A gene expression cassette for improving the production of methionine by candida utilis, an expression vector, genetically engineered bacteria, a method and application
By modifying the GAP-P promoter and selecting the homologous signal peptide SP8, gene expression cassettes and expression vectors were constructed, which increased the methionine production of Candida utilis, solved the problem of insufficient amino acid balance in dairy cow diets, reduced feed costs, and reduced environmental pollution.
Patent Information
- Application Number
- CN202211409375.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-11
- Publication Date
- 2026-02-27
- Estimated Expiration
- 2042-11-11
AI Technical Summary
In the existing technology, the methionine production of engineered Candida utilis is low, which is difficult to meet the amino acid balance requirements of dairy cow diets, resulting in insufficient dairy cow production performance and high feed costs.
By modifying the GAP-P promoter and selecting the homologous signal peptide SP8, gene expression cassettes and expression vectors were constructed to enhance the secretory expression of δ-ZEIN protein and increase methionine production.
Methionine production increased by 21.09%, achieving amino acid balance in dairy cow diets, reducing feed costs and environmental pollution.
Smart Images

Figure CN116254285B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of protein expression, and particularly relates to a gene expression cassette for improving methionine yield of Candida utilis, an expression vector, genetically engineered bacteria, a method and application. BACKGROUND
[0002] In the cost of cow breeding, the cost of forage generally accounts for 70% to 80%, and the change of the cost of forage mainly depends on the up and down fluctuation of the price of protein feed raw materials. In the daily ration of cows, due to reasons such as mad cow disease, China prohibits the use of animal-derived products as feed raw materials, and crop by-product cakes are the main source of cow feed protein. In the cake protein feed, soybean meal is a relatively ideal feed raw material in terms of amino acid balance, and thus the price is high. In order to reduce the cost, it can only be used in high-yield cow daily ration, and a small amount or not used in low-yield cow daily ration. In order to make up for the lack of soybean meal, microorganism protein (yeast, yeast culture, etc.) and over-the-rumen amino acid (lysine and methionine) are usually added to the daily ration based on grains to provide sufficient amino acids for cows to obtain the maximum milk yield and milk protein yield. However, due to the low content of methionine in soybean meal and yeast feed, it cannot meet the requirements of amino acid balance and needs of cows. The expensive price of over-the-rumen amino acid often leads to less or no addition, so it is difficult to achieve the ideal effect in actual production.
[0003] In most cases of daily ration, methionine and lysine are the main limiting amino acids for milk secretion and milk protein synthesis of cows, and in the daily ration based on corn silage, methionine is the first limiting amino acid for milk secretion and milk protein synthesis. After the balance of daily ration lysine and methionine, not only the utilization rate of metabolic protein, total feed utilization efficiency, milk production performance and reproductive performance can be improved, but also metabolic disorders can be reduced. Domestic and foreign researches have shown that the supplement of over-the-rumen protected methionine to cows can increase milk yield, milk protein, milk fat and total solid content. It is also deeply realized that methionine as an important limiting amino acid for ruminants plays a great role in fully exerting the production potential of animals, reducing the emission of fecal and urine nitrogen and protecting the environment.
[0004] Methionine is also a functional amino acid. The hair, milk and meat production of animals are limited by the content of sulfur-containing amino acids (methionine and cystine). Methionine can stimulate the growth of rumen microorganisms, improve the digestibility of fiber, the production of volatile fatty acids and the synthesis of microbial protein. In the body of dairy cows, methionine can not only synthesize protein and be quickly converted into cystine, but also provide active methyl and hydroxyl groups for the synthesis of choline, keratin and nucleic acid, etc., supplement the partial function of choline or vitamin B12, and promote cell proliferation and animal growth. Methionine can also use its methyl group to methylate toxic or drugs to play a detoxification role. In addition to participating in the transfer of methyl and phosphorus metabolism in the animal body, methionine is also involved in the synthesis of adrenaline and creatine. Methionine is of great significance to the development of the mammary gland of dairy cows and the synthesis of milk. However, methionine mainly exists in animal protein, and the content in plant protein is relatively low. Moreover, methionine cannot be directly synthesized in the animal body, and the need of animals for methionine can only be supplemented by exogenous.
[0005] The zein in the endosperm of corn is a naturally occurring stable protein, which is rich in sulfur-containing amino acids (containing 20% methionine), and the content of δ-10kD type zein is the highest. The protein is not degraded in the rumen of ruminants and has enteric solubility, which can cleverly achieve the purpose of rumen protection. Feed yeast belongs to single-cell protein, which is safe and reliable, has short production cycle (yeast has stronger ability to synthesize protein than plant protein, and is faster than animal protein), simple operation, low production cost, and high nutritional value. The protein content in dry matter can be as high as 50%, the lysine content is higher than that of soybean, close to animal protein, and it also contains B vitamins, minerals and other physiological active substances. It is a multi-dimensional high-protein active yeast feed, but the content of methionine is low. Methionine needs to be added when it is used as a protein feed raw material. Among them, Candida utilis, Saccharomyces cerevisiae and Kluyveromyces are certified by the US FDA as yeasts that can be used as food additives, which can be used in food, pharmaceutical industry and feed of livestock and poultry. If the δ-10kD type zein gene is transformed into Candida utilis and applied in the daily diet of dairy cows, the content of methionine in the daily diet of dairy cows can be increased, the balance between lysine and methionine can be achieved, and the production performance of dairy cows can be improved. The utilization rate of protein feed of dairy cows can be improved, the nitrogen excretion in feces can be reduced, and the environmental pollution can be reduced. It can be directly used as a safe single-cell protein for feed, and the fermentation liquor does not need to be separated and purified, which saves time and is economical and practical. The protein feed produced by the yeast engineering bacteria can be applied in the daily diet of dairy cows, so that the rumen-protected amino acids do not need to be added in the daily diet of dairy cows, or the protein feed of dairy cows can be completely or partially replaced by soybean meal, which can significantly reduce the cost of feed. However, the yield of methionine of the food-grade Candida utilis engineering bacteria expressing zein still needs to be improved. SUMMARY
[0006] The application aims to provide a gene expression cassette, an expression vector, a genetically engineered bacterium and a method for improving the yield of methionine in Candida utilis and application thereof.
