal density inhibitor EPF2 (SEQ ID NO. 9) is obtained.

[0188] PCR amplification of the promoter of stomatal density inhibitor EPF2 is detected in the same way as the detection of PpnMYC2 gene cloning, that is, the PCR product is recovered and purified, and then sequenced. If the sequencing result is correct, the amplification is successful.

[0189] 2, using the method of seamless cloning, incubating the EPF2 promoter sequence obtained in step 1C in Infusion seamless cloning enzyme at 50°C for 15 minutes, then connecting the EPF2 promoter sequence to the pGreenII0800 vector by the method of seamless cloning, then transforming the ligation product into E. coli DH5α competent cells by freeze-thaw method (E. coli DH5α is a commonly used strain for plasmid cloning), obtaining the plant dual luciferase detection reporter vector pGreenII0800-ProEPF2;

[0190] The detection method of whether the vector construction is successful is the same as the detection method of PpnMYC2 plant overexpression vector, that is, PCR detection is performed on single colony bacteria on the transformed plate, if the PCR agarose gel electrophoresis detection band is the same as the Marker molecular band, that is, the PCR detection is correct (about 2000bp), then the plasmid of the single colony with correct band is extracted for sequencing, and the sequencing result is correct, which means that the vector construction is successful, and the positive plasmid is obtained.

[0191] Example 4 Construction of Stomatal Density Inhibitor EPFL4 Promoter Dual Luciferase Reporter Vector

[0192] 1. PCR amplification of the promoter of stomatal density inhibitor EPFL4

[0193] 1A, according to the sequence information of stomatal density inhibitor EPFL4, design EPFL4 promoter amplification specific primers (i.e. EPFL4-promoter primers: EPFL4-F and EPFL4-R), take Populus genomic DNA as template for PCR amplification, obtain EPFL4 promoter sequence, wherein, add HindIII and NcoI enzyme cutting sites to the upstream and downstream of the primers respectively, EPFL4-promoter primers are as follows:

[0194] Forward primer EPFL4-F: CGGTATCGATAAGCTAACTTCAGATAATGGCATAGTACTC (SEQ ID NO. 10),

[0195] Reverse primer EPFL4-R: TTGGCGTCTTCCATGGTGGAGTTGCTGCAAGTTAG (SEQ ID NO. 11).

[0196] 1B. Using Populus genome DNA as a template, EPFL4-promoter was obtained by PCR amplification. The PCR amplification procedure and reaction system are as follows.

[0197] PCR amplification procedure: same as step 1B of Example 3.

[0198] PCR reaction system: 10 μL Taq enzyme, 8 μL ddH2O, 0.5 μL primer EPFL4-F / R, 1 μL DNA, total volume 20 μL system.

[0199] 1C. The PCR product agarose gel electrophoresis band is the same as the Marker molecular band. After recovery and purification, sequencing is performed to obtain the promoter sequence of Populus stomatal density inhibitor EPFL4 (SEQ ID NO. 12).

[0200] The detection method of PCR amplification of the promoter of stomatal density inhibitor EPFL4 is the same as that of the cloning of PpnMYC2 gene, i.e. after recovery and purification, the PCR product is sequenced. If the sequencing result is correct, the amplification is successful.

[0201] 2. Using the seamless cloning method, the EPFL4 promoter sequence obtained in step 1C is connected to the pGreenII0800 vector by the seamless cloning method at 50°C for 15 minutes. Then the ligation product is transformed into E. coli DH5α competent cells by freeze-thaw method to obtain the plant dual luciferase detection reporter vector pGreenII0800-ProEPFL4.

[0202] The detection method of whether the vector construction is successful is the same as the detection method of PpnMYC2 plant overexpression vector, i.e. PCR detection is performed on the single colony bacteria on the transformed plate. If the PCR agarose gel electrophoresis detection band is the same as the Marker molecular band, i.e. the PCR detection is correct (about 2000 bp), then the plasmid of the single colony with correct band is extracted for sequencing. The correct sequencing result indicates that the vector construction is successful, and a positive plasmid is obtained.

[0203] Example 5 Construction of Stomatal Density Promoter EPFL9 Dual Luciferase Reporter Vector

[0204] 1. PCR amplification of the promoter of stomatal density promoter EPFL9

[0205] 1A, according to the sequence information of stomatal density promoting factor EPFL9, the specific primers of EPFL9 promoter amplification (namely EPFL9-promoter primers: EPFL9-F and EPFL9-R) are designed, and the EPFL9 promoter sequence is obtained by PCR amplification with poplar genomic DNA as a template, wherein the HindIII and NcoI enzyme cutting sites are added to the upstream and downstream of the primers respectively, and the EPFL9-promoter primers are as follows:

[0206] EPFL9-F: CGGTATCGATAAGCTATTGTTTCTTGGTCCACAGTGC (SEQ ID NO. 13),

[0207] EPFL9-R: TTGGCGTCTTCCATGTTCTAATTCCCTTTGTATCAAGG (SEQ ID NO. 14).

