An ochratoxin a electrochemical sensor based on a primer exchange reaction driven release of agncs by dnazyme
By combining primer exchange reaction and DNAzyme cleavage reaction with an electrochemical sensor of silver nanoclusters, the problems of complexity and insufficient sensitivity of existing detection methods are solved, and rapid, sensitive and low-cost detection of ochratoxin A is achieved.
Patent Information
- Application Number
- CN202310197995.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-03
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2043-03-03
AI Technical Summary
Existing methods for detecting ochratoxin A (OTA) have drawbacks such as cumbersome procedures, expensive instruments, and complex equipment, making them unsuitable for rapid on-site detection, and they also lack sufficient sensitivity and specificity.
An electrochemical biosensor based on the specific recognition of OTA and its aptamers, primer exchange reaction, and DNAzyme cleavage reaction is used. The primer exchange reaction and the catalytic cleavage reaction of DNAzyme are combined with silver nanoclusters (AgNCs) for electrochemical signal amplification to achieve rapid and sensitive detection of OTA.
It enables rapid, simple, and sensitive quantitative detection of OTA, with mild reaction conditions, low operational complexity, and is suitable for detection in food and the environment. It also has low preparation cost, stable performance, and is suitable for industrialization.
Smart Images

Figure CN116223587B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biosensors, and relates to an electrochemical sensor for detecting ochratoxin A by releasing AgNCs through a primer exchange reaction driven DNAzyme. BACKGROUND
[0002] Ochratoxin is a kind of fungal secondary metabolite, which is a typical biological toxin. Ochratoxin A (OTA) is highly toxic, widely contaminated, difficult to degrade and remove, and can invade the liver and kidney of the human body and cause cancer and liver and kidney poisoning in most mammals. OTA is widely produced in the processes of food and feed processing and storage and transportation, and a small amount of OTA also exists in water bodies. The International Cancer Research Agency lists ochratoxin A as a potential human carcinogen. The standard limit of OTA in beans, cereals and their products in China is 5 μg / kg, and the standard limit of OTA in wine (grape wine) is 2 μg / kg.
[0003] At present, there are many methods for detecting OTA, such as optical analysis method, electrophoresis method, chromatography method and the like. However, these analysis methods have the defects of complicated procedures, expensive instruments and complex equipment, and are not suitable for on-site detection. Therefore, it is necessary to develop a rapid, trace, high-sensitivity and selective analysis method for detecting OTA. SUMMARY
[0004] In order to realize more sensitive and specific detection of ochratoxin A (OTA), the application proposes an electrochemical biosensor based on specific recognition of OTA and its aptamer, primer exchange reaction and DNAzyme cleavage reaction, which has the advantages of fast detection speed, high sensitivity and high specificity, can make up for the defects and deficiencies of the existing detection methods of OTA, and realizes convenient and accurate quantitative detection of OTA.
[0005] To achieve the above purpose, the application adopts the following technical solutions.
[0006] An ochratoxin A electrochemical sensor comprises:
[0007] A-P probe, gold electrode modified with capture DNA (cDNA), AgNCs modified with hairpin H (H-AgNCs), hairpin H1, hairpin H2, KF DNA polymerase, mixed solution of deoxynucleotides dATP, dCTP and dGTP (dHTPs), Mg 2+ , H2O2;
[0008] The A-P probe is obtained by hybridization of an aptamer Apt and a primer P;
[0009] The nucleotide sequences of the aptamer Apt, primer P, capture DNA, hairpin H, hairpin H1 and hairpin H2 are shown in SEQ ID NO: 1-6.
[0010] The 3' end of the capture DNA is modified with -SH.
[0011] The 3' ends of the hairpin H1 and the hairpin H2 are both modified with reverse dT.
[0012] The preparation method of the gold electrode modified with the capture DNA (cDNA) comprises the following steps:
[0013] The solution of the capture DNA is dropped onto the gold electrode and incubated at 37℃, and then washed with PBS buffer and water in sequence; the gold electrode is immersed in 6-mercapto-1-hexanol (MCH) and stored at 0-4℃.