[0007] The application provides application of a GAP-P mutated promoter GP6 and a homologous signal peptide SP8 in improving the yield of methionine in Candida utilis.
[0008] The application also provides nucleotide sequences of the gene expression cassette containing the GAP-P mutated promoter GP6, the homologous signal peptide SP8 and a zein gene.
[0009] Preferably, the gene expression cassette further comprises a pro region of an exogenous signal peptide a-MF, and the nucleotide sequence of the pro region of the exogenous signal peptide a-MF is shown as SEQ ID NO. 4.
[0010] Preferably, the nucleotide sequence of the gene expression cassette is shown as SEQ ID NO. 5.
[0011] The application also provides an expression vector containing the gene expression cassette.
[0012] The application also provides a construction method of the expression vector, and the gene expression cassette is constructed on a basic plasmid to obtain the expression vector.
[0013] The application also provides a genetically engineered bacterium containing the expression vector or obtained by the construction method.
[0014] Preferably, the basic bacterium of the genetically engineered bacterium comprises Candida utilis.
[0015] The application also provides application of the gene expression cassette, the expression vector or the genetically engineered bacterium in improving the yield of methionine or as food or as a feed additive.
[0016] The application also provides a method for improving the yield of methionine, and the genetically engineered bacterium is cultured in a culture medium.
[0017] The application provides application of a GAP-P mutated promoter GP6 and a homologous signal peptide SP8 in improving production of methionine of Candida utilis. The GAP-P mutated promoter GP6 and the homologous signal peptide SP8 can be used to construct an expression plasmid which can improve the production of methionine of Candida utilis, and then a genetically engineered bacterium which can improve the production of methionine of Candida utilis is obtained. The test results show that, compared with a delta-ZEIN engineered bacterium containing a wild-type GAP-P promoter (i.e. a non-mutated GAP-P promoter), the methionine production of the delta-ZEIN engineered bacterium constructed by the optimal promoter and signal peptide screened in the application is increased by 21.09%. BRIEF DESCRIPTION OF DRAWINGS
[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.
[0019] Figure 1 The figure is a GAP-P mutated promoter E. coli recombinant bacterium identification result provided by the present application;
[0020] Figure 2 The figure is a GAP-P mutated promoter recombinant plasmid single and double enzyme digestion identification result provided by the present application;
[0021] Figure 3 The figure is a mutated promoter recombinant yeast subgenome PCR identification provided by the present application;
[0022] Figure 4 The figure is a pM-ZEIN expression vector construction provided by the present application;
[0023] Figure 5 The figure is an endogenous signal peptide expression vector construction provided by the present application;
[0024] Figure 6 The figure is a signal peptide expression vector E. coli recombinant bacterium PCR identification result provided by the present application;
[0025] Figure 7 The figure is a signal peptide expression vector recombinant yeast subgenome PCR identification provided by the present application;
[0026] Figure 8 The figure is a signal peptide recombinant yeast bacterium delta-ZEIN ELISA detection result provided by the present application;
[0027] Figure 9 Construction map of the secretory expression vector of delta-ZEIN provided by the present application;
[0028] Figure 10 PCR identification map of the secretory expression vector of the recombinant yeast genome provided by the present application. DETAILED DESCRIPTION
[0029] The application provides application of a GAP-P mutated promoter GP6 and a homologous signal peptide SP8 in improving the yield of methionine of Candida utilis; the nucleotide sequence of the GP6 is shown as SEQ ID NO. 1, and the nucleotide sequence of the SP8 is shown as SEQ ID NO. 2. The application realizes the improvement of the yield of methionine of Candida utilis by screening the GAP-P mutated promoter GP6 and the homologous signal peptide SP8.
[0030] The application obtains the GAP-P mutated promoter capable of improving the yield of methionine by mutating the GAP-p promoter in the food-grade Candida utilis engineering bacteria expressing zein. Then the homologous signal peptide with a secretory effect is obtained. The mutated promoter and the homologous signal peptide can increase the secretory expression of the delta-ZEIN protein.
[0031] The application preferably takes the plasmid pGZM18-EGFP as a template, and obtains the mutated GAP promoter through EP-PCR. After obtaining the mutated GAP promoter, the application preferably performs screening of a GAP promoter mutation library to obtain a high-intensity promoter. Specifically, the application preferably cultures the recombinant yeast bacteria of the mutated GAP-P promoter, determines the bacterial concentration and the expression intensity of EGFP, and screens the strong promoter according to the fluorescence intensity, that is, the GP6 in the above technical solution.
[0032] The homologous signal peptide in the application refers to the homologous signal peptide of Candida utilis. The application preferably utilizes a sequencing company to determine and assemble splice the whole sequence of the chromosome of the recipient Candida utilis bacteria, and then performs prediction and analysis of the signal peptide.
[0033] The application preferably carries out signal peptide screening by constructing a signal peptide screening vector. First, a section containing the alpha-MF signal peptide of Saccharomyces cerevisiae and the delta-zein alcohol-soluble protein gene (containing a His tag at the C terminal) is synthesized. Then, the synthesized alpha-MF signal peptide and the delta-zein alcohol-soluble protein gene (containing a His tag at the C terminal) are connected to the double enzyme digestion product of the pGZM18-EGFP plasmid by enzyme digestion and connection, the egfp gene and the SV40 poly(A) signal are removed, and the remaining part is connected to the alpha-MF signal peptide and the delta-zein gene (containing a His tag at the C terminal) to construct the pM-ZEIN vector as a control vector for screening signal peptides. Second, the homologous signal peptides are selected according to the genome sequencing of C.utilis and signal peptide software analysis. The selected signal peptide sequences are connected to the pro region of the alpha-MF signal peptide and the target gene delta-zein, respectively, to construct multiple signal peptide expression vectors. The signal peptide recombinant yeast is constructed, the content of delta-ZEIN in the fermentation broth of the yeast is detected, and the endogenous signal peptide SP8 which has a very significant difference compared with the control group a-MF signal peptide is obtained.