[0208] 1B, the EPFL9-promoter is obtained by PCR amplification with poplar genomic DNA as a template, and the PCR amplification procedure and reaction system are as follows:

[0209] PCR amplification procedure: same as step 1B of example 3.

[0210] PCR reaction system: 10 μL Taq enzyme, 8 μL ddH2O, 0.5 μL primer EPFL9-F / R, 1 μL DNA, and the total volume is 20 μL.

[0211] 1C, the PCR product agarose gel electrophoresis band is the same as the Marker molecular band, and the sequence is obtained after recovery and purification, and the promoter sequence of poplar stomatal density promoting factor EPFL9 (SEQ ID NO. 15) is obtained.

[0212] The detection method of PCR amplification of the promoter of stomatal density promoting factor EPFL9 is the same as that of the cloning of PpnMYC2 gene, that is, the PCR product is recovered and purified, and then sequenced. If the sequencing result is correct, the amplification is successful.

[0213] 2, by using the method of seamless cloning, the EPFL9 promoter sequence obtained in step 1C is connected to the pGreenII0800 vector by the method of seamless cloning under the action of Infusion seamless cloning enzyme at 50°C for 15 minutes, and then the ligation product is transformed into E. coli DH5α competent cells by freeze-thaw method, and the plant dual luciferase detection report vector pGreenII0800-ProEPFL9 is obtained;

[0214] The detection method of whether the vector construction is successful is the same as the detection method of PpnMYC2 plant overexpression vector, that is, PCR detection is performed on single colony bacteria on the transformed plate. If the PCR agarose gel electrophoresis detection band is the same as the marker molecular band, that is, the PCR detection is correct (about 2000 bp), then the plasmid of the single colony with correct band is extracted for sequencing. If the sequencing result is correct, the vector construction is successful, and a positive plasmid is obtained.

[0215] Example 6 Construction of PpnMYC2 Expression Vector

[0216] 1. PCR amplification of PpnMYC2 transcription factor with pGWB17 vector adapter

[0217] 1A. According to the sequence information of the transcription factor PpnMYC2 obtained in Example 1, primers are designed, and Xba I and Pac I enzyme digestion sites are added to the upstream and downstream of the primers (pGWB17-PpnMYC2-F / R), respectively. The primers are as follows:

[0218] pGWB17-PpnMYC2-F: CACGGGGGACTCTAGATGGAAGAGATACTGTCCTCC (SEQ ID NO. 16)

[0219] pGWB17-PpnMYC2-R: TTTTGTTCACCGTTAGTTCTGCATTCTTTGAAAAAT (SEQ ID NO. 17)

[0220] 1B. The sequence of the transcription factor PpnMYC2 obtained in Example 1 is used as a template to obtain the PpnMYC2 transcription factor sequence with the pGWB17 vector adapter by PCR amplification, wherein:

[0221] PCR amplification procedure: 94°C pre-denaturation for 4 min, then enter the cycle amplification stage: 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, cycle for 30 times; 72°C for 5 min for incubation, end the reaction, and store the PCR product at 4°C.

[0222] PCR reaction system: 10 μL Taq enzyme, 8 μL ddH2O, 0.5 μL primers pGWB17-PpnMYC2-F / R, 1 μL template, total volume 20 μL system.

[0223] 1C. After the PCR product is recovered and purified, the PpnMYC2 transcription factor sequence with the pGWB17 vector adapter (SEQ ID NO. 18) is obtained.

[0224] The detection method of PCR amplification of PpnMYC2 transcription factor sequence with pGWB17 vector adapter is that if the band is correct (about 1500 bp) after the PCR product is recovered and purified, the amplification is successful.

[0225] 2. The cloned PpnMYC2 transcription factor sequence with pGWB17 vector adapter is connected to the empty pGWB17 vector by seamless cloning method, that is, the PpnMYC2 transcription factor with pGWB17 vector adapter is added to Infusion seamless cloning enzyme, and the reaction is carried out at 50°C for 15 minutes to obtain the ligation product, and then the ligation product is transformed into E. coli DH5a competent cells by freeze-thaw method to obtain the plant expression vector pGWB17-PpnMYC2, that is, the plant expression vector pGWB17-PpnMYC2 containing PpnMYC2 transcription factor.

[0226] The detection method of whether the vector construction is successful is the same as the detection method of PpnMYC2 plant overexpression vector, that is, the single colony bacteria on the transformed plate are detected by PCR, and if the PCR detection band is correct (that is, the size of the agarose gel electrophoresis is the same as that of the marker of about 1500 bp), that is, the fragment size is about 1500 bp, then the plasmid of the single colony with correct band is extracted for sequencing, and the correct sequencing result indicates that the vector construction is successful, and the positive plasmid is obtained.