[0014] The preparation method of the AgNCs modified with the hairpin H comprises the following steps: mixing the solution of the hairpin H and the AgNO3 solution in a buffer with pH 7.0-7.4, adding NaBH4 and reacting in dark conditions to obtain the AgNCs modified with the hairpin H.
[0015] The molar ratio of the hairpin H to AgNO3 is 1:6; the molar ratio of AgNO3 to NaBH4 is 1:1.
[0016] The temperature of the reaction is 0-4℃; the time of the reaction is 16 h-24 h.
[0017] The preparation method of the above-mentioned electrochemical biosensor for detecting ochratoxin A comprises the following steps:
[0018] (1) synthesis of silver nanoclusters;
[0019] (2) pretreatment of the counter electrode;
[0020] (3) modification of the capture DNA to the electrode surface;
[0021] (4) detection of the sample for OTA.
[0022] The pretreatment method is as follows:
[0023] The gold electrode is immersed in a mixture of H2O2 and concentrated H2SO4 with a volume ratio of 7:3, then ultrasonicated and washed with double-distilled water; then polished to a mirror surface in 0.3 µm and 0.05 µm alumina slurries in sequence, and then repeatedly rinsed with PBS buffer and double-distilled water.
[0024] A kit comprising the above-mentioned electrochemical sensor for ochratoxin A.
[0025] The kit can further comprise ochratoxin A and a buffer.
[0026] A method for detecting ochratoxin A by using the above-mentioned electrochemical sensor or kit, comprising the following steps:
[0027] (1) mixing the sample solution to be detected with A-P probe solution, Mg 2+ solution, hairpin H1 solution, hairpin H2 solution, dHTPs solution, modified hairpin H AgNCs suspension, KF DNA polymerase solution, and then dropping onto the gold electrode modified with capture DNA for reaction, sequentially cleaning with PBS buffer and ultrapure water for three times respectively, and drying under nitrogen flow to obtain the modified gold electrode;
[0028] (2) taking Ag / AgCl as the reference electrode, Pt electrode as the counter electrode, and the modified gold electrode as the working electrode, placing in the electrolyte containing H2O2, and reading the change of the electric signal by using differential pulse voltammetry.
[0029] In step (1), the reaction temperature is 37 DEG C, and the reaction time is 2h.
[0030] In step (2), the parameter setting of differential pulse voltammetry is: the potential setting is-0.2 to-0.8 V, the amplitude is 0.05V, and the pulse width is 0.2s.
[0031] The detection principle of the application is shown in Figure 1 , wherein the sequences of each nucleic acid element and intermediate product are as follows:
[0032] Aptamer Apt:
[0033] 5'-GATC GGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-3';
[0034] Primer P:
[0035] 5'-T GTCCGATGCAAAGACACCCGA-3';
[0036] Capture DNA:
[0037] 5'-CCGCCGGAAAAAACCGCCGGAAAAAACCGCCGGAAAAAA-SH-3';
[0038] Hairpin H:
[0039] 5'-CCCCCCCCCCCC CCGGC GGCTCT(rA)GGGTGTCT GCCGG-3';
[0040] Hairpin H1:
[0041] 5'-CGAAGAGCCGCTTTGGGGAAAAACCCCAAAGCGGCTCTTCGTCCGGCTCGG-inverted-dT-3';
[0042] Hairpin H2:
[0043] 5'-CACCCGAGCCG TTTGGGG AAAAA CCCCAAA CGGCTCGGGTG TCTTTGCGGC-inverted-dT-3';
[0044] Product P2 (SEQ ID NO: 7):
[0045] 5'-TGTCCGATGCAAAGACACCCGACGAAGAGCCGCTTTGGGGAAAAACCCCAAAGCGGCTCTTCGTCCGGCTCGG-inverted-dT-3'
[0046] Product P3 (SEQ ID NO: 8):
[0047] 5'-TGTCCGATGCAAAGACACCCGACGAAGAGCCGCAAAGACACCCGAGCCG TTTGGGG AAAAACCCCAAA CGGCTCGGGTG TCTTTGCGGC-inverted-dT-3'
[0048] DNAzyme (SEQ ID NO: 9):
[0049] 5'-AGACACCCGAGCCGGACGAAGAGCC-3'
