Mesenchymal stem cells capable of achieving tumor targeting enhancement and virus mass production

By genetically modifying mesenchymal stem cells and introducing the GRP78 and E1B55K genes, the timing of viral production and release is controlled, solving the problem of low efficiency in viral vector delivery to tumors and achieving highly efficient tumor-targeted viral delivery and therapeutic effects.

CN116261591BActive Publication Date: 2025-12-09デイツバイオカンパニーリミテッド
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202180046632.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-10-27
Filing Date
2021-10-27
Publication Date
2025-12-09
Estimated Expiration
2041-10-27

AI Technical Summary

Technical Problem

In existing technologies, viral vectors have low delivery efficiency to tumors, are destroyed by circulating antiviral antibodies, are non-specifically adsorbed into non-tumor tissues, and have a low rate of viral outflow from blood vessels to tumor sites, resulting in poor cancer treatment outcomes.

Method used

By genetically modifying mesenchymal stem cells and introducing the glucose regulatory protein 78 (GRP78) gene and the E1B55K gene, the production and release time of the virus can be controlled, thereby improving tumor targeting and enhancing the tumor delivery capability of the viral vector.

Benefits of technology

It significantly improved the viral migration rate to tumors and the adenovirus replication rate, enhanced tumor targeting, achieved efficient viral delivery and tumor treatment effects, and reduced side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116261591B_ABST
    Figure CN116261591B_ABST
Patent Text Reader

Abstract

The present application relates to the preparation of mesenchymal stem cells for the proliferation of viral vectors and viruses, and the ability to control the production and release time of viruses, thereby improving tumor targeting and mass-producing viruses. In addition, the tumor occurrence of the mesenchymal stem cells of the present application can be fundamentally blocked, safety can be ensured by controlling the production and release of viruses at the desired time point, and the anti-tumor effect can be maximized.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the preparation of mesenchymal stem cells for the proliferation of viral vectors and viruses, and the ability to control the production and release time of viruses, thereby improving tumor targeting and mass-producing viruses. BACKGROUND

[0002] It is reported that, in the case of vesicular stomatitis virus, the ratio of reaching the tumor within 24 hours is 0.01% compared to the virus administered intravenously (input virus) (non-patent document 1), and the biggest limitation is that the efficiency of delivery to the target is very low during intravenous injection of the virus.

[0003] Since most of the deaths of cancer patients are caused by metastatic tumors, it is crucial to have a tendency to tumors and a sufficient amount of tumor-killing (oncolytic) viruses to be delivered to the tumor in terms of administered viruses.

[0004] However, when injected intravascularly, most of the viruses are absorbed by Kupffer cells in the liver, are rapidly cleared by mechanical deposition, are easily destroyed by intravascular virus-neutralizing antibodies and complement, and in addition, there is a problem that the proportion of intravascular viruses released at the tumor site is quite low. In particular, due to these problems, it is not expected that the introduction of adenovirus alone by intravenous injection is effective.

[0005] Solutions to the above problems include genetic modification of viruses, introduction of nanotechnology, use of mesenchymal stem cells having a tendency to tumor sites, etc. In particular, around 2010, oncotropic cells such as mesenchymal stem cells have been studied [non-patent document 2]. However, although mesenchymal stem cells (MSCs) have many advantages in terms of ethics and technical convenience, low immunogenicity, and genetic stability, the problem of reduced adenovirus infection rate and replication rate of MSCs has emerged.

[0006] In order to be a vector and an amplifier of oncolytic adenovirus, it is necessary to maintain infection and replication of MSCs at a certain level or higher, and in order to solve these problems, the present inventors prepared genetically modified MSCs to obtain a patent registration in Korea [patent document 2]. However, it was confirmed that the passage extension is not easy for these MSCs, and the state of the cell line deteriorates as the number of passages increases.

[0007] In addition, non-patent document 3 confirmed that intravascular delivery of MSCs for delivery of oncolytic viruses can be used to treat various brain tumors, but there are problems such as tumor growth potential of MSCs.

[0008] Meanwhile, a technique has been reported that constructs a platform that temporarily releases viruses whose production has been increased at a desired time point after the viruses have migrated to a tumor [Non-Patent Literature 4]. When MSCs are used as viral vectors, the vector cells (MSCs) loaded with genes that induce cell death are rapidly lysed to release viruses before reaching the tumor site, and thus this technique raises various problems, particularly safety problems, etc., that can be caused by virus release.

[0009] Therefore, in fact, most cancer deaths are caused by recurrence and metastasis, and thus a technique that can overcome the major obstacle that has not been solved in the treatment of tumors with oncolytic viruses is required.

[0010] [Related Art Documents]

[0011] [Patent Documents]

[0012] (Patent Document 1) Korean Patent No. 10-2169798 (October 26, 2020)

[0013] [Non-Patent Documents]

[0014] (Non-Patent Document 1) Silva, N et al., Double trouble for tumors: Exploiting the tumor microenvironment to enhance anticancer effect of oncolytic viruses, Cytokine & Growth Factor Reviews 21: 135, 2010

[0015] (Non-Patent Document 2) Xia, X et al, Mesenchymal stem cells as carriers and amplifiers in CRAd delivery to tumors, Molecular Cancer 10: 134, 2011

[0016] (Non-Patent Document 3) Kerrigan BCP, Shimizu Y, Andreeff M, Lang FF. Mesenchymal stromal cells for the delivery of oncolytic viruses in gliomas. Cytotherapy 2017; 19: 445-457

[0017] (NON-PATENT DOCUMENT 4) Nakashima H, Kaur B, Chiocca EA. Directing systemic oncolytic viral delivery to tumors via carrier cells. Cytokine Growth Factor Rev 2010; 21: 119-126 SUMMARY

[0018] PROBLEMS TO BE SOLVED BY THE INVENTION

[0019] Accordingly, the present inventors have conducted research and endeavored to solve the above problems, and as a result, have developed mesenchymal stem cells capable of controlling the timing of virus production and release, in order to improve the tumor targeting ability of mesenchymal stem cells for virus vectors and virus proliferation, and to mass-produce viruses, thereby completing the present invention.

[0020] Accordingly, it is an object of the present invention to provide mesenchymal stem cells for delivering oncolytic viruses, which have improved tumor targeting ability, into which a glucose-regulated protein 78 (GRP78) gene has been introduced.

