Enterovirus infectious clone with HiBiT novel reporter gene and its construction method and application

Abstract

The present invention discloses an enterovirus infectious clone with a novel HiBiT reporter gene and a construction method and application thereof, including enterovirus EVA71, CVA16, CVA10 and CVA7 infectious clones with a novel HiBiT reporter gene, using HiBiT as a reporter gene for the first time on the basis of EVA71, CVA16, CVA7 and CVA10 infectious clones, preparing EVA71-HiBiT, CVA16-HiBiT, CVA7-HiBiT and CVA10-HiBiT infectious clones, further rescuing the reporter virus by the infectious clone, and verifying the biological activity and genetic stability of the reporter virus by cytopathic effect, plaque, WB and flow cytometry in vitro. The virus clone or reporter virus involved in the present invention has a wide range of application value in the field of anti-enterovirus drugs and high-throughput screening of neutralizing antibodies.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to infectious clones of enterovirus EVA71, CVA16, CVA10 and CVA7 with a novel HiBiT reporter gene, and construction methods and applications thereof. Background Art

[0002] Enterovirus belongs to the single-stranded positive-strand RNA virus family of the Picornaviridae family. The Enterovirus genus contains 1513 species, namely Enterovirus AI and Rhinovirus AC. Common serotypes include EnterovirusA71 (EVA71), Coxsackievirus A10 (CVA10), Human rhinovirus A1 (HRVA1), Poliovirus (PV), etc. The viral genome is about 7.5 kb long and consists of the 5' non-coding region (5'UTR), the coding region, and the 3' non-coding region (3'UTR). After the virus infects the cell, the genomic RNA is released into the cytoplasm for replication and translation. The viral genome contains a reading frame, which is first translated in the cytoplasm to form a polyprotein including structural and non-structural proteins. Subsequently, the virus-encoded proteases 2A and 3C cleave the polyprotein to form four mature structural proteins VP1, VP2, VP3 and VP4 and seven non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D. Hand, foot and mouth disease is a common infectious disease caused by a variety of enteroviruses, mainly affecting infants and young children. Common pathogens of hand, foot and mouth disease are EVA71 and CVA16, and severe cases and deaths are mostly caused by EVA71 infection. In recent years, the number of cases of hand, foot and mouth disease caused by CVA6 and CVA10 has increased, and the research on antiviral drugs or antibodies for hand, foot and mouth disease pathogens is particularly important.

[0003] Infectious clones have been widely used as a powerful tool for virus research. Through reverse genetics technology, scientists can easily construct the viral genome into a plasmid that is easy to amplify and store. At the same time, they can also perform a variety of directed modifications to the viral genome, such as gene deletion mutations, exogenous tag insertions, and reporter gene insertions. In addition, compared to the high mutation frequency of the virus, the mutation frequency of infectious clones is lower, thus avoiding mutations during viral passage. In summary, as a tool for virus research, infectious clones have a wide range of application value in many aspects such as viral pathogenicity, drug and neutralizing antibody screening.

[0004] Infectious clones with reporter genes are constructed by inserting exogenous reporter genes on the basis of viral infectious clones. Widely used reporter genes are generally divided into two categories: fluorescent proteins and luciferases. Fluorescent proteins include green fluorescent protein (GFP) and red fluorescent protein (mCherry); luciferases include firefly luciferase (Fluc), Renilla luciferase (Rluc), Gaussia luciferase (Gluc) and new luciferases (NanoLuc, Nluc). Currently published enterovirus infectious clones carrying reporter genes include EVA71 and CVA16 infectious clones carrying GFP. The CVA16 infectious clone carrying GFP lacks genetic stability studies on eGFP-CVA16 recombinant viruses, and reporter viruses that cannot be stably propagated are not suitable for high-throughput screening of antiviral drugs. In addition, there are no reports of CVA10 and CVA7 reporter viruses carrying GFP, indicating that GFP is not suitable for most enterovirus infectious clones. Although viruses carrying GFP can be traced by observing luminescence both in vivo and in vitro, it is difficult to quantitatively analyze viruses using fluorescent proteins, further limiting the application of viruses carrying reporter genes in virological research and drug screening. Studies have reported that the EVA71 infectious clone carrying Gluc, whose Gluc reporter gene simplifies the steps of virus quantitative analysis, but due to the large Gluc gene fragment, the stability of the virus carrying Gluc is poor. Therefore, finding a stable reporter gene that is suitable for most enterovirus infectious clones will provide an important tool for the development of drugs and antibodies related to hand, foot and mouth disease.