[0034] Subsequently, the application uses the screened GAP-P mutant promoter sequence and the homologous signal peptide sequence to construct a delta-ZEIN secretion expression vector. The DNA sequence from the prokaryotic microorganism is deleted by the SOE-PCR method, and the genetically engineered bacteria for food-grade secretion expression of delta-zein are constructed in Candida utilis by electrotransformation, identified by PCR and sequencing, and the methionine content is determined by liquid chromatography.
[0035] The application also provides a gene expression cassette for improving the methionine yield of Candida utilis, wherein the gene expression cassette contains a GAP-P mutant promoter GP6, a homologous signal peptide SP8 and a nucleotide sequence of a zein gene; the nucleotide sequence of the GP6 is shown as SEQ ID NO. 1, the nucleotide sequence of the SP8 is shown as SEQ ID NO. 2, and the nucleotide sequence of the zein gene is shown as SEQ ID NO. 3. In the application, the gene expression cassette further contains a pro region of an exogenous signal peptide a-MF, and the nucleotide sequence of the pro region of the exogenous signal peptide a-MF is shown as SEQ ID NO. 4. In the application, the nucleotide sequence of the gene expression cassette is shown as SEQ ID NO. 5.
[0036] The application also provides an expression vector containing the gene expression cassette described in the above technical solution.
[0037] The application also provides a construction method of the expression vector, which constructs the gene expression cassette in the basic plasmid to obtain the expression vector.
[0038] The application also provides a genetically engineered bacterium comprising the expression vector or the expression vector obtained by the construction method.
[0039] The entire genetic elements of the whole expression system (i.e. the vector after deleting the DNA sequence of the prokaryotic microorganism and the transformed food-grade engineered bacterium) of the application are from the probiotic Candida utilis and the non-toxic and harmless fungus, do not carry antibiotic resistance genes, do not exist the drift, diffusion and integration of the resistance genes, do not carry other toxic protein genes, and do not cause biological safety hazards to the environment or human and animals, so that the food-grade application is achieved, and the food-grade application can be directly added to food and feed.
[0040] The application also provides the application of the gene expression cassette, the expression vector, the genetically engineered bacterium or the method for improving the methionine yield or as food or as a feed additive.
[0041] The application also provides a method for improving the methionine yield, which cultures the genetically engineered bacterium in a culture medium.
[0042] In order to further illustrate the application, the gene expression cassette, the expression vector, the genetically engineered bacterium, the method and the application for improving the methionine yield of Candida utilis are described in detail in combination with the drawings and examples, but they cannot be understood as the limitation of the protection scope of the application.
[0043] Example 1
[0044] 1. Study on improving the strength of the promoter
[0045] 1.1 Materials and methods
[0046] 1.1.1 Reagents, plasmids and strains
[0047] Trans 1-T1 E. coli competent, pEASY-T1 simple Cloning Vector, Trans 2K Marker Seamless Cloning Kit were purchased from Beijing Zoman Biotechnology Co., Ltd. OMEGA E.Z.N.A Gel Extraction Kit was purchased from OMEGA Company. Tool enzymes endonuclease, Taq DNA polymerase, deoxyribonucleotides (dATP, dTTP, dGTP, dCTP), error-prone PCR kit were purchased from Baorui Biotechnology (Beijing) Co., Ltd. pCMV-C-EGFP was purchased from Biyun Tian Biotechnology. T4 DNA ligase, pBR322 vector were purchased from New England Biolabs. pGZM18, pGZM18-EGFP plasmid were constructed and preserved by the laboratory.
[0048] 1.1.2 EP-PCR to obtain GAP-P promoter mutant gene sequence
[0049] EP-PCR reaction amplification system and reaction conditions
[0050] 1) EP-PCR primers (as shown in Table 1)
[0051] Table 1 EP-PCR primer sequence
[0052]
[0053] 2) EP-PCR reaction system:
[0054] pGZM18-EGFP plasmid (construction method: pGZM18 plasmid as a template, design seamless cloning experiment primers, PCR amplification 18s rDNA gene fragment, GAP-P gene, GAP-T gene, CYH resistance gene fragment gel recovery, pCMV-C-EGFP plasmid as a template, obtain egfp gene and SV40 poly(A) signal gene fragment for gel recovery. pBR322 vector double enzyme digestion (EcoRV, Nru I), gel recovery of the target fragment. The 18s rDNA gene fragment, GAP-P gene, egfp gene and SV40 poly(A) signal gene fragment, GAP-T gene, CYH resistance gene obtained by gel recovery and linearized vector pBR322 were subjected to recombination reaction. Gently mix, 50°C for 15 min. After cooling on ice, the recombination product was subjected to E. coli transformation experiment, and the pGZM18-EGFP plasmid was constructed as a control vector in the GAP-P promoter screening experiment) as a template, the final concentration of the template was 1 ng / μL, and the number of cycles (n) in the EP-PCR reaction system was 25; Mn 2+ The EP-PCR reaction was carried out with dATP concentration of 32 mM and dGTP concentration of 4 mM (reaction system as shown in Table 2, reaction conditions as shown in Table 3), a single target band was amplified and the product was recovered, and then the recovered PCR product was used as a template for four consecutive EP-PCR to obtain the best mutation rate. Finally, the EP-PCR products were named: GP1, GP2, GP3, GP4, GP5, GP6.