[0021] Further, it is another object of the present invention to provide mesenchymal stem cells for delivering oncolytic viruses, into which an E1B55K gene has been introduced, such that expression thereof is induced by an expression inducer.

[0022] Further, it is another object of the present invention to provide mesenchymal stem cells for delivering oncolytic viruses, which include a glucose-regulated protein 78 (GRP78) gene and an E1B55K gene, wherein the E1B55K gene is expressed by an expression inducer.

[0023] Further, it is another object of the present invention to provide a composition for delivering an anticancer gene, which comprises mesenchymal stem cells and oncolytic viruses.

[0024] Further, it is another object of the present invention to provide an anticancer pharmaceutical composition comprising mesenchymal stem cells and oncolytic viruses.

[0025] Further, it is another object of the present invention to provide a composition for diagnosing cancer, which comprises mesenchymal stem cells and oncolytic viruses.

[0026] Further, it is another object of the present invention to provide a method of treating cancer, the method comprising: administering to a subject a therapeutically effective amount of a pharmaceutical composition comprising mesenchymal stem cells and oncolytic viruses.

[0027] TECHNICAL SOLUTION

[0028] The three main difficulties of a tumor treatment method caused by viruses alone are as follows.

[0029] First, the destruction of the oncolytic adenovirus by circulating antiviral antibodies, second, the non-specific adsorption of other non-tumor tissues such as the liver and spleen, and third, the outflow of the virus from the blood vessels to the tumor site rarely occurs.

[0030] To overcome these fundamental problems of viral therapy, mesenchymal stem cells are used as a cell carrier to facilitate systemic blood transport of the oncolytic virus, and in addition to the viral delivery, a genetically modified mesenchymal stem cell line (MSC) is developed for effective anti-tumor effect caused by a large amount of virus produced during migration to the target tumor site.

[0031] The present application relates to the preparation of mesenchymal stem cells for the proliferation of viral vectors and viruses, and the ability to control the production and release time of the virus, so that tumor targeting can be improved and viruses can be mass-produced.

[0032]

Advantages

[0033] Since most of the deaths of cancer patients are due to metastatic tumors, the migration of the administered virus to the tumor and the reduction of the existing adenovirus replication rate in MSCs are significantly improved, so that a sufficient amount of oncolytic virus can be delivered to the tumor, and at the same time, MSCs with improved tumor targeting are developed.

[0034] Using MSCs as a virus production factory, the MSCs according to the present application can achieve innovative improvements in stability and anticancer efficacy, while minimizing side effects caused by a significant increase in tumor targeting and a significant increase in infectious virus particles / virus particles (IVP / VP) with efficiency comparable to existing virus production cell lines. That is, by solving the most difficult problems of virus-based anticancer drugs, such as tumor occurrence, tumor tropism, tumor migration ability, and control of virus production / release at the appropriate time point, the efficacy maximization and toxicity minimization of MSCs loaded with oncolytic viruses can be achieved at the same time. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 It is shown that TERT expression of human adipose MSC-TERT is confirmed by Western blotting.

[0036] Figure 2 It is shown that the passage extension of human adipose MSC-TERT is effective even at passage 30, confirmed by Western blotting.

[0037] Figure 3 It is shown that the adenovirus infection ability of human adipose MSC-TERT is confirmed by fluorescence microscopy.

[0038] Figure 4p53 accumulation and reduction of survival-related signals upon induction of E1B55K expression in human bone marrow and adipose mesenchymal stem cells, as demonstrated by Western blot.

[0039] Figure 5 Increase of p53 promoter activity by E1B55K in the presence of doxycycline, as demonstrated by luminescence intensity, by Tet-One inducible expression system.

[0040] Figure 6 Reduction of E1B55K increase of p53 promoter activity by E4orf6, as demonstrated by luminescence intensity.

[0041] Figure 7 E4orf6 gene in adenoviral backbone dl324-BstBI was amplified by PCR, transferred to pFlag-CMV2 vector and sequenced to confirm 100% match.

[0042] Figure 8 E1B55K gene insertion into adenoviral shuttle vector pCA14, as demonstrated by DNA electrophoresis.

[0043] Figure 9 demonstrates confirmation of E1B55K gene sequence for pCA14-E1B55K.

[0044] Figure 10A demonstrates that E1B55K detection by polyclonal antibody against E1B55K is normal.

[0045] Figure 10B demonstrates that normal expression was achieved as demonstrated by detection of replication-incompetent virus expressing purified E1B55K by MOI.

[0046] Figure 11 Virus titration demonstrated that MSC-TERT transfection with plasmid expressing E1B55K and increase of virus yield during oncolytic adenovirus infection.

[0047] Figure 12 Virus titration demonstrated that MSC-TERT infection with replication-deficient virus expressing purified E1B55K and increase of virus yield during additional infection with oncolytic adenovirus, as demonstrated by increase of MOI for each MOI.

[0048] Figure 13 Protocol for Tet-One inducible expression system is explained.

[0049] Figure 14 PCR conditions during construction of pRetro-x-tetone-puro-E1B55K are explained.

[0050] Figure 15 shows confirmation of the construction of the plasmid, in which E1B55K was correctly inserted into pRetro-x-Tetone by the fusion method of exogenous gene transfer.

[0051] Figure 16 is a cleavage map of the pRetro-x-Tetone-puro-E1B55K vector used for construction.

[0052] Figure 17 shows confirmation of the final introduction by sequence analysis of the E1B55K plasmid inserted into pRetro-x-Tetone.

[0053] Figure 18 shows confirmation of whether E1B55K, the gene inserted into pRetro-x-Tetone, is expressed as a protein by doxycycline induction.

[0054] Figure 19 shows protein expression of E1B55K in pRetro-x-tetone-puro-E1B55K according to the amount of doxycycline during treatment with doxycycline.

[0055] Figure 20 compares virus yield with and without doxycycline treatment after infection with oncolytic adenovirus after transfection of human adipose MSC-TERT with pRetro-Tetone-E1B55K.

[0056] Figure 21 shows the results of Western blotting in which the MSC-TERT-tetone E1B55K cell line was established from MSC-TERT.

[0057] Figure 22 shows the results of p53 accumulation from the MSC-TERT-tetone E1B55K cell line confirmed by Western blotting in the presence of doxycycline (2.5 μg / ml).

[0058] Figure 23 confirms the possibility of eliminating tumorigenicity of the MSC-TERT-tetone E1B55K cell line.