[0227] Example 7 Tobacco transient transformation detects the activation of stomatal density inhibiting factors EPF2 and EPFL4 promoters and the inhibition of stomatal density promoting factor EPFL9 promoter by transcription factor PpnMYC2

[0228] 1. Obtaining of Agrobacterium engineering strain

[0229] 1A) The pGWB17 control empty vector and the plant expression vector pGWB17-PpnMYC2 containing PpnMYC2 gene constructed in Example 6 are respectively transformed into Agrobacterium tumefaciens GV3101 (purchased from Weidi Biotechnology Co., Ltd.) with pSoup helper plasmid by freeze-thaw method to obtain Agrobacterium GV3101 containing pGWB17 empty vector, and Agrobacterium GV3101 containing pGWB17-PpnMYC2 vector engineering bacteria, respectively;

[0230] 1B) Constructed plant bioluminescence reporter vectors pGreenII0800-ProEPF2, pGreenII0800-ProEPFL4, pGreenII0800-ProEPFL9 in Example 3, 4, 5, using freeze-thaw method into the Agrobacterium GV3101 with pSoup helper plasmid, respectively, to obtain containing reporter vector pGreenII0800-ProEPF2, containing reporter vector pGreenII0800-ProEPFL4, containing reporter vector pGreenII0800-ProEPFL9 Agrobacterium GV3101 engineering strains, wherein: GV3101 Agrobacterium transformation (freeze-thaw method) steps as follows:

[0231] First: take -80℃ stored in test tube Agrobacterium competence at room temperature, when it is partially thawed, in ice water mixture state, the test tube is inserted into the ice;

[0232] Next: 100 μl Agrobacterium competence to add 0.01-1 μg plasmid DNA (i.e. pGWB17 empty vector, pGWB17-PpnMYC2 vector, pGreenII0800-ProEPF2 vector, pGreenII0800-ProEPFL4 vector or pGreenII0800-ProEPFL9 plasmid, higher transformation efficiency, the first use before preferably do pre-experiment to determine the amount of plasmid added), dial the tube bottom, mix well, then on ice for 5 min, 5 min in liquid nitrogen, 37℃ water bath 5 min, ice bath 5 min;

[0233] Next: add 700 μL of LB medium without antibiotics (5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, add water to 1 L, 121℃ sterilization 15 min) or YEB liquid medium, 28℃ shaking culture 2-3 h.

[0234] Then: 6000 rpm centrifugation 1 min, discard part of the supernatant, take about 100 μL supernatant after centrifugation, blow gently, resuspend the precipitate, then spread on the LB or YEB plate containing the corresponding antibiotic, inverted in 28℃ incubator for 2-4 days, until the plate is full of colonies; wherein:

[0235] The LB or YEB plate medium containing the corresponding antibiotic is: LB or YEB plate medium containing 50 μg / ml Kan or containing 50 μg / ml Kan and 20 μg / ml Rif at the same time or containing 50 μg / ml Rif; when the plate only contains 50 μg / ml Kan, it can be cultured at 28°C for 48 h; when the plate contains 50 μg / ml Kan and 20 μg / ml Rif at the same time, it needs to be cultured at 28°C for 60 h; if the plate used contains 50 μg / ml Rif, it needs to be cultured at 28°C for 72-90 h; in this example, the bacterial block resuspension is coated on the LB plate medium containing 50 μg / ml Kan.

[0236] 1C, screening positive strains

[0237] The Agrobacterium single colony on the plate obtained in step 1B) is taken as a template, and colony PCR amplification detection is performed. The empty vector pGWB17 has a target band with a size of about 230 bp, the pGWB17-PpnMYC2 has a target band with a size of about 1500 bp, or the pGreenII0800-ProEPF2 vector and the pGreenII0800-ProEPFL4 vector and the pGreenII0800-ProEPFL9 vector have a target band with a size of about 2000 bp, that is, a positive strain. The PCR amplification procedure and system are as follows:

[0238] PCR amplification procedure: 94°C pre-denaturation for 4 min, then enter the cycle amplification stage: 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, cycle 30 times; 72°C for 5 min, end the reaction, and store the PCR product at 4°C.

[0239] PCR reaction system: 10 μL Taq enzyme, 8 μL ddH2O, 0.5 μL primer F / R, 1 μL single colony, total volume 20 μL.

[0240] Among them, the primers (pGWB17-F / R) for pGWB17 colony PCR are as follows:

[0241] pGWB17-F: GTCAGGCTCCCTTATACACAG (SEQ ID NO. 19)

[0242] pGWB17-R: TTGTTCACCGTTCAAGTCTTCC (SEQ ID NO. 20)

[0243] The target band is 230 bp, and if the band is correct, it indicates that the empty vector pGWB17 has been successfully transformed into Agrobacterium, and the single colony used as the PCR template is positive.