[0050] Apt specifically recognizes and takes away OTA, thus releasing the promoter primer P. The promoter primer P first binds to H1 as the first primer of the primer exchange reaction, and then polymerization reaction is carried out under the action of KF DNA polymerase and dHTPs to obtain product P2; P2 as the second primer hybridizes with H2, and then polymerization reaction is carried out under the action of KF and dHTPs to obtain product P3; P3 will continue to bind to H1 to carry out polymerization reaction, and the cycle continues until dHTPs are completely consumed, and finally the product obtained contains a large amount of Mg 2+Metal DNAzyme. After the primer exchange reaction, the cleavage reaction of DNAzyme and H-AgNCs was carried out, and H-AgNCs was cut into two parts, and the part with silver nanoclusters entered the electrode sensing interface, and the other part entered the cycle of the primer exchange reaction. The electrode sensing interface first anchors a large amount of cDNA through Au-S bond, and when the homogeneous reaction solution is added, the DNA with silver nanoclusters is combined with cDNA. Through the three-electrode system, the electrode sensing interface carries out electrochemical sensing detection in the electrolyte containing H2O2, and a strong electrochemical signal is generated. When the system does not exist OTA, the above process cannot be carried out, so a strong electrochemical signal change will not be detected.
[0051] The present application has the following advantages:
[0052] The sensor provided by the present application utilizes the specific binding between OTA and its aptamer for detection; the primer exchange reaction and the catalytic cleavage reaction of DNAzyme play a signal amplification role, and the detection sensitivity is improved. The reaction conditions of the sensor are mild, and the reaction speed is fast; the main process of the detection principle is realized on the electrode, the reaction speed is improved, the operation complexity is reduced, and rapid, simple and sensitive detection of the target substance is realized. The preparation method of the sensor is simple, the performance is stable, and the sensor is suitable for detection of OTA in food and environment; the process cost of the preparation process is low, the performance is stable, the electrode repeatability is good, and the sensor is suitable for the requirements of low cost in industrialization. BRIEF DESCRIPTION OF DRAWINGS
[0053] Figure 1 It is a schematic diagram of the principle of the present application;
[0054] Figure 2 It is a KF polymerase concentration optimization detection result graph;
[0055] Figure 3 It is a H-AgNCs concentration optimization detection result graph;
[0056] Figure 4 It is a H2O2 concentration optimization detection result graph;
[0057] Figure 5 It is a current of different OTA concentrations;
[0058] Figure 6 It is a standard curve of the sensor for detecting OTA. DETAILED DESCRIPTION
[0059] The present application will be further described below in combination with examples and drawings, but the present application is not limited by the following examples.
[0060] Example 1 Construction of electrochemical sensor
[0061] (1) Preparation and synthesis of elements
[0062] The aptamer Apt, primer P, capture DNA, hairpin H, hairpin H1 and hairpin H2 were synthesized according to the nucleotide sequences shown in SEQ ID NO: 1-6, wherein the 3' end of the capture DNA was modified with SH, and the 3' ends of the hairpin H1 and hairpin H2 were both modified with inverted-dT.
[0063] Preparation of A-P probe:
[0064] Equal volumes of aptamer Apt solution and primer P solution were incubated together at 95°C for 5 min, and then naturally cooled to room temperature to form an A-P probe (10 μM), which was stored at 4°C for later use.