[0005] Nluc luciferase protein consists of two subunits, the large subunit LgBiT (17.6kDa) and the small subunit SmBiT, an 11-amino acid peptide (1.3kDa). Previous researchers optimized the small subunit SmBiT and named the peptide with a strong affinity to LgBiT HiBiT. HiBiT can be used as a tag protein to detect endogenous protein expression, monitor receptor changes, WB experiments and virus research. Since the HiBiT tag is small in size, has only 11 amino acids, and has little effect on the protein being studied, it is speculated that it is suitable for constructing enterovirus infectious clones with reporter genes. Summary of the invention

[0006] In order to overcome the above-mentioned defects of the prior art, the purpose of the present invention is to provide an enterovirus infectious clone with a new reporter gene HiBiT and a construction method thereof, and successfully rescue four reporter viruses EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT by using infectious cloning technology. In addition, the EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT infectious clones constructed in the present invention will also provide important tools and reference ideas for basic research and applied research on other similar enteroviruses.

[0007] The purpose of the present invention can be achieved by the following technical methods:

[0008] The first aspect of the present invention provides an enterovirus infectious clone with a HiBiT novel reporter gene, including enterovirus EVA71, CVA16, CVA10 and CVA7 infectious clones with a HiBiT novel reporter gene, namely EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT infectious clones; wherein:

[0009] The nucleic acid sequence of the HiBiT novel reporter gene is shown in SEQ ID NO.1;

[0010] The nucleotide sequences of the enterovirus EVA71, CVA16, CVA10 and CVA7 are shown in SEQ ID NO.2-5 respectively.

[0011] The second aspect of the present invention provides a method for constructing the enterovirus infectious clone with the HiBiT novel reporter gene, comprising: the EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT infectious clones are constructed based on EVA71, CVA16, CVA10 and CVA7 infectious clones, respectively, using seamless cloning technology; wherein:

[0012] The EVA71 infectious clone is introduced into the HiBiT sequence through the upstream and downstream primers as shown in SEQ ID NO.6 and SEQ ID NO.7;

[0013] The CVA16 infectious clone is introduced into the HiBiT sequence through the upstream and downstream primers as shown in SEQ ID NO.8 and SEQ ID NO.9;

[0014] The CVA10 infectious clone is introduced into the HiBiT sequence through the upstream and downstream primers as shown in SEQ ID NO.10 and SEQ ID NO.11;

[0015] The CVA7 infectious clone is introduced into the HiBiT sequence through the upstream and downstream primers as shown in SEQ ID NO.12 and SEQ ID NO.13.

[0016] Furthermore, the method also includes the steps of recovering the correct fragments from the gel and transferring them into the competent cells of Trans2-Blue Escherichia coli, shaking the cells, extracting the plasmids and then verifying by sequencing, and storing the correctly sequenced plasmids at -20°C.

[0017] The third aspect of the present invention provides a reporter virus, including reporter viruses EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT, which are obtained by rescuing viruses from infectious clones of EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT, respectively, and specifically include the following steps:

[0018] S1. Preparation of EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT infectious clones by seamless cloning;

[0019] S2, in vitro transcription of EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT to obtain mRNA;

[0020] RD cells were transfected with mRNA of S3, EVA71-HiBiT, CVA10-HiBiT, and CVA7-HiBiT, and Vero cells were transfected with mRNA of CVA16-HiBiT;

[0021] S4. Continue to passage the cell supernatant and observe the cell pathological changes;

[0022] S5. Plaque titration of reporter virus and parental virus and verification of growth characteristics;

[0023] S6. Verify the differences in growth characteristics between the reporter virus and the parental virus.

[0024] Furthermore, in step S1, based on the infectious clones of EVA71, CVA16, CVA10 and CVA7 preserved in the laboratory, seamless cloning technology was used. In the infectious clones, EVA71 introduced the HiBiT sequence through the upstream and downstream primers SEQ ID NO.6 and SEQ ID NO.7, CVA16 introduced the HiBiT sequence through the upstream and downstream primers SEQ ID NO.8 and SEQ ID NO.9, CVA10 introduced the HiBiT sequence through the upstream and downstream primers SEQ ID NO.10 and SEQ ID NO.11, and CVA7 introduced the HiBiT sequence through the upstream and downstream primers SEQ ID NO.12 and SEQ ID NO.13. After the correct fragments were recovered by gel, they were transferred into Trans2-Blue Escherichia coli competent cells, the bacteria were shaken, and the plasmids were extracted and sequenced for verification. The plasmids with correct sequencing were stored at -20°C.