[0059] Figure 24A confirms that the expression of all factors acting at each stage of MSC homing increases with increasing GRP78.

[0060] Figure 24B shows confirmation of the increase in GRP78 mRNA expression by introducing pcDNA3.1-GRP78 into human MSC-TERT to confirm that the expression of GRP78 is secured.

[0061] Figure 25Results of confirming whether the GRP78 gene was inserted into the pcDNA3.1-hygro vector [C: pcDNA3.1-hygro] are shown.

[0062] Figure 26 Results of transfecting a hepatoma cell line with a plasmid obtained from the pcDNA3.1-GRP78 clone, and then confirming an increase in GRP78 protein expression by Western blotting to confirm gene introduction are shown.

[0063] Fig. 27 shows results of analysis of the base sequence of the GRP78 gene introduced from the plasmid obtained from the pcDNA3.1-GRP78 clone.

[0064] Figure 28 A cleavage map of the LNCXneo vector in which a restriction enzyme recognition site was added to the LNCX vector is illustrated.

[0065] Figure 29 Results of screening of plasmid clones in which the GRP78 gene was inserted into LNCXneo by restriction enzyme digestion are shown.

[0066] Figure 30 Results of screening of clones expressing GRP78 by introducing a retrovirus expressing the GRP78 gene into the MSC-TERT cell line are shown.

[0067] Figure 31 Results of clearly confirming that the MSC-TERT-GRP78 reached site accumulated in the tumor tissue site in a very short time without adsorbing to other organs are shown.

[0068] Fig. 32 shows results of tumor targeting verification (rapid and accurate targeting of tumors) of the final type MSC-TERT-tetoneE1B55K-GRP78 confirming that its gene transfer was completed in lung cancer (a), liver cancer (b), and pancreatic cancer (c) cell lines.

[0069] Figure 33 Results of enhanced intratumoral infiltration of the final type MSC-TERT-tetoneE1B55K-GRP78 at 24 hours (a), 48 hours (b), and 72 hours (c) after injection are shown.

[0070] Figure 34 Expression of adenovirus-associated proteins in tumor tissue in the presence of doxycycline when the final type MSC-TERT-tetoneE1B55K-GRP78 was infected with an oncolytic virus is shown.

[0071] Figure 35Results showing the establishment of final type MSC-TERT-tetone E1B55K-GRP78 cell lines clone 21, 24, 25 and 26 cell lines are shown.

[0072] Figure 36 Results confirming that E1B55K induced by doxycycline in the final clone 21 is effectively and sufficiently induced without leakage even at very low concentrations are shown.

[0073] Figure 37 Viral amounts produced when the final type MSC-TERT-tetone E1B55K-GRP78 is infected with an oncolytic virus according to the presence of doxycycline or during the expression of E4orf6 are shown.

[0074] Figure 38 Results confirming the expression of tumor homing markers according to the increase in the passage of MSC-TERT are shown.

[0075] Figure 39 The anti-tumor effect of MSC-TERT-tetone E1B55K-GRP78 infected with an oncolytic adenovirus is shown by confirming the change in the size of mouse tumors through pictures.

[0076] Fig. 40A confirms the anti-tumor effect of MSC-TERT-tetone E1B55K-GRP78 infected with an oncolytic adenovirus by the change in the size of mouse tumors after removing the mouse tumors.

[0077] Fig. 40B shows the anti-tumor effect of MSC-TERT-tetone E1B55K-GRP78 infected with an oncolytic adenovirus by confirming the change in the size of mouse tumors by taking pictures of the mice.

[0078] Fig. 41 shows the virus adsorption rate of tumors (A) and other organs [liver (B), lung (C), spleen (D), kidney (E) and heart (F)]. DETAILED DESCRIPTION

[0079] Hereinafter, the present application will be described in more detail.

[0080] The present application includes mesenchymal stem cells for delivering an oncolytic virus, in which a human glucose-regulated protein 78 (GRP78) gene (GenBank NM_005347) is introduced.

[0081] Further, the present application provides mesenchymal stem cells having improved tumor targeting ability for delivering an oncolytic virus by introducing a GRP78 gene into mesenchymal stem cells used as a viral vector.

[0082] The GRP78 gene is a glucose-regulated protein 78 gene, the effect of which is known to increase cell infiltration by increasing cell motility, and its gene sequence is shown in GenBank NM_005347 SEQ NO: 1 (human). In the present application, a tumor homing marker is used to improve tumor targeting ability.

[0083] [SEQ ID NO: 1]

[0084]

[0085]

[0086] In the present application, it is confirmed that the GRP78 gene improves tumor tropism, and in particular, a virus is delivered to a tumor tissue site without being adsorbed to organs other than tumors.

[0087] Although it is difficult to perform passaging in order to facilitate introduction of this specific gene in the case of human mesenchymal stem cells, a telomerase reverse transcriptase (TERT) gene that induces cell proliferation can be additionally introduced to overcome this difficulty.

[0088] The TERT gene is a telomerase reverse transcriptase gene, and its gene sequence is shown in GenBank NM_198253, SEQ ID NO: 2 (human).

[0089] [SEQ ID NO: 2]

[0090]

[0091]

[0092] In the present application, an MSC-TERT-GRP78 cell line is established, and it is confirmed that tumor targeting of mesenchymal stem cells for a viral vector and viral proliferation is improved. Accordingly, mesenchymal stem cells can be used for tumor diagnosis and treatment.

[0093] In addition, the present application provides mesenchymal stem cells for delivery of an oncolytic virus, in which an E1B55K gene is introduced such that expression thereof is induced by an expression inducer.

[0094] The E1B55K gene is a viral gene encoding an E1B55K protein, which is expressed in an early stage of adenovirus life. Its gene sequence is shown in GenBank AC_000008, SEQ ID NO: 3 (the underlined a in the first line is originally g, but a Kpnl site is replaced. The underlined t in the 14th line is originally replaced with a to remove a HindIII site).

[0095] [SEQ ID NO: 3]

[0096]

[0097] The present inventors established a human MSC-CAR-E1B55K cell line from a previously submitted bone marrow-derived human MSC (Patent Literature 1), and confirmed an increase in virus production, but confirmed that passage extension is not easy and the condition of the cell line deteriorates as the number of passages increases, and confirmed that for this reason animal experiments and master cell banks are not possible, and a large amount of time was spent to find the cause. In particular, a new function of E1B55K was confirmed. This is the fact that E1B55K not only induces an increase in virus proliferation, but also simultaneously causes a decrease in cell line viability.