[0065] Preparation of gold electrode modified with capture DNA (cDNA-AuE):
[0066] (a) The surface residues were removed by immersion in a mixture of 30% H2O2 and H2SO4 (concentrated) (volume ratio 7:3), followed by ultrasonic treatment and washing with double-distilled water; then the pre-treatment gold electrode was polished to a mirror surface by sequentially placing it in 0.3 μm and 0.05 μm alumina slurries, and then repeatedly rinsed with PBS buffer (pH 7.4) and double-distilled water three times;
[0067] (b) A solution of cDNA (final concentration 1 μM) was added dropwise to the pre-treatment gold electrode, which was then incubated at 37°C for 4 h, washed with PBS buffer (pH 7.4) three times, and then immersed in MCH, and the modified electrode was washed with PBS multiple times, and stored at 4°C.
[0068] Preparation of AgNCs modified with hairpin H (H-AgNCs):
[0069] 15 μL of 100 μM hairpin H solution was added to 76 μL of 20 mM PB buffer (pH=7.0) and mixed; then 4.5 μL of 2 mM AgNO3 solution was added and shaken to mix, followed by reaction at 4°C in the dark for 30 min; then 4.5 μL of 2 mM NaBH4 was added and shaken to mix, followed by reaction at 4°C in the dark for 16 h, to obtain H-AgNCs with a final concentration of 15 μM, wherein the 5' end of the hairpin H was connected to AgNCs.
[0070] (2) Modification of working electrode
[0071] (a) Preparation of 100 μL of ochratoxin A detection system: 8 μL of 25 μM A-P probe, 10 μL of double distilled water (control) or 100 ng / mL OTA, 2 μL of 1 M MgCl2, 4 μL of 25 μM H1, 4 μL of 25 μM H2, 2 μL of 100 U / μL KF DNA polymerase, 30 μL of dHTPs and 40 μL of 15 μM H-AgNCs;
[0072] (b) 10 μL of the above solution was added dropwise to the cDNA-AuE, incubated at 37°C for 2 h, then washed with PBS buffer (pH 7.4) and ultrapure water respectively for three times, dried under nitrogen flow, and the modified gold electrode (working electrode) was obtained.
[0073] (3) Target detection
[0074] (a) Preparation of electrolyte: 4 mL of 5×PBS buffer (pH 7.4) was taken in 16 mL of sterilized water, and 200 μL of 100 mM H2O2 solution was added, mixed well and used immediately;
[0075] (b) Detection of target: The modified gold electrode was placed in the electrolyte, and DPV test was performed by electrochemical workstation, with Ag / AgCl as reference electrode and Pt electrode as counter electrode, potential setting at -0.2 to -0.8 V, amplitude 0.05 V, pulse width 0.2 s, and differential pulse voltammetry was used to read the change of electric signal to detect the target. Compared with the control, the current of the detection system containing OTA increased significantly, indicating that the constructed electrochemical sensor could detect OTA.
[0076] Example 2 Effect of KF polymerase concentration on electric signal
[0077] The components of each electrochemical sensor prepared in Example 1 were taken, and then the optimal concentration of KF polymerase was screened according to the following steps:
[0078] Preparation of 100 μL of ochratoxin A detection system: 8 μL of 25 μM A-P probe, 10 μL of 100 ng / mL OTA, 2 μL of 1 M MgCl2, 4 μL of 25 μM H1, 4 μL of 25 μM H2, 2 μL of double distilled water or KF DNA polymerase (final concentration of 0.5 U / μL, 1.0 U / μL, 1.5 U / μL, 2.0 U / μL, 2.5 U / μL), 30 μL of dHTPs and 40 μL of 15 μM H-AgNCs;
[0079] Take 10 μL of the above solution dropwise to cDNA-AuE, incubate at 37°C for 2h, then wash with PBS buffer (pH 7.4) and ultrapure water respectively for three times, dry under nitrogen flow, obtain the modified gold electrode (working electrode);
[0080] The current signal was detected according to the method in step (3) of Example 1, and the results are shown in Figure 2 As can be seen from the figure, in the concentration range of 0-2.5 U / μL, with the increase of concentration, the electrochemical response first increases and then stabilizes, and the electrochemical response is the strongest when the concentration is 2 U / μL, so 2 U / μL is the optimal concentration of KF polymerase.