[0025] Further, in step S2, a template for in vitro transcription is prepared by PCR primers, EVA71-HiBiT upstream and downstream PCR primers SEQ ID NO.14 and SEQ ID NO.15, CVA16-HiBiT upstream and downstream PCR primers SEQ ID NO.16 and SEQ ID NO.17, CVA10-HiBiT upstream and downstream PCR primers SEQ ID NO.18 and SEQ ID NO.19, CVA7-HiBiT upstream and downstream PCR primers SEQ ID NO.20 and SEQ ID NO.21, and an in vitro transcription kit is used to synthesize mRNA, and the mRNA with correct quality control is packaged and stored at -80°C.

[0026] Furthermore, in step S3, the mRNA transcribed in step S2 is transferred into the cells in the 6-well plate, and the cell pathological changes are observed day by day.

[0027] Furthermore, in step S6, after the virus supernatant collected in step S4 is infected with cells, the biological activity of the reporter virus is verified by plaque, 2C antibody detection of the translation level of viral protein, and dsRNA antibody detection of the efficiency of virus infection of cells and compared with the parental virus.

[0028] Virus rescue: refers to cloning the full-length cDNA of the virus into a plasmid vector and rescuing the virulent virus in vitro through reverse genetics methods.

[0029] The exogenous reporter gene in the virus is easily lost after continuous passage, and this genetic instability will negatively affect the application of the reporter virus. The above-mentioned four reporter viruses EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT of the present invention were continuously passaged in cells until P10, and the fluorescence expression of different generations of viruses after infecting cells was detected to determine the genetic stability of the reporter virus.

[0030] The fourth aspect of the present invention provides the use of the aforementioned enterovirus EVA71, CVA16, CVA10 and CVA7 infectious clones or reporter viruses carrying the HiBiT novel reporter gene in high-throughput screening of anti-enterovirus drugs or neutralizing antibodies.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] 1. Enterovirus is a small RNA virus with a viral genome length of about 7.5 kb. The preparation of enterovirus infectious clones with reporter genes is often limited by their small capacity to accommodate foreign genes. HiBiT is a small subunit of the NanoLuc gene, containing only 11 amino acids, and can be used as an independent luciferase tag protein. The present invention proposes a method for constructing enterovirus infectious clones with a novel HiBiT reporter gene, and successfully constructs infectious clones including EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT with the novel HiBiT reporter gene.

[0033] 2. In the infectious clone of the present invention, a poly(A)25 tail is contained after 3'UTR and a T7 RNA polymerase promoter sequence and a hammerhead ribozyme (Hhrib) sequence are contained before 5'UTR. Using the T7 RNA polymerase promoter, mRNA can be obtained in vitro; the hammerhead ribozyme improves the replication ability of viral RNA.

[0034] 3. The enterovirus infectious clone with the novel HiBiT reporter gene constructed by the present invention inserts the HiBiT sequence behind the first amino acid (start codon) of the viral VP4, adds a sequence of synonymous mutations of the second to fourth amino acids of VP4 at the 5' end of the HiBiT sequence, and adds a 2A protease recognition site (AITTL) at the 3' end of the HiBiT sequence.

[0035] 4. After the mRNA obtained by in vitro transcription in the present invention is transfected into cells, the mRNA is efficiently replicated in the cells and can be correctly assembled into mature virus particles.

[0036] 5. The enterovirus infectious clone with the new HiBiT reporter gene constructed by combining cytopathic test, plaque test, WB and flow cytometry verification can produce infectious EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT virus particles. It also proves that the EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT viruses rescued by reverse genetics have similar growth characteristics and other biological characteristics to the parental viruses, providing a powerful tool for the study of the related mechanisms and applied research of EVA71, CVA16, CVA10 and CVA7 viruses.

[0037] 6. The present invention combines luciferase detection experiments to prove that the EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT viruses rescued by the enterovirus infectious clone with the HiBiT novel reporter gene constructed in the present invention can be continuously and stably propagated for more than 10 generations in in vitro cell culture without losing the HiBiT exogenous gene. The EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT viruses rescued by the present invention greatly improve the stability of the virus. The stable reporter virus is an important basis for the study of viral mechanism and the screening of antiviral drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a schematic diagram of the construction of an enterovirus infectious clone carrying the HiBiT novel reporter gene in the example.

[0039] Figure 2 These are graphs showing cell pathological changes caused by infection with the reporter viruses EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT, CVA7-HiBiT and the parental viruses EVA71, CVA16, CVA10, and CVA7 in the examples.