[0055] Table 2 EP-PCR reaction system of GAP-P promoter gene
[0056]
[0057]
[0058] Table 3 EP-PCR reaction conditions of GAP-P promoter gene
[0059]
[0060] 1.1.3 Construction of GAP-P mutant promoter gene library
[0061] The multiple gel recovery products obtained by EP-PCR were individually connected with pEASY-T1 simple vector to construct the GAP-P mutant promoter gene library.
[0062] According to the pEASY-T1 simple vector instruction, the optimal molar ratio was added, mixed gently, and the ligation reaction was performed at 25°C for 15 min, and then placed on ice. The ligation product was transformed into Trans1-T1 E. coli, and after centrifugation of the transformation liquid at 1500 g, part of the supernatant was discarded, 100 μL was reserved, and then coated on an LB plate containing Amp, X-gal, and IPTG, and then cultured at 37°C overnight. The next day, a single colony of the recombinant bacteria was selected for streak culture.
[0063] A small amount of each streaked bacteria was taken into 10 μL sterile water and vortexed. 1 μL of the bacterial suspension was used as a DNA template for colony PCR identification. Positive GAP-P mutant promoter recombinant bacteria were obtained, and then amplified, cultured, preserved, and sequenced.
[0064] 1.1.4 Construction of GAP-P mutant promoter recombinant yeast bacteria
[0065] 1.1.4.1 Construction of GAP-P mutant promoter expression vector
[0066] Six GAP-P mutant promoter plasmids and pGZM18-EGFP plasmids were selected and double-digested with Kpn I and Sal I (Table 5). The target fragments were recovered and ligated with T4 ligase (Table 6) to replace the original GAP-P promoter in the pGZM18-EGFP plasmid with the GAP-P mutant promoter. Six GAP-P mutant promoter expression vectors were constructed, and then transformed into E. coli, respectively.
[0067] Table 4 Double enzyme digestion reaction system of plasmid
[0068]
[0069] Table 5 Connection reaction of target gene and expression vector
[0070]
[0071] Multiple GAP-P mutant promoter E. coli recombinant colonies were selected for streak culture. The next day, a small amount of each streaked bacteria was taken into 10 μL sterile water and vortexed. The GAP-P mutant promoter E. coli recombinant bacteria were used as a template, and 2GAPS / 2GAPAS was used as the upper and lower primers for PCR amplification. The PCR product was identified by 1% agarose gel electrophoresis to identify positive recombinant bacteria. The reaction system is shown in Table 6. The colony PCR reaction system is shown in Table 6 (25 μL):
[0072] Table 6 Colony PCR reaction system
[0073]
[0074] 1.1.4.2 Extraction of GAP-P mutant promoter E. coli recombinant plasmid
[0075] After amplification and culture of the GAP-P mutant promoter expression vector E. coli recombinant bacteria, the plasmid was extracted according to the operation manual of the Genomed plasmid extraction kit. The GAP-P mutant promoter E. coli recombinant plasmid and the pGZM18-EGFP plasmid were subjected to single and double enzyme digestion identification experiments. Single enzyme digestion used sal I, and double enzyme digestion used Kpn I and Sal I. The specific steps were the same as those in 1.1.4.1.
[0076] 1.1.4.3 GAP-P mutant promoter expression vector for C.utilis yeast transformation
[0077] The pGZM18-EGFP plasmid was subjected to single enzyme digestion with Nco I, and the enzyme digestion product was recovered and transformed into C.utilis as a control strain.
[0078] The expression vector plasmid of the GAP-P mutant promoter in E. coli was subjected to single enzyme digestion with Nco I, and the enzyme digestion product was recovered and transformed into C.utilis.
[0079] Preparation of Candida utilis competent cells According to the operation manual of the Clontech yeast transformation kit.
[0080] 1.1.4.4 Identification of GAP-P mutant promoter recombinant yeast bacteria
[0081] After amplification and culture of the recombinant yeast, the yeast genome was extracted according to the operation manual of the Genomed yeast genome extraction kit.
[0082] Using the yeast genome as a template, PCR identification and sequencing identification were performed with the target gene egfp primers GFPS (TCTAGAATGGTGAGCAAGGGCGAG, SEQ ID NO. 10) / GFPAS (GCTAGCTTAAGATACATTGATGAG, SEQ ID NO. 11). The PCR reaction conditions were the same as those in 1.1.3.
[0083] 1.1.5 GAP-P mutant promoter recombinant yeast bacteria fluorescence intensity detection
[0084] The GAP-P mutant promoter recombinant yeast bacteria were cultured in a 48-deep-well plate, with 900 μL of culture medium per well, at 30°C and 220 r / min.
[0085] Recombinant yeast strains with the GAP-P mutant promoter were streaked, and single colonies approximately 3 mm in size were inoculated into 1 mL of YPD medium and cultured for 24 h. The culture from the previous step was then inoculated into 900 μL of BMD medium (containing 0.2% glucose) and cultured for 48 h. The culture was then inoculated again into 900 μL of BMD medium (containing 1% glucose) and cultured for 36 h. The bacterial concentration and EGFP expression intensity were then measured. Cell density and EGFP fluorescence intensity were measured using a multi-mode microplate reader. The culture was diluted with PBS (Ph 7.0) to an OD of 1. 200 μL of the diluted sample was transferred to a 96-well plate, and the fluorescence intensity was measured under excitation light at 488 nm and emission light at 550 nm. The OD was also detected. 600 The selected strong promoters were then sequenced and verified based on fluorescence intensity screening.
[0086] 1.2 Results and Analysis
[0087] 1.2.1 EP-PCR reaction
[0088] 1) EP-PCR amplification of the GAP-P promoter gene
[0089] The target band was amplified by EP-PCR using the reaction system in Table 2 and the reaction conditions in Table 3. The PCR product was recovered. The recovered product was then subjected to four more rounds of EP-PCR to obtain the GAP-P promoter mutant gene.