[0081] Example 3 Influence of H-AgNCs concentration on electrical signal
[0082] Take the components of each electrochemical sensor prepared in Example 1, and then screen the optimal concentration of H-AgNCs according to the following steps:
[0083] Prepare 100 μL of ochratoxin A detection system: 8 μL of 25 μM A-P probe, 10 μL of 100 ng / mL OTA, 2 μL of 1 M MgCl2, 4 μL of 25 μM H1, 4 μL of 25 μM H2, 2 μL of 200 U / μL KF DNA polymerase, 30 μL of dHTPs and 40 μL of H-AgNCs (2, 4, 6, 8, 10 μM);
[0084] Take 10 μL of the above solution dropwise to cDNA-AuE, incubate at 37°C for 2h, then wash with PBS buffer (pH 7.4) and ultrapure water respectively for three times, dry under nitrogen flow, obtain the modified gold electrode (working electrode);
[0085] The current signal was detected according to the method in step (3) of Example 1, and the results are shown in Figure 3 As can be seen from the figure, in the concentration range of 0-2.5 U / μL, with the increase of concentration, the electrochemical response first increases and then stabilizes, and the electrochemical response is the strongest when the concentration is 2 U / μL, so 2 U / μL is the optimal concentration of KF polymerase.
[0086] Example 4 Influence of H2O2 concentration on electrical signal
[0087] Take the components of each electrochemical sensor prepared in Example 1, and then screen the optimal concentration of H-AgNCs according to the following steps:
[0088] Prepare 100 μL of ochratoxin A detection system: 8 μL of 25 μM A-P probe, 10 μL of 100 ng / mL OTA, 2 μL of 1 M MgCl2, 4 μL of 25 μM H1, 4 μL of 25 μM H2, 2 μL of 200 U / μL KF DNA polymerase, 30 μL of dHTPs, and 40 μL of 6 μM H-AgNCs;
[0089] Take 10 μL of the above solution and drop it onto the cDNA-AuE, incubate at 37°C for 2 h, then wash with PBS buffer (pH 7.4) and ultrapure water respectively for three times, dry under nitrogen flow, and obtain the modified gold electrode (working electrode);
[0090] Take 4 mL of 5×PBS buffer (pH 7.4) in 16 mL of sterilized water, and add 200 μL of H2O2 solution (25, 50, 100, 150, 200 mM), mix well, and then detect the current signal according to the method in step (3) of Example 1;
[0091] The results are shown in Figure 4 From the figure, it can be seen that when the concentration of H2O2 is in the range of 0-10 mM, the current signal increases with the increase of its concentration, when the concentration reaches 10 mM, the current reaches the maximum, and when the concentration exceeds 10 mM, the current decreases slightly, so the optimal concentration of H2O2 is 10 mM.
[0092] Example 5 Detection limit of sensor for OTA
[0093] Take the components of each electrochemical sensor prepared in Example 1, and then measure the detection limit of the sensor according to the following steps:
[0094] Prepare 100 μL of ochratoxin A detection system: 8 μL of 25 μM A-P probe, 10 μL of 100 ng / mL OTA, 2 μL of 1 M MgCl2, 4 μL of 25 μM H1, 4 μL of 25 μM H2, 2 μL of 200 U / μL KF DNA polymerase, 30 μL of dHTPs, and 40 μL of 6 μM H-AgNCs;
[0095] Take 10 μL of the above solution and drop it onto the cDNA-AuE, incubate at 37°C for 2 h, then wash with PBS buffer (pH 7.4) and ultrapure water respectively for three times, dry under nitrogen flow, and obtain the modified gold electrode (working electrode);
[0096] Detect the current signal according to the method in step (3) of Example 1, and the results are shown in Figure 5 and Figure 6The DPV responses corresponding to different concentrations of OTA are shown in the figure. As can be seen from the figure, the higher the concentration of OTA, the stronger the DPV response. The peak current of the DPV response is linearly fitted with the logarithm of the concentration of OTA, and the equation is I = 3.751 + 0.919lgC OTA (R 2 = 0.9959). It is calculated that the detection limit of the electrochemical sensor for OTA reaches 0.649 ng / mL.