[0040] Figure 3 These are plaque images of the reporter viruses EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT, CVA7-HiBiT and the parental viruses EVA71, CVA16, CVA10, and CVA7 in the examples.

[0041] Figure 4 These are WB images of cells infected with the reporter viruses EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT, CVA7-HiBiT and the parental viruses EVA71, CVA16, CVA10, and CVA7 in the examples.

[0042] Figure 5 The flow cytometry results after cells were infected with the reporting viruses EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT, CVA7-HiBiT and the parental viruses EVA71, CVA16, CVA10, and CVA7 in the examples.

[0043] Figure 6 The results of genetic stability of the viruses EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT, and CVA7-HiBiT in cells reported in the examples, wherein: A is the fluorescence value of cells infected with different generations of EVA71-HiBiT virus; B is the fluorescence value of cells infected with different generations of CVA16-HiBiT virus; C is the fluorescence value of cells infected with different generations of CVA10-HiBiT virus; D is the fluorescence value of cells infected with different generations of CVA7-HiBiT virus. DETAILED DESCRIPTION

[0044] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0045] In the following examples, the nucleotide sequences are as follows:

[0046] The nucleotide sequence of the HiBiT tag gene is shown in SEQ ID NO.1:

[0047] GTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGC

[0048] The nucleotide sequence of the EVA71 virus is shown in SEQ ID NO.2:

[0049]

[0050] The nucleotide sequence of the CVA16 virus is shown in SEQ ID NO.3:

[0051]

[0052] The nucleotide sequence of the CVA10 virus is shown in SEQ ID NO.4:

[0053]

[0054] The nucleotide sequence of the CVA7 virus is shown in SEQ ID NO.5:

[0055]

[0056] The experimental methods in this embodiment are conventional methods in the art unless otherwise specified. The present invention is described in detail below through several specific embodiments, but is not limited to the following embodiments.

[0057] Example 1

[0058] A method for constructing an enterovirus infectious clone with a novel HiBiT reporter gene and rescuing the virus comprises the following steps:

[0059] 1. Preparation of an enterovirus infectious clone with a new HiBiT reporter gene: Using the infectious clones of EVA71, CVA16, CVA10 and CVA7 as templates, the HiBiT sequence was introduced during PCR amplification. The amplified fragments were subjected to 0.7% (w / v) agarose gel electrophoresis. According to the DNA Marker band, the amplified product of the correct size was cut and the cDNA fragment was recovered and purified using the Tiangen enhanced gel recovery kit. The purified cDNA products were transferred into Trans2-Blue competent Escherichia coli, and the single clones were picked and preliminarily identified by PCR. The correct clones were expanded and shaken, and the plasmids were extracted and sequenced for verification. The correctly sequenced plasmids were stored at -20°C ( Figure 1 ).

[0060] The upstream amplification primer of EVA71 has a sequence as shown in SEQ ID NO.6: 5'-GCGGCTGTTCAAGAAGATTAGCGCCATTACTACCCTTGGTTCGCAAGTGTCTACACA-3'

[0061] The downstream amplification primer of EVA71, the sequence is shown in SEQ ID NO.7:

[0062] 5'-CTTCTTGAACAGCCGCCAGCCGCTCACCTGGGATCCCATGTTTAGCTGTGTTA AGGGT-3'

[0063] The upstream amplification primer of CVA16, the sequence is shown in SEQ ID NO.8:

[0064] 5'-GCGGCTGTTCAAGAAGATTAGCGCCATTACTACCCTTGGGTCACAAGTCTCCA CCC-3'

[0065] The downstream amplification primer of CVA16 has a sequence as shown in SEQ ID NO.9:

[0066] 5'-CTTCTTGAACAGCCGCCAGCCGCTCACCTGGGATCCcatTTCTTACAGTTGAGG AGC-3'

[0067] The upstream amplification primer of CVA10 has a sequence as shown in SEQ ID NO.10:

[0068] 5'-CTGGCGGCTGTTCAAGAAGATTAGCGCCATTACTACCCTTGGAGCACAAGTTT CATCTCAGAG-3'

[0069] The downstream amplification primer of CVA10 has a sequence as shown in SEQ ID NO.11:

[0070] 5'-TTGAACAGCCGCCAGCCGCTCACCACCTGAGCACCCATCTTCTGATATTTAACA CCAAGATG-3'

[0071] The upstream amplification primer of CVA7, the sequence is shown in SEQ ID NO.12:

[0072] 5'-CGGCTGTTCAAGAAGATTAGCGCCATTACTACCCTTGGCGCTCAAATATCAACA CAA-3'