[0090] 1.2.2 Identification of recombinant Escherichia coli with GAP-P mutant promoter
[0091] 1) PCR identification of recombinant bacterial colonies with GAP-P mutant promoter
[0092] Using E. coli recombinant bacteria with the GAP-P mutant promoter as a template, and 2GAPS / 2GAPAS as upstream and downstream primers, PCR amplification was performed. The PCR products were then identified by 1% agarose gel electrophoresis to identify positive recombinant bacteria.
[0093] The results are as follows Figure 1 As shown, Figure 1 Figure showing the identification results of recombinant E. coli strains with the GAP-P mutant promoter; where M: Trans2K Marker; 1-6: GAP-P mutant promoter sequences.
[0094] 2) Identification by enzyme digestion of recombinant plasmids from GAP-P mutant promoter
[0095] Figure 2Figure 1 shows the results of single and double enzyme digestion identification of the GAP-P mutant promoter recombinant plasmid and the pGZM18-EGFP plasmid; where M1: Trans 2K Marker; 1, 3, 5, 7, 9, 11, 13: single enzyme digestion products of Sal I; 2, 4, 6, 8, 10, 12, 14: double enzyme digestion products of Kpn I and Sal I; M2: DL10000 DNA Marker.
[0096] The results are as follows Figure 2 As shown, 1-12 are the single and double enzyme digestion products of six GAP-P mutant promoter plasmids. After single digestion with sal I, the full-length vector is 10050 bp. After double digestion with Kpn I and Sal I, the lengths are 970 bp for the GAP-P mutant promoter and 9080 bp for the remaining sequence excluding the GAP-P mutant promoter, respectively. 13 and 14 are the single and double enzyme digestion products of the pGZM18-EGFP plasmid. After single digestion with sal I, the full-length vector is 10050 bp. After double digestion with Kpn I and Sal I, the length of the non-mutated GAP-P promoter is 970 bp, and the remaining sequence excluding the non-mutated GAP-P promoter is 9080 bp.
[0097] 3) Sequencing results of the GAP-P mutant promoter gene.
[0098] The GAP-P mutant promoter gene was cloned and sequenced. Sequencing results showed that the corresponding mutant promoter sequences in the recombinant bacteria were all different. Compared with the wild-type GAP-P promoter sequence, the mutant bases were distributed throughout the entire promoter sequence without obvious pattern.
[0099] 1.2.3 Identification of recombinant yeast strains with GAP-P mutant promoter
[0100] The successfully constructed GAP-P mutant promoter expression vector was homologously recombined into the chromosome of *Candida utilis*, yielding a *C. utilis* strain with the GAP-P mutant promoter. The recombinant yeast genome was extracted for PCR and sequencing identification of the egfp gene. The results showed that the exogenous gene had been successfully integrated into the *Candida utilis* chromosome.
[0101] Figure 3 This is a PCR identification diagram of the recombinant yeast genome; where M: DL2000 marker; 1-6: egfp target gene.
[0102] 1.2.4 Screening for enhanced GAP-P mutant promoters
[0103] GAP-P mutant promoter recombinant yeast was cultured in 48 deep well plates, and the EGFP fluorescence intensity of the recombinant bacteria was detected by a fluorescence microplate reader. It was found that the fluorescence intensity of the recombinant yeast after mutation was significantly higher than that of the wild-type GAP-P promoter regulated EGFP expression strain. The different GAP-P mutant sequences can prove that the different GAP-P mutant sequences have different starting strengths.
[0104] The fluorescence intensity values of the 6 mutant recombinant bacteria were significantly higher than those of the wild-type GAP-P promoter. See Table 7. The GAP-P mutant promoter sequence GP6 was 1.87 times that of the wild-type GAP-P promoter GP, and the GAP-P mutant promoter sequences GP3 and GP5 were 1.23 times and 1.26 times that of the wild-type GAP-P promoter GP. The fluorescence intensity values of the GAP-P mutant recombinant yeast of GP3, GP5 and GP6 were significantly different from those of the GP group. Therefore, the GAP-P mutant promoter sequence GP6 is an enhanced strong promoter.
[0105] Table 7 GAP-P mutant promoter recombinant yeast fluorescence intensity values
[0106]
[0107] Example 2
[0108] 2 Screening of endogenous signal peptides of C.utilis
[0109] 2.1 Materials and methods
[0110] 2.1.1 Reagents, plasmids and strains
[0111] A δ-zein alcohol soluble protein gene containing a Saccharomyces cerevisiae α-MF signal peptide (C-terminal containing His tag) was synthesized by Nanjing Kingsway Company, Premix Taq (Ex Taq TM (Ex Taq TM Version 2.0) was purchased from Baorui Biotechnology (Beijing) Co., Ltd.
[0112] 2.1.2 Sequencing of C.utilis genome
[0113] Candida utilis (C.utilis) chromosomal whole sequence determination, assembly and splicing to obtain C.utilis genome data.
[0114] 2.1.3 Prediction and analysis of signal peptides
[0115] The sequenced C.utilis whole genome data is analyzed by SignalP 5.0 software to obtain endogenous signal peptide sequences with potential secretory protein. The amino acid sequence is input into SignalP 5.0 software for prediction and analysis according to the C, Y, S and D values given by the software. The results in the neural network algorithm NN mainly involve three values: C, S and Y. The S value is one S value corresponding to each amino acid, and the S value of the signal peptide region is higher. The C value is the cleavage site value. Each amino acid will have a C value, and the C value is the highest at the cleavage site. The Y value is a parameter that considers the S value and the C value. It is usually the position where the S value is steep and the site where the C value is the highest. The D value is the average of the S value and the Y value, and plays an important role in distinguishing whether it is a secretory protein. The amino acid sequence with a D value greater than 0.7 has a high possibility of being a signal peptide. Therefore, eight signal peptide sequences are screened from the genomic data, and one commonly used exogenous signal peptide α-mate-factor (a-MF) is used as a control to construct different signal peptide expression vectors.