Claims
1. An electrochemical sensor for ochratoxin A, characterized in that, include: AP probe, gold electrode modified for DNA capture, AgNCs modified with hairpin H, hairpin H1, hairpin H2, KF DNA polymerase, a mixture of deoxyribonucleotides dATP, dCTP, and dGTP, and Mg 2+ H2O2; The AP probe was obtained by hybridization of aptamer Apt and primer P. The nucleotide sequences of the aptamer Apt, primer P, capture DNA, hairpin H, hairpin H1 and hairpin H2 are shown in SEQ ID NO:1-6; The 3' end of the captured DNA is modified with -SH; Both hairpin H1 and hairpin H2 have their 3' ends modified with reverse dT.
2. The ochratoxin A electrochemical sensor according to claim 1, characterized in that, The method for preparing a modified gold electrode for capturing DNA includes the following steps: The DNA-capturing solution was added to the gold electrode and incubated at 37°C, then washed sequentially with PBS buffer and water; the gold electrode was then immersed in 6-mercapto-1-hexanol to obtain the final product.
3. The ochratoxin A electrochemical sensor according to claim 1, characterized in that, The preparation method of hairpin H-modified AgNCs includes the following steps: mixing hairpin H solution and AgNO3 solution in a buffer solution of pH 7.0-7.4, adding NaBH4 and reacting under dark conditions to obtain hairpin H-modified AgNCs.
4. The ochratoxin A electrochemical sensor according to claim 3, characterized in that, The molar ratio of hairpin H to AgNO3 is 1:6; the molar ratio of AgNO3 to NaBH4 is 1:
1. The reaction temperature is 0-4℃; the reaction time is 16 h-24 h.
5. A method for preparing an ochratoxin A electrochemical sensor as described in any one of claims 1-4, characterized in that, Includes the following steps: (1) Synthesis of silver nanoclusters; (2) Pre-treat the electrodes; (3) Capture DNA modified onto the electrode surface; (4) The sample was subjected to OTA testing.
6. The preparation method according to claim 5, characterized in that, The preprocessing method is as follows: The gold electrode was immersed in a mixture of H2O2 and concentrated H2SO4 at a volume ratio of 7:3, then sonicated and washed with double-distilled water; then polished to a mirror finish in 0.3 µm and 0.05 µm alumina slurries, and then rinsed repeatedly with PBS buffer and double-distilled water.
7. A kit comprising an ochratoxin A electrochemical sensor as described in any one of claims 1-4.
8. A method for detecting ochratoxin A using an electrochemical sensor as described in any one of claims 1-4 or a kit as described in claim 7, characterized in that, Includes the following steps: (1) Mix the sample solution to be tested with the AP probe solution and Mg 2+ The solution, hairpin H1 solution, hairpin H2 solution, dHTPs solution, AgNCs suspension modified with hairpin H, and KF DNA polymerase solution were mixed and then dropped onto the modified gold electrode for capturing DNA. The electrode was washed three times with PBS buffer and ultrapure water, and dried under a nitrogen stream to obtain the modified gold electrode. (2) Using Ag / AgCl as the reference electrode, Pt electrode as the counter electrode, and modified gold electrode as the working electrode, the electrode was placed in an electrolyte containing H2O2, and the change in electrical signal was read by differential pulse voltammetry.
9. The method according to claim 8, characterized in that, In step (1), the reaction temperature is 37℃ and the reaction time is 2h.
10. The method according to claim 8, characterized in that, In step (2), the parameters of the differential pulse voltammetry are set as follows: the potential is set to -0.2 to -0.8 V, the amplitude is 0.05 V, and the pulse width is 0.2 s.
Citation Information
Patent Citations
Electrochemical aptamer sensor for quantitatively detecting ochratoxin A and application thereof
CN111122677A
Electrochemical biosensor for detecting ochratoxin A based on DNA tetrahedron
CN113552188A