[0073] The downstream amplification primer of CVA7, the sequence is shown in SEQ ID NO.13:

[0074] 5'-TCTTTCTGAACAGCCGCCAGCCGCTCACCTGTGCTCCCATTTTGCTTTGTCCA AACTCAG-3'

[0075] The PCR reaction system was: TransStart FastPfu DNA Polymerase: 1 μL, 5×TransStartFastPfu Buffer: 10 μL, 2.5 mM dNTPs: 5 μL, primers (F+R): 2 μL, DNA template: 1 μL, ddH2O: 31 μL;

[0076] Amplification conditions were as follows: 95°C, 2 min, 1 cycle; 95°C, 20 sec; 55°C, 20 sec; 72°C, 1 min, 35 cycles; 72°C 5 min.

[0077] 2. In vitro transcription: PCR amplified the full length of EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT to prepare the in vitro transcription DNA template. After gel recovery, proteinase K treatment and DNA product purification, the PCR product was subjected to T7 in vitro transcription using the Nearshore T7 High Yield RNA Transcription Kit to obtain mRNA. After the mRNA was purified by LiCl precipitation, the mRNA quality was detected by agarose gel electrophoresis. After the bands were correct, the mRNA was aliquoted and stored at -80°C; wherein:

[0078] The upstream full-length amplification primer of EVA71-HiBiT has a sequence as shown in SEQ ID NO.14: 5'-GGGGATCAATTCTCTAGAGCGGC-3'

[0079] The downstream full-length amplification primer of EVA71-HiBiT has a sequence as shown in SEQ ID NO.15: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTGCTATTCTGGTTATAACAAATTTACCCCCA-3'

[0080] The upstream full-length amplification primer of CVA16-HiBiT, the sequence is shown in SEQ ID NO.16: 5'-GAGGCCCTTTCGTCTTCAAGAATTG-3'

[0081] The downstream full-length amplification primer of CVA16-HiBiT, the sequence is shown in SEQ ID NO.17: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTCTGCTATTCTGGTTATAACAAATTTACCCCC-3'

[0082] The upstream full-length amplification primer of CVA10-HiBiT has a sequence as shown in SEQ ID NO.18: 5'-GACGAGTTCTTCTGAGGGGATCA

[0083] The downstream full-length amplification primer of CVA10-HiBiT, the sequence is shown in SEQ ID NO.19: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTGCTATTCTGGTTATAACAAATTTACCCCCAC-3'

[0084] The upstream full-length amplification primer of CVA7-HiBiT, the sequence is shown in SEQ ID NO.20: 5'-GGGTGAGCAAAAACAGGAAGGC-3'

[0085] The downstream full-length amplification primer of CVA7-HiBiT, the sequence is shown in SEQ ID NO.21: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTGCTATTCTGGTTATAACAAATTTACCCCCACC-3'

[0086] T7 in vitro transcription reaction system: Template: 8μL, A: 1.5μL, G: 1.5μL, C: 1.5μL, U: 1.5μL, Buffer: 2μL, T7 Enzyme: 1μL; RNase-free ddH2O: 3μL, 37℃, 2h.

[0087] 3. Virus rescue: Digest RD and Vero cells with good growth status and plate 5×10 5 After culturing overnight at 37°C, RD cells were transfected with the mRNA of EVA71-HiBiT, CVA10-HiBiT and CVA7-HiBiT using Lipo3000 transfection reagent, and Vero cells were transfected with the mRNA of CVA16-HiBiT. The cells transfected with mRNA continued to be cultured and the cytopathic effect was observed. When more than 80% of the cells showed cytopathic effect, they were frozen and thawed twice at -80°C, and the viral supernatant was collected by centrifugation at 4000g and stored at -80°C.

[0088] Example 2

[0089] EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT have similar cytopathic ability as the parental virus, and the steps are:

[0090] RD and Vero cells with good growth status were digested and 5×10 cells were plated in each well of a 6-well plate. 5 After overnight culture at 37°C, the cell supernatant was replaced with DMEM medium containing 2% FBS. EVA71-HiBiT, CVA10-HiBiT and CVA7-HiBiT viruses were infected with RD cells at MOI=1, and CVA16-HiBiT virus was infected with Vero cells at MOI=1. At the same time, positive control wells infected with EVA71, CVA16, CVA10 and CVA7 parental viruses and blank groups of uninfected groups were set up. Continue to culture at 37°C. When the cells showed obvious CPE, take pictures with an inverted microscope ( Figure 2 ).