[0244] pGWB17-PpnMYC2-F: CACGGGGGACTCTAGATGGAAGAGATACTGTC CTCC (SEQ ID NO. 16)

[0245] pGWB17-PpnMYC2-R: TTTTGTTCACCGTTAGTTCTGCATTCTTTGAAA AAT (SEQ ID NO. 17)

[0246] pGWB17-PpnMYC2-R: TTTTGTTCACCGTTAGTTCTGCATTCTTTGAAA AAT (SEQ ID NO. 17)

[0247] The target band is about 1500bp, if the band is correct, it indicates that the pGWB17-PpnMYC2 vector is successfully transferred into Agrobacterium, and the single colony as the PCR template is positive.

[0248] pGreenII0800-ProEPF2-F: CGGTATCGATAAGCTATTGAGGTTTGGTAGAGACG (SEQ ID NO. 7),

[0249] pGreenII0800-ProEPF2-F: CGGTATCGATAAGCTATTGAGGTTTGGTAGAGACG (SEQ ID NO. 7),

[0250] pGreenII0800-ProEPF2-F: CGGTATCGATAAGCTATTGAGGTTTGGTAGAGACG (SEQ ID NO. 7),

[0251] The target band is about 2000bp, if the band is correct, it indicates that the pGreenII0800-ProEPF2 vector is successfully transferred into Agrobacterium, and the single colony as the template is positive.

[0252] pGreenII0800-ProEPFL4-F: CGGTATCGATAAGCTAACTTCAGATAATGGCATAGTACTC (SEQ ID NO. 10),

[0253] pGreenII0800-ProEPFL4-F: CGGTATCGATAAGCTAACTTCAGATAATGGCATAGTACTC (SEQ ID NO. 10),

[0254] pGreenII0800-ProEPFL4-F: CGGTATCGATAAGCTAACTTCAGATAATGGCATAGTACTC (SEQ ID NO. 10),

[0255] The target band is about 2000bp. If the band is correct, it indicates that the pGreenII0800-ProEPFL4 vector is successfully transferred into Agrobacterium, and the single colony used as the template is the positive bacteria.

[0256] The primers (pGreenII0800-ProEPFL9-F / R) for pGreenII0800-ProEPFL9 colony PCR are as follows:

[0257] EPFL9-F: CGGTATCGATAAGCTATTGTTTCTTGGTCCACAGTGC (SEQ ID NO. 13),

[0258] EPFL9-R: TTGGCGTCTTCCATGTTCTAATTCCCTTTGTATCAAGG (SEQ ID NO. 14).

[0259] The target band is about 2000bp. If the band is correct, it indicates that the pGreenII0800-ProEPFL9 vector is successfully transferred into Agrobacterium, and the single colony used as the template is the positive bacteria.

[0260] 2. Transient transformation of tobacco

[0261] 2A) The positive strains of each Agrobacterium engineering bacteria obtained by screening in step 1C above are inoculated in 10ml YEB liquid medium at a ratio of 1:100, respectively, and are expanded and cultured at 28°C overnight. After centrifugation at 4500rpm for 10min, the corresponding Agrobacterium positive bacteria are collected;

[0262] 2B) The bacteria are resuspended with MS liquid medium, and each bacterial solution is diluted to OD600 of 0.6 with MS liquid medium;

[0263] 2C) 200μmol / L of acetyl-syringone (AS) and 10mmol / L of buffer 2-morpholinoethanesulphonic acid (MES) (pH 5.7) are added to each bacterial solution at a final concentration, and the solution is incubated at room temperature for 3h. Five Agrobacterium engineering bacteria transformation solutions are obtained, i.e., Agrobacterium engineering bacteria containing pGWB17 empty vector, pGWB17-PpnMYC2 vector, report vector pGreenII0800-ProEPF2, report vector pGreenII0800-ProEPFL4, and report vector pGreenII0800-ProEPFL9, which are ready for use. AS promotes the entry of Agrobacterium into plants. MES is a biological buffer that regulates the pH in plants. In this case, the pH of the plants is adjusted.

[0264] 2D) The Agrobacterium engineering bacteria transformation liquid containing pGWB17-PpnMYC2 vector, the Agrobacterium engineering bacteria transformation liquid containing empty vector pGWB17 were mixed with the Agrobacterium engineering bacteria transformation liquid containing plant dual luciferase detection reporter vector pGreenII0800-ProEPF2 or pGreenII0800-ProEPFL4 or pGreenII0800-ProEPFL9 at a ratio of 1:1 to obtain mixed Agrobacterium engineering bacteria transformation liquid, and then the mixed transformation liquid was injected into the 4-5 week old N. benthamiana leaves by using a 1 mL needle-free syringe, wherein the mixed Agrobacterium engineering bacteria strains were as follows:

[0265] The Agrobacterium engineering bacteria transformation liquid containing pGWB17-PpnMYC2 was mixed with the Agrobacterium engineering bacteria transformation liquid containing pGreenII0800-ProEPF2 or pGreenII0800-ProEPFL4 or pGreenII0800-ProEPFL9 plant dual luciferase detection reporter vector at a ratio of 1:1.