[0116] The protein sequence of the gene is analyzed by using the tmhmm software to find out the predicted transmembrane protein containing transmembrane helix. The proteins containing transmembrane helix are removed from the above predicted proteins containing signal peptide, and the remaining proteins are secretory proteins.
[0117] 2.1.4 Construction of signal peptide expression vector
[0118] First, a gene containing the α-MF signal peptide of Saccharomyces cerevisiae and the δ-zein alcohol-soluble protein (containing His tag at the C-terminus) is synthesized. Then, the synthesized α-MF signal peptide and δ-zein alcohol-soluble protein gene (containing His tag at the C-terminus) are connected to the pGZM18-EGFP plasmid double enzyme digestion product by enzyme digestion and ligation, and the egfp gene and SV40poly(A)signal gene are removed. The remaining part is connected with the α-MF signal peptide and δ-zein alcohol-soluble protein gene to construct the pM-ZEIN (C-terminus containing His tag) vector as a screening signal peptide control vector. α-MF is a widely used exogenous signal peptide with good secretion ability, and is used as a signal peptide screening control vector to study the influence of C.utilis endogenous signal peptide on δ-zein alcohol-soluble protein secretion. The α-MF signal peptide includes a pre region and a pro region. Studies have shown that the secretion of combined signal peptides is higher than that of themselves. Therefore, the α-MF pro region is retained in the screening of signal peptides in the present application, and the subsequent screening signal peptide vector is constructed. Because the signal peptide secretion efficiency is different in different genes, δ-zein alcohol-soluble protein is used as a signal peptide vector for screening according to the experimental requirements for subsequent use.
[0119] Secondly, based on C. utilis genome sequencing and signal peptide software analysis, homologous signal peptides SP1, SP2, SP3, SP4, SP5, SP6, SP7, and SP8 were selected. The selected signal peptide sequences were then ligated to the target gene δ-zein (containing the α-MFpro region) to construct eight signal peptide expression vectors: pSP1, pSP2, pSP3, pSP4, pSP5, pSP6, pSP7, and pSP8.
[0120] 2.1.4.1 Design of signal peptide vector primers
[0121] Table 8. Primer sequences for signal peptide vectors
[0122]
[0123]
[0124] 2.1.4.2 Construction of pM-ZEIN expression vector containing α-MF signal peptide
[0125] A synthesized segment containing the *Saccharomyces cerevisiae* α-MF signal peptide and δ-zein prolysin gene, along with the pGZM18-EGFP plasmid, was subjected to SalI / PacI double digestion. The digestion products were then recovered by agarose gel extraction. After gel recovery, the two digestion products were ligated using T4 ligase to construct the pM-ZEIN vector.
[0126] 2.1.4.3 Amplification of Endogenous Signal Peptide Genes
[0127] Single clones of *C. utilis* were streaked onto YPD plates and inoculated into YPD liquid medium. Yeast genomic DNA was extracted and used as templates for amplifying the signal peptide. SP1-8F / SP1-8MR primers were used to amplify the signal peptide sequence. pM-ZEIN was used as a template, and SP1-8MF / SPR primers were used to amplify the α-MFpro-ZEIN sequence. Using the amplified signal peptide and α-MFpro-ZEIN as nested PCR templates, eight SP1-SP8 signal peptide-α-MFpro-ZEIN sequences were amplified using SP1-8F / SPR primers. PremixTaq TM (Ex Taq TM Version 2.0) amplification system is shown in the table: Premix Taq TM (Ex Taq TM The amplification system for Version 2.0 is shown in Table 9, and the PCR amplification conditions are shown in Table 10.
[0128] Table 9 PCR Amplification Reactions
[0129]
[0130] Table 10 PCR amplification conditions
[0131]
[0132] 2.1.4.4 Construction of endogenous signal peptide expression vector
[0133] The signal peptide sequence amplified in the previous step was double-enzymatically cut with Sal I / Pac I, and the 764 bp target fragment was recovered from the gel. pGZM18-EGFP was double-enzymatically cut with Sal I / Pac I, and the egfp gene and SV40 poly(A) signal gene were removed, and the remaining 9060 bp vector fragment was recovered from the gel by electrophoresis. The T4 DNA ligase was used for ligation to construct eight endogenous signal peptide expression vectors (containing His tag at the C-terminus), respectively. The endogenous signal peptide expression vectors were transformed into Transl-T1 E. coli, respectively.
[0134] 2.1.4.5 Colony PCR identification of positive clones
[0135] The single clone was resuspended in 10 μL ddH2O, and 1 μL was taken as a template for colony PCR, using the upstream primer for each signal peptide upstream primer and the downstream primer for SPR. PCR was performed for electrophoresis detection. The PCR amplification system was the same as 1.1.3.
[0136] 2.1.5 Construction of signal peptide recombinant yeast
[0137] 2.1.5.1 Purification of signal peptide expression vector
[0138] The correct clone was sequenced, and the extracted plasmid was cut with Nco I, and recovered by agarose gel recovery kit.
[0139] 2.1.5.2 Construction of signal peptide expression vector transformed into C.utilis
[0140] The constructed different signal peptide expression vectors were transformed into C.utilis, respectively.
[0141] 2.1.5.3 Identification of signal peptide recombinant yeast
[0142] The signal peptide recombinant yeast genome was extracted, and the yeast genome was used as a template to design XHTS / XHTAS primers for PCR detection and sequencing identification. The PCR reaction conditions were the same as 1.1.3.
[0143] 2.1.6 ELISA detection of signal peptide recombinant yeast
[0144] The content of His-tagged δ-ZEIN protein in the supernatant of the fermentation broth of the signal peptide recombinant yeast cultured for 48 h was detected by ELISA method. The His Tag ELISA Kit of Kingsway was used to detect according to the product use instruction. The OD 450nm values of the standard and the yeast supernatant were determined, and the standard curve was drawn with the OD 450nm values of the samples. The reaction was repeated three times, and the data was expressed as mean standard error. The data was statistically analyzed by SPSS22.0 statistical software, and P<0.05 and P<0.01 between two groups of data were considered to have statistical significance.