[0091] Example 3

[0092] EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT, and CVA7-HiBiT had plaque sizes similar to those of the parental virus, and the steps were:

[0093] 1. Virus gradient dilution: Take 300 μL of virus stock solution and add it to a 1.5 mL EP tube. Use DMEM medium containing 2% FBS to dilute the parent virus and reporter virus by 10 times. -1 Up to 10 -8 Dilute and set aside;

[0094] 2. Infect cells with gradient diluted virus solution: Digest RD and Vero cells with good growth status and plate 3×10 5 After culturing overnight at 37°C, discard the cell culture supernatant, wash twice with sterile PBS, add 300 μL of gradient diluted virus solution, make three replicates for each gradient, and set up an uninfected blank group at the same time. Infect at 37°C for 2 hours, and shake every 15 minutes to promote virus infection.

[0095] 3. Avicel overlay culture and fixation staining: discard the virus infection supernatant, wash twice with sterile PBS, add 1mL of Avicel and 2×4% DMEM 1:1 mixture from Aminos, cover the cells, and culture in a 37°C incubator. The plaques of EVA71, CVA10 and CVA7 appear in 2 days, and the plaques of CVA16 appear in 3 days. The plaques of the reporter virus and the parent virus appear in the same time. After the empty plaques are formed, discard the overlay, fix the cells with 4% paraformaldehyde for 2 hours, then discard the paraformaldehyde and add crystal violet for staining for 2 hours. After the staining is completed, rinse the crystal violet with running water, and take pictures after the culture plate is dry ( Figure 3 ).

[0096] Example 4

[0097] EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT, and CVA7-HiBiT had similar protein expression levels as the parental virus, and the steps were:

[0098] 1. Virus infection of cells: Digest RD and Vero cells with good growth status and plate 3×10 cells per well in a 12-well plate. 5After overnight culture at 37°C, discard the cell culture supernatant and replace it with DMEM medium containing 2% FBS. EVA71-HiBiT, CVA10-HiBiT and CVA7-HiBiT viruses were infected with RD cells at MOI=0.1, and CVA16-HiBiT virus was infected with Vero cells at MOI=0.1. At the same time, positive control wells infected with EVA71, CVA16, CVA10 and CVA7 parental viruses and blank wells of uninfected groups were set up. Continue to culture at 37°C for 24.

[0099] 2. Prepare protein loading solution: discard the supernatant, wash once with PBS, add 300μL trypsin to each well, and place in a 37℃ incubator to digest the cells. After terminating the digestion with complete medium, centrifuge at 1000g for 5min, discard the supernatant, and collect the cell pellet. Dilute 5×SDS Loading buffer to 1× with ddH2O, and add 100μL 1×SDS Loading buffer to the cell pellet. Boil the sample at 100℃ for 10min to denature the protein. Centrifuge and collect the liquid on the tube wall. The prepared protein sample can be directly run on the gel or stored at -20℃ for a short time.

[0100] 3. SDS-PAGE electrophoresis and antibody incubation: Prepare 12% SDS-PAGE gel. Prepare the lower gel first and flatten it with ddH2O. After 30 minutes, prepare the upper gel and insert a 15-hole comb. Use ddH2O to dilute 10×Runningbuffer 10 times to prepare the Running buffer working solution, and add the prepared working solution to the electrophoresis tank. Load 15μL / well, and add an equal volume of three-color pre-stained protein markers. Add 1×SDS Loading buffer to the extra wells. Perform constant voltage electrophoresis at 80V for 30 minutes, then use constant voltage electrophoresis at 110V until bromophenol blue reaches the bottom of the gel, and end the electrophoresis. Prepare 1L of fast transfer working solution and add it to the electrophoresis tank. Cut 5cm×8cm NC membrane for use. Prepare the transfer "sandwich" in the order of "black side, sponge, filter paper, gel, NC membrane, filter paper, sponge, white side". All components were moistened with transfer working solution, and bubbles between layers were removed. The "sandwich" was placed in the electrophoresis tank, and the cross-flow electrophoresis was performed at 400 mA for 30 minutes. A 5% milk blocking solution was prepared with PBS solution, and the blocking was performed at room temperature for 1 hour, and the shaking speed was set to 15 r / min. A 3% milk primary antibody diluent was prepared with PBST solution containing 0.5% Tween, and the 2C antibody prepared in the author's laboratory was diluted 1:1000, and the housekeeping gene β-tubulin antibody was diluted 1:1000. After adding the primary antibody, incubate at 4°C overnight, and the shaking speed was set to 15 r / min. Incubate the secondary antibody. After the primary antibody incubation, wash 3 times with PBST, 5 minutes each time, and the shaking speed was set to 70 r / min. The HRP Goat-anti-Mouse IgG secondary antibody was diluted 1:10000 with PBST solution, added with the secondary antibody, and incubated at room temperature for 1 hour, and the shaking speed was set to 15 r / min. After the secondary antibody incubation, wash with PBST three times, 5 minutes each time, and set the shaking speed to 70r / min. After washing, prepare high-sensitivity ECL chemiluminescent solution, use dual infrared quantitative analyzer to expose and analyze the experimental results, and the membrane can also be temporarily stored in a 4℃ refrigerator ( Figure 4 ).