[0266] The Agrobacterium engineering bacteria transformation liquid containing empty vector pGWB17 was mixed with the Agrobacterium engineering bacteria transformation liquid containing pGreenII0800-ProEPF2 or pGreenII0800-ProEPFL4 or pGreenII0800-ProEPFL9 plant dual luciferase detection reporter vector at a ratio of 1:1.

[0267] 3. Dual-Luciferase detection

[0268] After 3 days of injection of the mixed bacteria liquid, the leaves were collected and infiltrated with 150 μg / ml luciferin, and then the Night SHADE LB 985 system was used to detect luciferase activity, and the detection results were as follows: Figure 1A 、 2A 、3A.

[0269] After the leaves injected with the bacteria liquid were ground, the LUC and REN enzyme activities were detected by using the dual luciferase reporter gene detection kit (Beyotime, RG027), and the operation was carried out according to the kit instructions, wherein: 100 microliters of firefly luciferase detection reagent was added, mixed well, and then the RLU (relative light unit) was detected, and then 100 microliters of sea-horse luciferase detection working solution was added, mixed well, and then the RLU (relative light unit) was detected.

[0270] The RLU value obtained by the firefly luciferase assay is divided by the RLU value obtained by the sea renilla luciferase assay. The degree of activation of the target reporter gene in different samples is compared according to the obtained ratio. The ratio of LUC / REN is obtained, and the detection result is as follows Figure 1B 、 2B 、3B.

[0271] Figure 1A The luciferase activity detected by using the Night SHADE LB 985 system is shown. The fluorescence intensity of PpnMYC2+ProEPF2 is stronger than that of pGWB17+ProEPF2 on the left, indicating that PpnMYC2 has an activating effect on ProEPF2, promotes the expression thereof, and thus the fluorescence intensity is stronger. Figure 1B The ratio of LUC / REN determined by using the dual luciferase reporter gene detection kit is shown. If the ratio PpnMYC2+ProEPF2 is higher than that of pGWB17+ProEPF2, it indicates that PpnMYC2 has an activating effect on ProEPF2, promotes the expression thereof, and reduces the leaf stomatal density, otherwise it is an inhibitory effect. Here, it indicates that PpnMYC2 has an activating effect on ProEPF2.

[0272] Figure 2A The luciferase activity detected by using the Night SHADE LB 985 system is shown. The fluorescence intensity of PpnMYC2+ProEPFL4 is stronger than that of pGWB17+ProEPFL4 on the left, indicating that PpnMYC2 has an activating effect on ProEPFL4, promotes the expression thereof, and thus the fluorescence intensity is stronger. Figure 2B The ratio of LUC / REN determined by using the dual luciferase reporter gene detection kit is shown. If the ratio PpnMYC2+ProEPFL4 is higher than that of pGWB17+ProEPFL4, it indicates that PpnMYC2 has an activating effect on ProEPFL4, promotes the expression thereof, and reduces the leaf stomatal density, otherwise it is an inhibitory effect. Here, it indicates that PpnMYC2 has an activating effect on ProEPFL4.

[0273] Figure 3A The luciferase activity detected by using the Night SHADE LB 985 system is shown. The fluorescence intensity of PpnMYC2+ProEPFL9 is weaker than that of pGWB17+ProEPFL9 on the left, indicating that PpnMYC2 has an inhibitory effect on ProEPFL9, inhibits the expression thereof, and thus the fluorescence intensity is weaker. Figure 3BIf the ratio of LUC / REN measured by the dual-luciferase reporter assay reagent is lower in PpnMYC2+ProEPFL9 than in pGWB17+ProEPFL9, it indicates that PpnMYC2 has an inhibitory effect on ProEPFL9, inhibits the expression of ProEPFL9, and reduces the stomatal density of leaves. Otherwise, it indicates that PpnMYC2 has a promoting effect on ProEPFL9.

[0274] As shown in FIG. 1, PpnMYC2 significantly activates the activity of the EPF2 gene promoter, indicating that PpnMYC2 promotes the expression of EPF2. As shown in FIG. 2, PpnMYC2 significantly activates the activity of the EPFL4 gene promoter, indicating that PpnMYC2 promotes the expression of EPFL4. As shown in FIG. 3, PpnMYC2 significantly inhibits the activity of the EPFL9 gene promoter, indicating that PpnMYC2 inhibits the expression of EPFL9.