[0145] 2.2 Results and analysis
[0146] 2.2.1 Bioinformatics analysis results
[0147] 2.2.1.1 Signal peptide prediction analysis
[0148] The protein sequences of all the predicted genes were analyzed by using the software SignalP 5.0 to find out the proteins containing signal peptides, and the prediction results are shown in Table 11. 337 signal peptides, 1110 transmembrane proteins and 205 secreted proteins were predicted.
[0149] Table 11 Prediction results of signal peptides of C.utilis genome
[0150]
[0151] After analysis, the candidate signal peptides SP1, SP2, SP3, SP4, SP5, SP6, SP7 and SP8 were screened out, and the D values were all greater than 0.8.
[0152] 2.2.2 Construction of pM-ZEIN expression vector containing a-MF signal peptide
[0153] The synthesized gene containing the α-MF signal peptide of Saccharomyces cerevisiae and the δ-zein alcohol-soluble protein and the pGZM18-EGFP plasmid were subjected to SalI / PacI double enzyme digestion, and the egfp gene and the SV40 poly(A) signal gene were removed from the pGZM18-EGFP plasmid. The sequence length after the rear sequence was 9060 bp, and the length of the double enzyme-digested α-MF signal peptide and δ-zein alcohol-soluble protein gene was 764 bp (SEQ ID NO. 12). The enzyme digestion products were recovered by agarose gel. After the two groups of enzyme digestion products were recovered by gel, they were connected by T4 ligase to construct the pM-ZEIN vector with a length of 9824 bp.
[0154] Figure 4 Construction map of pM-ZEIN expression vector.
[0155] 2.2.3 Construction of endogenous signal peptide expression vector
[0156] The signal peptide sequence was amplified using C. utilis genome as template and SP1-8F / SP1-8MR as primers. The a-MFpro-ZEIN sequence was amplified using pM-ZEIN as template and SP1-8MF / SPR as primers. The signal peptide and a-MFpro-ZEIN were used as a nested PCR template and SP1-8F / SPR as primers to amplify eight screening signal peptide SP1-SP8 a-MFpro-ZEIN sequences (C-terminal containing His tag).
[0157] The signal peptide sequence amplified in the previous step was double digested with Sal I / Pac I, and the 764 bp target fragment was recovered by gel recovery. The pGZM18-EGFP was double digested with Sal I / Pac I, and the 9060 bp vector fragment was recovered by gel electrophoresis. The eight signal peptides were connected respectively using T4 DNA ligase to construct eight signal peptide expression vectors, namely pSP1, pSP2, pSP3, pSP4, pSP5, pSP6, pSP7, and pSP8 as shown in Figure 5 .
[0158] Figure 5 Endogenous signal peptide expression vector construction map.
[0159] 2.2.2 Identification of signal peptide recombinant E. coli
[0160] The endogenous signal peptide expression vector was transformed into Trans1-T1 E. coli, and the E. coli recombinants were resuspended in 10 μL ddH2O, 1 μL of which was used as a template for colony PCR to identify positive recombinants.
[0161] Figure 6 Signal peptide expression vector E. coli recombinant PCR identification results map; wherein, M: Trans 2K Marker; 1: negative control water PCR product; 2-9: signal peptide-a-MFpro-ZEIN gene sequence.
[0162] 2.2.3 Signal peptide recombinant yeast strain identification
[0163] The constructed pSP1, pSP2, pSP3, pSP4, pSP5, pSP6, pSP7, and pSP8 were homologously recombined into the chromosome of Candida utilis to obtain signal peptide recombinant yeast strains. The recombinant yeast strain genome was extracted and subjected to signal peptide and δ-zein gene sequence PCR identification and sequencing using primers XHTS / XHTAS. The results showed that the exogenous gene had been successfully integrated into the chromosome of Candida utilis.
[0164] Figure 7 Figure 1 is a PCR identification map of signal peptide expression vector recombinant yeast subgenome; M: DL2000 marker; 1-10: signal peptide and a-MF pro-δ-zein gene sequence of pM-ZEIN, pM-ZEIN, pSP1, pSP2, pSP3, pSP4, pSP5, pSP6, pSP7, pSP8; 11: negative control water PCR product.
[0165] 2.2.5 Influence of different signal peptides on the protein level of δ-ZEIN
[0166] The content of His fusion protein δ-ZEIN in the yeast supernatant was quantitatively detected by using His Tag ELISA kit, and the concentration of δ-ZEIN was taken as the abscissa, and OD 450 was taken as the ordinate to establish a standard curve, and the regression equation was y = 13.812x 2 -66.611x + 101.03, R 2 = 0.9937. Through the formula of the standard curve, the content of His fusion δ-ZEIN in the supernatant of signal peptide recombinant yeast SP1, SP2, SP3, SP4, SP5, SP6, SP7, SP8 was 1181.70, 1326.87, 1436.52, 1270.40, 1007.00, 1159.97, 1122.09, 1517.57, 2091.58 ng / mL respectively. Compared with the control group a-MF signal peptide, there was a very significant difference in SP8 group (between the two groups of data, *P < 0.05). Therefore, SP8 signal peptide was used as the best signal peptide in the subsequent optimization of the construction of the secretion expression vector.
[0167] Figure 8 Figure 5 is the ELISA detection result of signal peptide recombinant yeast δ-ZEIN.
[0168] 3 Construction of recombinant yeast bacteria with optimized expression elements
[0169] The present application optimizes the promoter and signal peptide respectively, and effectively improves the secretion expression of δ-ZEIN in Candida utilis by optimizing the promoter and signal peptide.
[0170] Example 3: Based on the optimal promoter and signal peptide screened, the recombinant yeast bacteria for secreting and expressing δ-ZEIN were constructed.