[0098] The increase in tumor occurrence potential of the TERT gene, which is inevitably introduced for mass production of MSC cell lines, was able to provide a solution for the first time by determining that E1B55K not only induces an increase in virus replication, but also causes a decrease in MSC cell viability as a whole. That is, the time difference in the expression timing point of the E1B55K gene induces the extension of the passage of MSCs, thereby enabling mass production through a cell bank, and at the same time, fundamentally blocks the tumor occurrence of MSCs.

[0099] In the examples, the Tet-on system is applied to induce the expression timing point of the E1B55K gene with a time difference, i.e., to allow expression after mesenchymal stem cells are introduced into the body, but any other time difference induction system is also possible. In addition, the expression inducer is preferably doxycycline, tetracycline, or the like.

[0100] In the present invention, an MSC-TERT-tetoneE1B55K cell line is established, and E1B55K is expressed (oncolytic) at a desired timing point by a time difference to fundamentally block mass production of viruses and tumor occurrence of MSCs.

[0101] In addition, the present invention includes a mesenchymal stem cell for delivering an oncolytic virus, which includes a glucose-regulated protein 78 (GRP78) gene and an E1B55K gene, wherein the E1B55K gene is expressed by an expression inducer.

[0102] In the present invention, an MSC-TERT-tetoneE1B55K-GRP78 cell line is established, and it is confirmed that the production and release timing of viruses can be controlled, so that tumor targeting can be improved and viruses can be mass-produced.

[0103] The mesenchymal stem cell line for the present invention is preferably of human origin. The mesenchymal stem cell line is preferably derived from bone marrow, umbilical cord blood, or fat.

[0104] The oncolytic virus used in the present application can be an oncolytic adenovirus, an oncolytic adenovirus-associated virus (AAV), an oncolytic retrovirus, an oncolytic lentivirus, an oncolytic herpes simplex virus, or an oncolytic vaccinia virus.

[0105] Further, the oncolytic adenovirus can be an oncolytic adenovirus described in Korean Patent Application No. 2016-0166171 developed by the present inventors.

[0106] The present application also includes a composition for delivering an anticancer gene, which includes mesenchymal stem cells for delivering an oncolytic virus and the oncolytic virus.

[0107] The composition for delivering a gene of the present application can be used for systemic administration.

[0108] The stem cell loaded with the virus of the present application (Ad-MSC) has a low or no immune response in addition to the cancer-specific characteristics, and thus can be administered systemically and is highly targeted to tumor cells, has an effect of not inducing toxicity, and thus can significantly improve gene delivery efficiency.

[0109] The mesenchymal stem cells can be isolated from bone marrow, umbilical cord blood, fat, etc., and allogeneic mesenchymal stem cells can be used using the patient's own or a blood bank database. Thus, when the stem cell loaded with adenovirus of the present application is used as a gene carrier, both autologous and allogeneic treatments are possible, and thus the unit cost of gene therapy can be further reduced.

[0110] The method of introducing the adenovirus containing the gene of the present application into the mesenchymal stem cell can be performed by various methods known in the art. Specifically, the gene can be introduced by a virus infection method known in the art.

[0111] As used herein, the term "anticancer pharmaceutical composition" means "a pharmaceutical composition for treating cancer."

[0112] Since the mesenchymal stem cells contained as an active ingredient in the anticancer pharmaceutical composition of the present application are the same as the above-described mesenchymal stem cells of the present application, the detailed description of the mesenchymal stem cells is equally applicable to the composition of the present application. Therefore, the description of common matters is omitted to avoid undue complication due to unnecessary repetitive description of the specification.

[0113] Since the oncolytic adenovirus included in the composition of the present application exhibits killing efficacy against various tumor cells as described above, the pharmaceutical composition of the present application can be used to treat cancer, for example, gastric cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, biliary tract cancer, bladder cancer, colorectal cancer, colon cancer, cervical cancer, brain cancer, prostate cancer, bone cancer, head and neck cancer, skin cancer, kidney cancer, polyploid cancer, thyroid cancer, parathyroid cancer, or ureter cancer. As used herein, the term "treatment" includes: (i) preventing tumor cell formation; (ii) inhibiting a tumor-related disease or disorder after removal of tumor cells; and (iii) relieving a tumor-related disease or disorder after removal of tumor cells. Accordingly, as used herein, the term "therapeutically effective amount" refers to an amount sufficient to achieve the pharmacological effects described above.

[0114] The pharmaceutically acceptable carrier included in the composition of the present application is a pharmaceutically acceptable carrier commonly used in formulation, including lactose, glucose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, sugar syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, etc., but is not limited thereto.

[0115] In addition to the above ingredients, the pharmaceutical composition of the present application can further include a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, etc.

[0116] The pharmaceutical composition of the present application is preferably administered parenterally, and can be administered, for example, using intravenous administration, intraperitoneal administration, intramuscular administration, subcutaneous administration, or topical administration. The pharmaceutical composition of the present application is administered intraperitoneally by an injection method to treat ovarian cancer, and is administered through the hepatic portal vein to treat liver cancer; in the case of liver cancer, melanoma, and breast cancer, the pharmaceutical composition can be administered by direct injection into a tumor mass, in the case of colon cancer, the pharmaceutical composition can be administered by direct injection into an enema, and in the case of bladder cancer, the pharmaceutical composition can be administered by direct injection into a catheter.

[0117] The appropriate administration amount of the pharmaceutical composition of the present application can vary depending on various factors, for example, the formulation method, the administration method, the age, the body weight, the gender or the disease condition of the patient, the diet, the administration time, the administration route, the excretion rate, and the reaction sensitivity, and a physician with ordinary skill can easily determine and employ an effective dose for the desired treatment. Generally, the pharmaceutical composition of the present application contains 1 x 10 5 to 1 x 10 15 pfu / ml of oncolytic virus, and generally, the virus amount for infecting MSCs (counted as 1 x 10 6 cells) at a time is 1 x 10 7 to 1 x 108 pfu.