[0275] Example 8: Agrobacterium tumefaciens-mediated genetic transformation of poplar with a PpnMYC2 overexpression vector to obtain transgenic poplar plants

[0276] 1. Obtain Agrobacterium tumefaciens engineering bacteria containing the PpnMYC2 overexpression vector

[0277] The plant overexpression vector pBI121-PpnMYC2 containing the PpnMYC2 gene obtained in Example 2 was transformed into Agrobacterium tumefaciens GV3101 (purchased from the Unique Company) by freeze-thaw method, and colony PCR detection was performed using the primers (PpnMYC2-F, PpnMYC2-R) in Example 2. Positive colonies were obtained, which were Agrobacterium tumefaciens engineering bacteria containing the PpnMYC2 overexpression vector (i.e., Agrobacterium tumefaciens engineering bacteria containing the overexpression vector pBI121-PpnMYC2). The operation steps of the freeze-thaw method are described in step 1 of Example 7.

[0278] The plasmid is the overexpression vector pBI121-PpnMYC2 plasmid obtained in Example 2.

[0279] Positive screening detection: using Agrobacterium single colony as template, PCR amplification, and the band at about 1500 bp is positive.

[0280] The PCR reaction system and procedure are as follows: PCR amplification procedure: 94°C pre-denaturation for 4 min, then enter the cycle amplification stage: 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, cycle for 30 times; 72°C for 5 min for preservation, and the reaction is ended. The PCR product is stored at 4°C. The PCR reaction system: 10 μL Taq enzyme, 8 μL ddH2O, 0.5 μL primers F / R, 1 μL Agrobacterium single colony, and the total volume is 20 μL.

[0281] Positive results indicate that the PpnMYC2-containing plant overexpression vector has been successfully transformed into the Agrobacterium tumefaciens strain, and the Agrobacterium tumefaciens engineering bacteria containing the PpnMYC2 gene overexpression vector are obtained.

[0282] 2. Pre-culture of explants (i.e. differentiation culture)

[0283] The leaves of the 4-week-old Populus alba var. pyramidalis 84K tissue culture seedlings were cut off in the clean bench, and the main veins were cut vertically with scissors, and the main veins were cut off. The base of the leaf, the middle of the leaf and the tip of the leaf were cut to facilitate the entry of Agrobacterium into plant cells. Among them, the middle of the leaf is cut vertically to the vein and the main vein is cut off, but the leaf is not cut off. The middle of the leaf is cut along the main vein of the leaf, and the structure is basically axisymmetric;

[0284] Then the cut leaves were respectively laid in culture dishes (9 cm in diameter) containing solid differentiation medium for differentiation culture for 3 days (usually 2-4 days), and pretreated leaf explants were obtained, wherein: the differentiation medium is: MS basic medium + NAA 0.05 mg / L + 6-BA 0.5 mg / L + agar 6 g / L + sucrose 30 g / L; The culture conditions are: the culture temperature is 25±2℃, the illumination is 2000lx, and the light cycle is 16h light / 8h dark.

[0285] 3. Preparation of infection bacteria solution

[0286] 3A, the plant overexpression vector pBI121-PpnMYC2 is transformed into GV3101 Agrobacterium competent cells by freeze-thaw method; except that the plasmid added to the Agrobacterium competent cells is the overexpression vector pBI121-PpnMYC2, the rest is the same as the operation of the Agrobacterium freeze-thaw transformation method of Example 6;

[0287] 3B, single colony Agrobacterium on the plate is picked and used for colony PCR detection, using 35S on the expression vector (pBI121) as upstream primer F (CTATCCTTCGCAAGACCCTTC), and a sequence on the target gene PpnMYC2 as downstream primer R (TTAGTTCTGCATTCTTTGAAAAAT).

[0288] 3C, the single colony with positive band (band size about 1500bp) detected by colony PCR is positive single colony. Then the positive single colony is inoculated into 50ml (per bottle) YEB liquid medium (10g / L yeast extract, 10g / L peptone, 5g / L sodium chloride, add water to 1L, 121℃ sterilization for 15min) added with 50mg / L kanamycin and 25mg / L rifampicin, and liquid suspension culture is carried out, wherein the temperature of liquid suspension culture is 27-29℃, the rotation speed is 180-200rpm, and the culture is carried out until the bacterial liquid is uniform and the OD600 of bacterial liquid reaches 0.7 (usually 0.6-0.8), thereby obtaining GV3101 agrobacterium infection bacterial liquid containing plant overexpression vector pBI121-PpnMYC2.

[0289] 4. Infection treatment

[0290] The leaf explants pretreated (i.e. differentiation culture) for 3 days are soaked in the agrobacterium infection bacterial liquid containing plant overexpression vector pBI121-PpnMYC2 for 15min (usually 10-15min), then the leaves are taken out and the bacterial liquid on the surface of the leaves is absorbed with sterile filter paper, and then the leaf explants are respectively laid in Petri dishes (9cm in diameter) containing infection-co-culture medium, and the infection treatment is carried out under dark conditions to obtain the infection-treated explant leaves, wherein the infection-co-culture medium is MS basic medium+NAA 0.05mg / L+6-BA 0.5mg / L+agar 6g / L+sucrose 30g / L, and the infection-co-culture conditions are as follows: the co-culture temperature is 25±2℃, and the dark culture is carried out for 2 days (usually 2-3 days), thereby obtaining infection-in vitro leaves.