[0171] Example 3
[0172] 3.1 Materials and methods
[0173] 3.1.1 Reagents, plasmids and strains
[0174] The experimental reagents and culture media used were consistent with Example 1.
[0175] 3.1.2 Construction of recombinant yeast strain secreting δ-ZEIN
[0176] 3.1.2.1 Construction of secretory expression vector
[0177] The GP6 GAP-P mutant promoter sequence obtained by screening was double-enzymatically cut with Kpn I and Sal I, and the target fragment was recovered and ligated with T4 ligase. A δ-ZEIN secretory expression vector containing the GP6 GAP-P mutant promoter sequence and the SP8 signal peptide sequence was constructed, and the vector was then transformed into E. coli. The prokaryotic microbial DNA sequence was then deleted by SOE-PCR to obtain a food-grade vector sequence.
[0178] 3.1.2.2 Transformation of C. utilis yeast with secretory expression vector
[0179] The food-grade vector sequence obtained in the previous experimental step was recovered and transformed into C. utilis. The recombinant yeast strain was extracted to obtain the yeast genome, and PCR verification was performed using primers GS1 / GS2. The method was the same as 1.1.3.
[0180] Table 12 Identification primers for secretory expression vector
[0181]
[0182] 3.1.3 Determination of methionine in fermentation broth of secretory expression recombinant yeast strain
[0183] The δ-ZEIN recombinant yeast strain containing the wild-type GAP-P promoter and the δ-ZEIN secretory expression recombinant yeast strain containing the GP6 GAP-P mutant promoter sequence and the SP8 signal peptide sequence after optimization were used as the control group and the test group, and LC-MS was used to detect the methionine content in the two groups of samples.
[0184] 3.2 Experimental results
[0185] 3.2.1 Construction of secretory expression vector
[0186] The GP6 GAP-P mutant promoter sequence obtained by screening was double-enzymatically cut with Kpn I and Sal I, and the target fragment was recovered and ligated with T4 ligase. A δ-ZEIN secretory expression vector containing the GP6 GAP-P mutant promoter sequence and the SP8 signal peptide sequence was constructed.
[0187] Figure 9 Construction map of δ-ZEIN secretory expression vector.
[0188] 3.2.2 Identification of recombinant yeast strain for secretion expression
[0189] After the recombinant yeast strain for secretion expression was amplified and cultured, the yeast genome was extracted, and PCR identification and sequencing identification were performed using the secretion expression vector identification primer GS1 / GS2 and the yeast genome as a template. The results showed that the size of GP6-SP8-δ-zein was about 2000 bp, which was consistent with the size of the designed fragment.
[0190] Figure 10 Figure 2 is a PCR identification diagram of the secretion expression vector recombinant yeast genome; wherein, M: DL2000 marker; 1: negative control water PCR product; 2: GP6-SP8-α-MFpro-δ-zein gene.
[0191] 3.2.3 Methionine determination results
[0192] The δ-ZEIN engineering bacteria containing the wild-type GAP-P promoter were used as a control group, and the δ-ZEIN secretion expression engineering bacteria containing the GP6 GAP-P mutant promoter sequence and the SP8 signal peptide sequence after optimization were used as a test group. The LC-MS determination results of methionine showed (Table 13) that the methionine content of the test group was increased by 8.85 μg / mL, which was 21.09% higher than that of the control group.
[0193] Table 13: Methionine content determination results (μg / mL, %)
[0194]
[0195] Based on the optimal promoter and signal peptide screened in the present application, the engineering bacteria for secretion expression of δ-ZEIN were constructed. The optimization of the promoter and the signal peptide effectively improved the secretion expression of 21.09% methionine in Candida utilis.
[0196] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.
Claims
1. A GAP-P mutated promoter GP6 and a homologous signal peptide SP8 in improving the yield of methionine in Candida utilis; the nucleotide sequence of the GP6 is shown in SEQ ID NO. 1, and the nucleotide sequence of the SP8 is shown in SEQ ID NO.
2. 2.A gene expression cassette for improving the yield of methionine in Candida utilis, the gene expression cassette comprising a GAP-P mutated promoter GP6, a homologous signal peptide SP8 and a nucleotide sequence of a zein gene; the nucleotide sequence of the GP6 is shown in SEQ ID NO. 1, the nucleotide sequence of the SP8 is shown in SEQ ID NO. 2, and the nucleotide sequence of the zein gene is shown in SEQ ID NO.
3.
3. The gene expression cassette of claim 2, wherein, The gene expression cassette further comprises a pro region of an exogenous signal peptide a-MF, and the nucleotide sequence of the pro region of the exogenous signal peptide a-MF is shown in SEQ ID NO.
4.
4. The gene expression cassette of claim 3, wherein, The nucleotide sequence of the gene expression cassette is shown in SEQ ID NO.
5. 5.An expression vector comprising the gene expression cassette according to any one of claims 2-4.
6. The method for constructing an expression vector according to claim 5, wherein, The gene expression cassette according to any one of claims 2-4 is constructed on a base plasmid to obtain an expression vector. 7.A genetically engineered bacterium comprising the expression vector according to claim 5 or the expression vector obtained by the construction method according to claim 6. 8.The genetically engineered bacterium of claim 7, characterized in that, The base bacterium of the genetically engineered bacterium comprises Candida utilis. 9.The gene expression cassette according to any one of claims 2-4, the expression vector according to claim 5, the expression vector obtained by the construction method according to claim 6, or the genetically engineered bacterium according to claim 7 or 8 is used for improving the yield of methionine or as a feed additive.
10. A method for increasing the production of methionine, characterized by, The genetically engineered bacterium according to claim 7 or 8 is cultured in a culture medium.
Citation Information
Patent Citations
Episomal expression vectors for Candida utilis, and construction method and application thereof
CN107630029A
Homologous integration expression vector of candida utilis, engineering bacterium, construction method and application
CN111607530A