[0118] The pharmaceutical composition of the present application can be prepared in the form of a unit dose, or formulated by using a pharmaceutically acceptable carrier and / or excipient according to a method easily performed by one of ordinary skill in the art to which the present application pertains, so as to be contained in a multiple dose container. In this case, the formulation can also be in the form of a solution, a suspension in an oil or aqueous medium, or an emulsion, an extract, a powder, a granule, a tablet, or a capsule, and the pharmaceutical composition of the present application can additionally contain a dispersant or a stabilizer.

[0119] The pharmaceutical composition of the present application can be used as a monotherapy, but can also be used in combination with a chemotherapeutic agent or a radiotherapeutic agent of an ordinary type, and when such a combination therapy is performed, cancer can be more effectively treated. The chemotherapeutic agent that can be used together with the composition of the present application includes gemcitabine, sorafenib, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosoureas, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide, tamoxifen, paclitaxel, transplatinum, 5-fluorouracil, vincristine, vinblastine, methotrexate, etc. The radiotherapy that can be used together with the composition of the present application includes X-ray radiation, γ-ray radiation, etc.

[0120] The mesenchymal stem cell according to the present application can exhibit an anticancer effect on gastric cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, biliary tract cancer, bladder cancer, colorectal cancer, colon cancer, cervical cancer, brain cancer, prostate cancer, bone cancer, head and neck cancer, skin cancer, kidney cancer, polyploid cancer, thyroid cancer, parathyroid cancer, or ureteral cancer.

[0121] In addition, the present application can include a composition for diagnosing cancer, the composition including a virus / stem cell complex including a mesenchymal stem cell and an oncolytic virus.

[0122] As used herein, the term "diagnosis" refers to the confirmation of the presence or characteristics of a pathological state. The diagnosis in the present application is the confirmation of the presence or absence of cancer and its progression.

[0123] The virus / stem cell complex refers to a stem cell infected or loaded with a virus.

[0124] The virus / stem cell complex can be combined with a luminescent material, a fluorophore, or an isotope to diagnose cancer by imaging.

[0125] The luminescent material refers to any material that emits light.

[0126] In an embodiment of the present application, it is confirmed that luminescence is captured as an image by intraperitoneally administering luciferin to a mouse after infecting MSC with an adenovirus expressing luciferase.

[0127] The fluorophore is preferably a phosphor, a fluorescent protein, or other imaging material capable of binding to a peptide specifically binding to NRP1, but is not limited thereto.

[0128] The fluorophore is preferably a fluorescein, a BODYPY, a tetramethylrhodamine, an Alexa, a cyanine, an allo-cyanine, or a derivative thereof, but is not limited thereto.

[0129] The fluorescent protein is preferably a Dronpa protein, a fluorescent protein (EGFP), a red fluorescent protein (DsRFP), Cy5.5 which is a cyanine fluorophore showing near-infrared fluorescence, or other fluorescent proteins, but is not limited thereto. The other imaging material is preferably iron oxide, a radioisotope, etc., but is not limited thereto, and can be applied to imaging devices such as MR and PET.

[0130] The present application also includes a method of treating cancer, the method comprising administering to a subject a therapeutically effective amount of a pharmaceutical composition comprising mesenchymal stem cells and an oncolytic virus.

[0131] All of the above with respect to the method of treating cancer can be applied to the above mesenchymal stem cells of the present application and the composition comprising the same or applied accordingly.

[0132] The cancer can be specifically gastric cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, biliary tract cancer, bladder cancer, colorectal cancer, colon cancer, cervical cancer, brain cancer, prostate cancer, bone cancer, head and neck cancer, skin cancer, kidney cancer, multiple cancer, thyroid cancer, parathyroid cancer, or ureter cancer, but is not limited thereto.

[0133] As used herein, the term "subject" refers to a mammal, preferably a human, who is the object of treatment, observation or experiment.

[0134] As used herein, the term "therapeutically effective amount" refers to the amount of an active ingredient or a pharmaceutical composition that a researcher, veterinarian, medical doctor or other clinician considers in inducing a biological or medical response in an organizational system, an animal or a human, which includes the amount inducing alleviation of symptoms of a disease or a disorder to be treated. It will be obvious to those skilled in the art that the therapeutically effective amount and the frequency of administration of the active ingredient of the present application will vary according to the desired effect. Therefore, the optimal administration dose can be easily determined by those skilled in the art, which varies depending on the type of disease, the severity of the disease, the content of the active ingredient and other ingredients in the composition, the type of preparation, the weight, age, sex, health condition and diet of the patient, the time of administration, the method of administration, the excretion rate, etc. In the therapeutic method of the present application, the amount of the active ingredient administered to a subject is preferably 1 × 105 1 x 10 15 pfu / ml of oncolytic virus, and typically, the amount of virus to infect MSCs (counted as 1 x 10 6 6 x 10 7 8 x 10 8 9 x 10

[0135] In the therapeutic method of the present application, the pharmaceutical composition of the present application can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) according to the desired method.

[0136] [INVENTION MODE]

[0137] Hereinafter, the present application will be described in more detail through examples of the present application, but the scope of the present application is not limited to the examples presented below.

[0138] [EXAMPLES]

[0139] Reference Example 1: Construction of human oncolytic adenovirus YSC-02

[0140] YSC-02 was constructed as described in Preparation Example 19 of Korean Patent Application No. 2016-0166171.

[0141] Reference Example 2: Construction of human oncolytic adenovirus dl324-3484-H1-shHSP27-U6-shTGFβ1

[0142] dl324-3484-H1-shHSP27-U6-shTGFβ1 was constructed as described in Preparation Example 9 of Korean Patent Application No. 2016-0166171.

[0143] Preparation Example 1: Introduction of TERT gene for mass production of MSC cell line

[0144] 1) Confirmation of human fat MSC-TERT monoclonal expression

[0145] The TERT gene was introduced to induce expression of specific genes to overcome the shortage and lifespan problems of MSCs. In the case of human bone marrow mesenchymal stem cells, it is not easy to pass. In order to overcome this problem, a telomerase reverse transcriptase (TERT) gene that induces cell proliferation was inserted, and a clone that highly expresses TERT was selected.

[0146] The method of introducing the TERT gene is as follows.

[0147] The retroviral vector pBABE-hygro-hTERT was purchased from Addgene, and cell clones resistant to 200 μg / ml hygromycin B gold were obtained by infecting human adipose MSCs with filtered medium, which was obtained by transfecting platinum-A packaging cells (Cell Biolabs) with 1 μg of the retroviral vector pBABE-hygro-hTERT, and then... Figure 1 The screening and selection process was carried out as shown in the diagram. Ultimately, MSC clone 22 was selected, and clone 22 was used for human adipose MSC-TERT in subsequent experiments.