[0291] 5. Screening treatment of resistant shoots

[0292] The infection-in-vitro leaves after the infection treatment are respectively washed with distilled water containing cefotaxime for 25min (usually 20-30min), wherein the concentration of cefotaxime in the distilled water containing cefotaxime is 50mg / L (usually 40-55mg / L), then the leaves are respectively washed with distilled water for 4 times (usually 3-5 times) for 2min each time, and then the water is absorbed with sterile filter paper, and then the leaves are respectively laid in Petri dishes containing selective differentiation medium, and the screening treatment of resistant shoots is carried out to screen the resistant shoots, wherein the selective differentiation medium is MS basic medium+NAA 0.05mg / L+6-BA 0.5mg / L+Kan 30mg / L+Tim 200mg / L+agar 6g / L+sucrose 30g / L, and the culture conditions of the screening treatment of resistant shoots are as follows: the culture temperature is 25±2℃, the illumination is 2000lx, and the illumination cycle is 16h light / 8h dark, and the screening culture of resistant shoots is carried out for about 1 week, the wound of the leaf begins to deform, the leaf presents wavy, and the resistant shoots grow out after about 2 weeks.

[0293] 6. Rooting culture of resistant shoots

[0294] When the resistant shoots grown on the selection differentiation medium grow to 1-2 cm, they are cut off with sterile scissors and inoculated on a selection rooting medium, respectively, for rooting culture, wherein the selection rooting medium is: 1 / 2MS basic medium+NAA 0.02 mg / L+IBA 0.05 mg / L+Kan 30 mg / L+Tim 200 mg / L+agar 6 g / L+sucrose 30 g / L; the culture conditions for the resistant rooting culture are as follows: the culture temperature is 25±2℃, the illumination is 2000 lx, and the light cycle is 16 h light / 8 h dark. The rooting culture time is 2-4 weeks, and regenerated plants are obtained.

[0295] 7. PCR detection of transgenic poplar plants

[0296] According to the operation of the novel plant genomic DNA extraction kit (DP320-03, Tiangen Biochemical Technology (Beijing) Co., Ltd.), DNA detection is performed on the regenerated plants obtained by rooting culture and non-transformed wild-type plants, respectively.

[0297] 1-2 leaves of the regenerated plants and non-transformed wild-type plants obtained after antibiotic selection are ground with liquid nitrogen, and DNA extraction is performed using the novel plant genomic DNA extraction kit of Tiangen Biochemical Technology Co., Ltd. The collected DNA is stored at -20℃ for standby.

[0298] PCR amplification is performed using the extracted DNA as a template, 10 μL Taq enzyme, 8 μL ddH2O, 0.5 μL detection primer F / R, and 1 μL DNA are added to the PCR tube, and the total volume of 20 μL system is subjected to PCR detection, wherein:

[0299] According to the plant pBI121 vector sequence and the gene sequence of PpnMYC2, forward detection primer F (CTATCCTTCGCAAGACCCTTC, SEQ ID NO. 21) and reverse detection primer R (TTAGTTCTGCATTCTTTGAAAAAT, SEQ ID NO. 22) are designed for positive detection of overexpression plants and non-transformed wild-type plants.

[0300] PCR program: 94℃ pre-denaturation for 4 min, and then enter the cycle amplification stage: 94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, cycle for 30 times; 72℃ for 5 min for incubation, and then end the reaction, and the PCR product is stored at 4℃.

[0301] The PCR products were separated by electrophoresis in a 1.2% agarose gel at 120V for 20 min, and the band of the target gene (PpnMYC2 gene) was checked using a gel imaging instrument. After electrophoretic detection, a band with a length (about 1500 bp) consistent with the target gene was obtained, indicating that the plant was positive. The detection results are shown in Figure 2. Figure 4 .

[0302] As can be seen from Figure 4 , using the designed PCR specific detection primer, the positive plant can amplify a specific DNA fragment (1-10) in Figure 4 . When the non-transformed wild-type poplar (WT) genomic DNA is used as a template, no fragment is amplified.

[0303] In this example, the plant overexpression vector containing PpnMYC2 was transformed into Agrobacterium tumefaciens GV3101 to obtain an Agrobacterium tumefaciens strain containing the plant overexpression vector for transforming poplar. The constructed Agrobacterium tumefaciens strain was used to transform poplar, and transgenic poplar plants were obtained by PCR detection. The acquisition of transgenic poplar plants provides direct materials for screening poplar lines with lower stomatal density and higher water use efficiency.

[0304] Test Example 1: Observation of wild-type and transgenic poplar stomatal density by scanning electron microscope

[0305] The stomata of wild-type (WT) and transgenic poplar plants obtained in Example 8 were analyzed by scanning electron microscope.