[0101] Example 5

[0102] EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT, and CVA7-HiBiT had similar levels of viral replication as the parental virus, the steps being:

[0103] 1. Virus infection of cells: Digest RD and Vero cells with good growth status and plate 3×10 cells per well in a 12-well plate. 5After overnight culture at 37°C, discard the cell culture supernatant and replace the cell supernatant with DMEM medium containing 2% FBS. EVA71-HiBiT, CVA10-HiBiT and CVA7-HiBiT viruses were infected with RD cells at MOI=0.1, and CVA16-HiBiT virus was infected with Vero cells at MOI=0.1. At the same time, positive control wells infected with EVA71, CVA16, CVA10 and CVA7 parental viruses and blank groups of uninfected groups were set up. Culture was continued at 37°C for 18h.

[0104] 2. Collect cells and perform flow cytometry analysis: After trypsin digestion of cells, use complete medium to terminate digestion and transfer to EP tubes, centrifuge at 500g for 5 minutes; discard the supernatant, add 100μL / tube of Fixation / Permeabilization solution, incubate at 4℃ for 20 minutes; dilute 10×BD Perm / Wash with ddH2O TM Buffer to 1×, use 250 μL 1× BD Perm / Wash TM Wash twice with buffer, centrifuge at 1000 g for 5 min; 1× BD Perm / Wash TM Buffer dilute dsRNA antibody, 50 μL / tube, incubate at 4℃ in dark for 30 min; use 250 μL 1×BD Perm / Wash TM Wash twice with buffer, centrifuge at 500g for 10 min; Donkey anti-Mouse IgG (H+L) Secondary Antibody, DyLight TM 488 1:500 dilution, 50 μL / tube, incubate at 4°C in the dark for 30 min; use 250 μL 1× BD Perm / Wash TM Wash twice with buffer, centrifuge at 500 g for 10 min; 300 μL BD Perm / Wash TM Resuspend the cells in buffer, filter and analyze on the machine ( Figure 5 ).

[0105] Example 6

[0106] EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT are genetically stable, and the steps are:

[0107] 1. Continuous virus passage: The virus was repeatedly frozen and thawed at -80℃ twice, and the virus supernatant was collected by centrifugation at 4000g as the P0 generation. Half of the volume of the P0 generation virus solution was taken to continue infecting cells. When the cell lesion rate exceeded 80%, the virus solution was collected as the P1 generation virus. The same steps were continued to pass to the P10 generation. The harvested virus solution was stored at -80℃.

[0108] 2. Luciferase activity was measured after different generations of viruses infected cells: 2.5×10 4 Vero and RD cells were inoculated into 96-well plates and cultured overnight at 37°C. The cell culture supernatant was discarded and replaced with DMEM medium containing 2% FBS. After the cells were infected with different generations of reporter viruses for 24 hours, 20 μL of Promega Nano Glo HiBiT LyticDetection substrate was added to each well and incubated at room temperature for 5 minutes to detect the fluorescence value. The stability of the virus was reflected by comparing the fluorescence values ​​generated by different generations of virus infection cells ( Figure 6 ).

[0109] The above is only a preferred embodiment of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the method of the present invention. These improvements and supplements should also be regarded as the scope of protection of the present invention.