[0148] 2) Confirmation of prolongation of generations

[0149] Figure 2 This study confirmed the extended passage of human MSCs, which proliferated to passage 30. It was also demonstrated that, compared to wild-type MSCs, TERT expression levels remained significantly increased in MSCs passaged extensively to passage 30, and the expression of other major MSC-related markers was maintained or increased.

[0150] 3) Confirmation of adenovirus infectivity

[0151] TERT-expressing MSC clones (number 22) were infected with a replication-deficient adenovirus expressing red fluorescent protein (RFP) at 20 MOI and 100 MOI. After 48 hours, the fluorescently stained cells were observed under a fluorescence microscope. The results, compared with wild-type MSCs as a control, confirmed an increased infection rate of human MSC-TERT compared to the control, with an infection rate at least two-fold higher at 20 MOI and reaching 90% or higher at 100 MOI. Figure 3 ).

[0152] Example 1: Confirmation of a novel function of the adenovirus gene E1B55K

[0153] When MSCs are used as a cell line for clinical mass production, it is necessary to construct a master cell bank. For this purpose, it is most important to make it possible to passage the bone marrow mesenchymal stem cells. However, on the other hand, the principle of extending the induction so as not to cause an increase in the tumorigenic potential also needs to be maintained. Although it was initially thought that the challenge of simultaneously satisfying both conditions was impossible, a solution was first proposed in the inventors' laboratory while constructing a stable MSC cell line in which a CAR and an E1B55K gene were introduced into MSCs. A human MSC-CAR-E1B55K cell line was established from a human MSC of bone marrow origin that had been deposited, and an increase in viral yield was confirmed [Patent Literature 1]. However, it was repeatedly confirmed that passaging was not easy, and that the condition of the cell line deteriorated as the number of passages increased. Thus, it was confirmed that in the case of animal experiments, a master cell bank was impossible, and as a result of finding the cause, it was confirmed that E1B55K simultaneously induced an increase in viral proliferation and a decrease in cell line viability Figure 4 ). That is, it was confirmed that not only p53, which is well known as a tumor suppressor gene and a cell growth inhibitor, was apparently accumulated, but also the expression of factors related to cell survival (HSP27, HSP70, Daxx, phospho-p65, NF-κB, c-Me) was decreased by E1B55K.

[0154] The experimental procedure for this was as follows.

[0155] E1B55K was first cloned into pcDNA3.1 hygro(+). In order to extract the E1B55K gene from pBSK-3484 including the E1B55K gene, after PCR (initial denaturation: 95°C for 2 minutes, denaturation: 95°C for 30 seconds, annealing: 58°C for 30 seconds, extension: 72°C for 2 minutes; 30 cycles) and digestion with BamHI / NotI using primers each containing BamHI and NotI (forward, 5'-GCGGATCCATGGAGCGAAGAAACCCATCT-3': SEQ ID NO: 4, reverse, 5'-GAGCGGCCGCTCAATCTGTATCTTCATCGCT-3': SEQ ID NO: 5), the E1B55K gene was introduced into pcDNA3.1 hygro(+) (Invitrogen) previously digested with BamHI / NotI to construct a plasmid.

[0156] By transfecting the plasmid expressing E1B55K into MSCs of bone marrow origin and MSCs of adipose tissue origin, it was confirmed that a cell line that expressed E1B55K for a long time decreased the viability of the cell line. That is, accumulation of p53 and reduction of various survival-related signals were observed.

[0157] To confirm how the expression of E1B55K causes accumulation of p53, reduction of cell survival signal, and induction of cell death, the following hypothesis was made. That is, it is known that E1B55K maintains cell survival only through a complex with E4orf6 protein, through p53 degradation known in the relevant field. Therefore, a hypothesis was made in which when the expression of E1B55K alone is induced in MSC cells, due to the quantitative comparative advantage of E1B55K over E4orf6, the free E1B55K alone (stoichiometry) acts as a transcriptional activator that promotes p53 transcription to reduce cell viability, and experiments were performed as follows.

[0158] After co-transfecting the MSC-TERT-tetone E1B55K cell line with 1 μg of pFlag-CMV2-E4orf6, the pFlag-CMV2-E4orf6 was subcloned with the constructed pGL2-p53 promoter (pGL2-356bp, Addgene) such that the constant part of the p53 promoter (-344 to +12) was located in front of the site where the luciferase-encoding gene was inserted, and 1 μg of pFlag-CMV2 (Sigma) as a control, the luciferase activity with and without doxycycline (1.25 μg / ml for 48 hours) was confirmed by luminescence intensity.

[0159] The analysis method used in this case was the Dual Luciferase Reporter Assay System from Promega (Catalog #E1910, Figure 5 ).

[0160] E1B55K, the expression of which was induced in the MSC-TERT-tetone E1B55K cell line by doxycycline treatment, directly or indirectly binds to the p53 promoter to activate transcription, resulting in a 4-fold increase in luminescence intensity due to luciferase activity ( Figure 5 ). In contrast, it was confirmed that when the expression of E4orf6 occurs in MSCs expressing E1B55K, the increase in luminescence intensity does not exceed 1.5-fold. These results indicate that E4orf6 interferes with the action of E1B55K alone due to the formation of a complex with E1B55K, while more actively exercising its known role in promoting the degradation of p53 protein ( Figure 6 ).

[0161] Herein, subcloning of the E4orf6 (GenBank AC_000008; also called E434K) gene was performed to transfer the E4orf6 gene from the adenovirus backbone dl324-BstBI to the pFlag-CMV2 vector. To this end, PCR primers for E4orf6 (forward 5'-GTACAAGCTTATGACTAC GTCCGGCGTTCC-3' including HindIII: SEQ ID NO: 6 and reverse 5'-CACCTCTAGACTACA TGGGGGTAGAGTCAT-3' including XbaI: SEQ ID NO: 7) were used to PCR-amplify the E4orf6-encoding gene site in dl324-BstBI (initial denaturation: 95°C for 2 minutes, denaturation: 95°C for 30 seconds, annealing: 58°C for 30 seconds, extension: 72°C for 1 minute 30 seconds; 30 cycles), followed by double digestion with HindIII / XbaI, and ligation to pFlag-CMV2 digested with HindIII and XbaI. Confirmation of 100% match by sequencing using CMV30 (one of the universal primers from Cosmogenetech Co. Ltd.) was performed to confirm that subcloning was performed correctly. Figure 7

[0162] From the above experimental results, it was seen that overexpression of E1B55K directly or indirectly acts on the p53 promoter, which is contrary to the main role of E1B55K in wild-type adenovirus (formation of a complex with E4orf6 to induce degradation of the p53 protein), thus a new role of inducing accumulation of p53 was discovered through transcription induction. In addition, in order to confirm how the increase in MSC cell death and the decrease in the viability signal depending on the increase in E1B55K expression affect the virus production ability in MSCs, it was intended to again confirm whether the virus production ability in MSCs is increased by externally supplying E1B55K using an adenovirus vector. To this end, a replication-defective adenovirus expressing E1B55K was constructed as follows.