[0306] The leaves of wild-type and transgenic poplar were fixed with 2.5% glutaraldehyde and then rinsed with 0.1M phosphate buffer PB (pH 7.4) for 3 times, 15 min each time. The rinsed leaves were transferred to 1% osmium tetroxide (OsO4) prepared in 0.1M phosphate buffer PB (pH 7.4) and fixed at room temperature for 1-2 hours. Then, the leaves were rinsed with 0.1M phosphate buffer PB (pH 7.4) for 3 times, 15 min each time. The cleaned leaf tissues were sequentially placed in 30%, 50%, 70%, 80%, 90%, 95%, 100%, and 100% concentration gradient alcohol for 15 min each time, and then immersed in tert-butyl alcohol for 30 min. The leaf samples soaked in tert-butyl alcohol were dried in a K850 critical point drying machine (Quorum Technologies Ltd., Lewes, UK), and then the samples were tightly attached to a conductive carbon film double-sided tape and placed on the sample stage of an ion sputtering instrument for gold spraying for about 30 s. The scanning electron microscope was used for observation and image capture. The stomatal density was determined by image. The stomatal density statistical results are shown in Figure 5.

[0307] From Figure 5AIt can be seen that the number of stomata per unit area of the PpnMYC2 overexpression plant (PpnMYC2-OE) obtained in Example 8 is significantly reduced, indicating that the PpnMYC2 transcription factor regulates stomatal density in poplar; wherein the PpnMYC2 overexpression plant line shows a significantly reduced stomatal density in Figure 5B Example 8, indicating that PpnMYC2 negatively regulates the stomatal density of poplar.

[0308] Test Example 2: Determination of water use efficiency of wild type and transgenic poplar

[0309] The net CO2 assimilation rate (A) and transpiration rate (Tr) of the overexpression poplar plant (PpnMYC2-OE) and wild type (WT) poplar grown for 6 weeks were determined under greenhouse conditions (16h light / d; temperature: 25℃; relative humidity: 40-45%) using a portable photosynthesis instrument (Li-Cor 6400; Lincoln, NE, USA), and the water use efficiency (WUE) (A / Tr) was calculated. The calculation results are shown in Figure 6 .

[0310] It can be seen from Figure 6 that the water use efficiency of the overexpression poplar (PpnMYC2-OE) is significantly higher than that of the wild type (WT) poplar. Overexpression of PpnMYC2 can significantly improve the water use efficiency of poplar.

[0311] The poplar bHLH transcription factor PpnMYC2 involved in the present application can reduce stomatal density and improve water use efficiency by activating the expression of EPF2 or EPFL4 and inhibiting the expression of EPFL9. The present application provides a transcription factor for regulating the stomatal density of plant leaves, and lays a solid foundation for creating plant germplasm with high water use efficiency using the transcription factor.

[0312] The above describes in detail the preferred embodiments of the present application. It should be understood that those skilled in the art can make many modifications and changes to the present application without creative labor based on the concept of the present application. Therefore, any technical solution obtained by logical analysis, reasoning or limited experiments by those skilled in the art based on the prior art according to the concept of the present application shall be within the protection scope defined by the claims.

Claims

1. Application of transcription factor MYC2 in reducing the stomatal density of poplar, wherein the transcription factor MYC2 is poplar PpnMYC2, and the sequence of the poplar PpnMYC2 is SEQ ID NO.

3. In the process of stomatal development of poplar, the transcription factor MYC2 activates the promoter activity of the poplar stomatal density inhibitor EPF2 and EPFL4, and inhibits the promoter activity of the poplar stomatal density promoter EPFL9, thereby regulating the stomatal density trait of poplar.

2. A method for obtaining a poplar tree with low stomatal density by overexpressing the transcription factor PpnMYC2, characterized in that, The method comprises the following steps: 1) Constructing a plant overexpression vector pBI121-PpnMYC2 containing the poplar PpnMYC2 gene, wherein the sequence of the PpnMYC2 gene is SEQ ID NO. 3; 2) Transferring the plant overexpression vector pBI121-PpnMYC2 containing the PpnMYC2 gene into Agrobacterium by freeze-thaw method to obtain Agrobacterium engineering bacteria containing the overexpression vector of the PpnMYC2 gene, inoculating the positive single colony into liquid suspension medium for liquid suspension culture to prepare Agrobacterium infection bacteria liquid containing the plant overexpression vector pBI121-PpnMYC2; 3) Transforming the infection bacteria liquid of step 2) into pre-cultured poplar explants for genetic transformation operation to obtain positive transgenic plants; 4) Observing the stomata of the poplar overexpressing PpnMYC2 and the wild-type poplar by scanning electron microscopy, and counting the stomatal density to obtain transgenic poplar plants with lower stomatal density; The transcription factor PpnMYC2 activates the promoter activity of the poplar stomatal density inhibitor EPF2 and EPFL4, and inhibits the promoter activity of the poplar stomatal density promoter EPFL9 in the process of stomatal development of poplar, thereby regulating the stomatal density trait of poplar.