Claims

1. An enterovirus infectious clone with a novel HiBiT reporter gene, comprising: Enterovirus EVA71, CVA16, CVA10 and CVA7 infectious clones with HiBiT novel reporter gene, namely EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT infectious clones; among which: The nucleic acid sequence of the HiBiT novel reporter gene is shown in SEQ ID NO.1; The nucleotide sequences of the enterovirus EVA71, CVA16, CVA10 and CVA7 are shown in SEQ ID NOs. 2-5 respectively; The method for constructing the enterovirus infectious clone with the HiBiT novel reporter gene comprises: 1) Add T7 RNA polymerase promoter sequence and hammerhead ribozyme sequence before 5'UTR and add poly(A)25 tail after 3'UTR. Use T7 RNA polymerase promoter to obtain mRNA in vitro. Hammerhead ribozyme improves the replication ability of viral RNA. 2) Insert the HiBiT sequence after the first amino acid of viral VP4, add synonymous mutation sequences of the second to fourth amino acids of VP4 at the 5' end of the HiBiT sequence, and add a 2A protease recognition site at the 3' end of the HiBiT sequence; The EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT infectious clones are constructed based on EVA71, CVA16, CVA10 and CVA7 infectious clones respectively, using seamless cloning technology; wherein: The EVA71 infectious clone is introduced into the HiBiT sequence through upstream and downstream primers with sequences as shown in SEQ ID NO.6 and SEQ ID NO.7; The CVA16 infectious clone was introduced with HiBiT sequence through upstream and downstream primers with sequences as shown in SEQ ID NO.8 and SEQ ID NO.9; The CVA10 infectious clone is introduced with HiBiT sequence through upstream and downstream primers as shown in SEQ ID NO.10 and SEQ ID NO.11; The CVA7 infectious clone is introduced with HiBiT sequence through upstream and downstream primers with sequences as shown in SEQ ID NO.12 and SEQ ID NO.13; The steps also include recovering the correct fragments from the gel and transferring them into Trans2-Blue competent E. coli, shaking the bacteria, extracting the plasmid and then sequencing to verify it, and storing the correctly sequenced plasmid at -20°C.

2. A reporter virus, comprising reporter viruses EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT, which are obtained by rescuing the infectious clones of EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT according to claim 1; The method for constructing the reporter virus comprises the following steps: S1, preparation of EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT infectious clones by seamless cloning; S2, in vitro transcription of EVA71-HiBiT, CVA16-HiBiT, CVA10-HiBiT and CVA7-HiBiT to obtain mRNA; RD cells were transfected with mRNAs of S3, EVA71-HiBiT, CVA10-HiBiT, and CVA7-HiBiT, and Vero cells were transfected with mRNAs of CVA16-HiBiT; S4. Continue to passage the cell supernatant and observe the cell pathological changes; S5. Plaque titration of reporter virus and parental virus and verification of growth characteristics; S6. Verify the differences in growth characteristics between the reporter virus and the parental virus; In step S1, based on the infectious clones of EVA71, CVA16, CVA10 and CVA7, the EVA71 infectious clone is introduced with the HiBiT sequence by upstream and downstream primers as shown in SEQ ID NO.6 and SEQ ID NO.7; the CVA16 infectious clone is introduced with the HiBiT sequence by upstream and downstream primers as shown in SEQ ID NO.8 and SEQ ID NO.9; the CVA10 infectious clone is introduced with the HiBiT sequence by upstream and downstream primers as shown in SEQ ID NO.10 and SEQ ID NO.11; the CVA7 infectious clone is introduced with the HiBiT sequence by upstream and downstream primers as shown in SEQ ID NO.12 and SEQ ID NO.13, the correct fragments are recovered by gel and transferred into Trans2-Blue Escherichia coli competent cells, the bacteria are shaken, and the plasmids are extracted and sequenced for verification, and the plasmids with correct sequencing are stored at -20°C; In step S2, a template for in vitro transcription is prepared by PCR primers, the sequences of the upstream and downstream PCR primers of EVA71-HiBiT are shown in SEQ ID NO.14 and SEQ ID NO.15, the sequences of the upstream and downstream PCR primers of CVA16-HiBiT are shown in SEQ ID NO.16 and SEQ ID NO.17, the sequences of the upstream and downstream PCR primers of CVA10-HiBiT are shown in SEQ ID NO.18 and SEQ ID NO.19, and the sequences of the upstream and downstream PCR primers of CVA7-HiBiT are shown in SEQ ID NO.20 and SEQ ID NO.21, and an in vitro transcription kit is used to synthesize mRNA, and the mRNA with correct quality control is stored at -80°C after aliquoting; In step S3, the mRNA transcribed in step S2 is transferred into cells in a 6-well plate, and the cell pathological changes are observed day by day; In step S6, after the virus supernatant collected in step S4 infects the cells, the biological activity of the reporter virus is verified by detecting the translation level of viral proteins by plaques and 2C antibodies, and the efficiency of virus infection of cells by dsRNA antibodies, and compared with the parental virus.

3. Use of the enterovirus infectious clone carrying the HiBiT novel reporter gene according to claim 1 or the reporter virus according to claim 2 in the preparation of anti-enterovirus drugs.

Images