[0163] 1) Construction of replication-defective adenovirus expressing E1B55K (pCA14-E1B55K)

[0164] ​The E1B55K gene was cloned into the adenovirus shuttle vector pCA14. E1B55K was contained in pBSK-3484, constructed and amplified by PCR (initial denaturation: 95°C for 2 minutes, denaturation: 95°C for 30 seconds, annealing: 58°C for 30 seconds, extension: 72°C for 2 minutes; 30 cycles) with primers containing Xbal and Hindlll at both ends (forward 5'-TTCATCTAGAATGGAGCGAAGAAACCCATC-3'(Xbal): SEQ ID NO: 9, reverse 5'-GACGAAGCTTTCAATCTGTATCTTCATCGC-3'(Hindlll): SEQ ID NO: 10) and ligated into pCA14 (Microbix, Canada) previously digested with Xbal / Hindlll. As a result, it was confirmed that all E1B55K PCR fragments were inserted into pCA14 (Figure 9). Figure 8 The confirmed adenovirus shuttle vector pCA14-E1B55K was linearized again with Xmnl after sequence confirmation (Figure 9), and adenovirus vector dl324-BstBI was linearized with Bsp119I, both of which were co-transformed into E. coli BJ5183 to induce homologous recombination to construct an adenovirus vector expressing E1B55K, and then the vector was transfected into 293A, and then virus production was induced for scale-up production, and after isolation and purification, the titer was calculated.

[0165] 1, 2, and 3 in plasmid clones 1, 2, 3, and 4 of pCA14-E1B55K matched with primers specific for pCA14 sequence analysis (forward (hCMV): 5'-GGGAGGTCTATATAAGCAGAGCTCG-3': SEQ ID NO: 11, reverse (pCA14 SV40): 5'-CATGATCGATGCTAGACGATCCAGA-3': SEQ ID NO: 12) in both forward and reverse directions, and in this regard, Figure 9 shows the results of sequence analysis of sample #3 clone plasmid DNA. In two (red) sequences shown in Figure 9 that do not match in the forward direction, the first base a of E1B55K of the existing wild-type adenovirus type 5 is the 2019th base of AC_000008 in GenBank, and the 2048th base g is intentionally replaced with a in the forward primer to remove the Kpnl site (GGTACC→AGTACC), and the 2084th base a is replaced with t in the forward primer (overlapping with the reverse primer in red) to intentionally remove the Hindlll site (AAGCTT→TAGCTT) (100% homologous).

[0166] 2) Confirmation of expression of E1B55K in MSC lysates infected with viruses expressing E1B55K

[0167] After confirming that the polyclonal antibody obtained by commissioning the construction of a specific antibody against E1B55K for confirming E1B55K expression did not detect E1B55K abnormally (FIG. 10A), and as a result of detecting the virus produced and purified at each MOI, normal expression was confirmed by Western blotting (FIG. 10B). The graph on the right side of FIG. 10A is attached as raw data of the left graph in order to confirm the correct size and band of the polyclonal antibody E1B55K. In lane 3 of FIG. 10A, 3 μg of adenovirus vector (dl324-E1B55K) DNA expressing E1B55K was digested with PacI, then transfected into 293A, after confirming virus production, human fat cell-derived MSC-TERT was infected with the harvested suspension, in lane 4, the final suspension was infected by freezing and thawing the suspension, and cells obtained in the same manner as lane 3 were added, in lane 5, the starting amount of DNA during the first transfection was 2.5 μg. In FIG. 10B, it was confirmed that the polyclonal antibody against E1B55K was working normally by confirming that the virus suspension obtained under condition 5 was amplified and purified, and when MSC-TERT was infected with a replication-defective virus expressing E1B55K, the band intensity corresponding to E1B55K also increased with increasing MOI by calculating the virus infectious particles.

[0168] The process of constructing a polyclonal antibody specific to E1B55K is as follows.

[0169] First, the peptide sequence located at the N-terminal site of E1B55K

[0170] (MERRNPSERGVPAGFSGHASVESGC: SEQ ID NO: 13) was synthesized, bovine serum albumin (BSA) was conjugated to the immunogen carrier, then New Zealand white rabbits were immunized and the serum was purified to obtain a polyclonal antibody (GW Vitek, Korea).

[0171] 3) Comparison of virus production according to the expression level of E1B55K in human fat MSC-TERT → verification of the innovative extension of the virus production capacity of MSC according to gene transfer

[0172] First, human fat cell-derived MSC-TERT was transfected with 1 μg of a plasmid expressing E1B55K (pcDNA3.1-E1B55K) Figure 11 ), or infected with a replication-defective adenovirus expressing E1B55K at each MOI Figure 12), then the medium was changed after 4 hours. After infection with oncolytic adenovirus (YSC-02) at 100 MOI, all the medium and cells were harvested after 48 hours, then frozen and thawed to excite as much virus as possible, then the results of the titration of infectious virus in the supernatant obtained by centrifugation were shown. As a result, it was confirmed that the virus yield was significantly increased compared to the control after infecting MSC-TERT expressing E1B55K with oncolytic adenovirus Figure 12

[0173] Example 2: By introducing the E1B55K time difference expression modulation system, innovative virus yield increase induction, expression time point modulation of the loaded gene, and intrinsic tumorigenesis control technology can be simultaneously achieved

[0174] The enhancement of the control of the tumorigenic potential of the TERT gene, which is inevitably introduced for mass production of MSC cell lines, can provide a solution for the first time by determining that E1B55K not only induces an increase in virus replication, but also induces a general decrease in MSC cell survival. That is, a control technology was developed in which the time difference in the expression time point of the E1B55K gene induces the extension of the passage of MSCs, thereby enabling mass production through a cell bank, while fundamentally blocking tumorigenesis of MSCs. It is significant that this provides an innovative turning point for a virus / MSC therapeutic agent.

[0175] Figure 13 The protocol in Example 1 refers to Retro-X TM Tet-One TM Inducible expression system (TAKARA catalog number 634307).

[0176] 1) Construction of pRetro-X-Tet-one-puro-E1B55K

[0177] In order to insert the E1B55K gene into the Retro-X-Tet-one-puro vector plasmid, it is necessary to have EcoRI and BamHI recognition sites at both ends, respectively. pCA14-E1B55K was used as a template for constructing E1B55K with recognition sites, the E1B55K fusion EcoRI sense primer was 5'-CCCTCGTAAAGAATTCATGGAGCGAAGAAACCCATCTGAG-3' (SEQ ID NO: 14), and the E1B55K fusion BamHI antisense primer was 5'-GAGGTGGTCTGGATCCTCAATCTGTATCTTCATCGCTAGA-3' (SEQ ID NO: 15).

[0178] The PCR conditions were as follows (​Figure 14 ).

[0179] After initial denaturation at 95°C for 2 minutes, 30 cycles of 95°C denaturation for 40 seconds, 61°C annealing for 40 seconds, and 72°C elongation for 1 minute 50 seconds were performed.

[0180] PCR was performed using Promega (#M750B) products.

[0181] After obtaining the sample pRetro-X-Tetone-E1B55K#13 in the constructed plasmid (pRetro-X-Tetone-puro-E1B55K) in which E1B55K was inserted into pRetro-X-Tetone by a fusion method of introducing an exogenous gene, it was finally confirmed that the introduction was correct by performing sequence analysis (Fig. 17). Next, it was confirmed whether or not the expression of the actually inserted E1B55K protein was induced by doxycycline (dox) (Fig. 18). Figure 15 Figure 18 As shown in lane 5 of Fig. 18, it was confirmed that when A549 was transfected with the pRetro-X-Tetone-E1B55K plasmid in the presence of doxycycline (2.5 μg / ml) alone, the expression of E1B55K was induced, whereas when A549 was transfected with the same plasmid in the absence of doxycycline, the expression of E1B55K was not induced. That is, there was no occurrence of a leak phenomenon. The rightmost lane is a positive condition in which E1B55K was constitutively expressed, and thus the expression of E1B55K was confirmed. Figure 18 The pRetro-X-tetone-puro-E1B55K vector used for construction is shown in Fig. 16.

[0182] Figure 16 2) Confirmation of expression of pRetro-X-tetone-puro-E1B55K

[0183] After transfection with the pRetro-X-Tetone-puro-E1B55K plasmid, it was confirmed that the expression of E1B55K in pRetro-X-tetone-puro-E1B55K was confirmed depending on the amount of doxycycline during the period of treatment with doxycycline. When the tet one system was introduced to investigate whether or not the time difference expression regulation of E1B55K could be controlled with the tet one system, it was confirmed that no E1B55K expression occurred at all before treatment with doxycycline (Fig. 19).

[0184] That is, it was confirmed that there was no occurrence of a leak. In contrast, even treatment with doxycycline at an extremely low concentration of 0.05 μg / ml immediately induced the expression of E1B55K. This means that it is possible to maintain cell survival before treatment with doxycycline and to immediately induce expression after reaching a tumor and then treating with doxycycline. Figure 19

[0185] ​​​The time difference virus release was verified twice as follows.

[0186] After transfection of human fat MSC-TERT with pRetro-tetone-E1B55K plasmid (4 hours), then infection with oncolytic adenovirus expressing red fluorescent protein (RFP) (4 hours), the virus production was compared after 48 hours with and without doxycycline treatment.

[0187] As a result, it was confirmed that the virus production was significantly increased by 10 times or more after treatment with doxycycline Figure 20 ).

[0188] 3) Establishment of MSC-TERT-tetoneE1B55K cell line

[0189] After introducing a gene encoding E1B55K (early region 1B-55kDa of adenovirus) into a Retro-X-Tet-One inducible expression system (TAKARA Bio Inc.), MSC-TERT was infected with the system to secure a clone expressing E1B55K in the presence of doxycycline. For this, GP2-293 packaging cells were cotransfected with pRetroX-TetOne-E1B55K and pAmpho vector encoding membrane protein included in the TAKRA kit. After 48 hours, MSC-TERT as target cells were infected with filtered retroviral supernatant. All clones selected with puromycin during culture were subjected to Western blotting again to confirm the induction of E1B55K expression in the presence of doxycycline (2.5 μg / ml) Figure 21 ) and p53 accumulation Figure 22 ) at the same time.

[0190] These results indicate that according to the treatment of doxycycline, by adjusting the expression time point of E1B55K, a kind of negative load gene, it is possible to increase the induction of virus production at the desired time point (since the gene expression of E1B55K must be induced, at least 24 hours after treatment with doxycycline, the virus seems to start to increase).

[0191] 4) Realization of internal tumor occurrence control technology

[0192] It was confirmed whether clone 2 or 10 in Figure 21 can control tumor occurrence. For this, after treating a 6-well aliquot of the clonal cell line with doxycycline, long-term (about 14 days) culture was performed.

[0193] As a result, it was confirmed that after 2 weeks of culture with doxycycline (1.25 μg / ml), most of the cells lost their viability (1.25 μg / ml) Figure 23Therefore, even for uninfected MSCs other than those lysed by oncolytic virus infection, infection with E1B55K-expressing retroviruses and the selected cell lines ultimately lead to cell death, thereby fundamentally ruling out the possibility of tumorigenesis.

[0194] Example 3: Establishing an innovative approach to tumor targeting – discovering tumor homing improvement factors

[0195] The expression of tumor tropism-related markers was confirmed by inducing additional expression of GRP78 in human adipose MSC-TERT.

[0196] It was confirmed that the expression of all factors that play a role in each stage of MSC homing increased with the increase of GRP78 (Figure 24A).

[0197] To confirm that GRP78 was indeed expressed, the increase in GRP78 mRNA expression was confirmed by transfecting human MSC-TERT with pcDNA3.1-GRP78 (2 μg) (Figure 24B).

[0198] 1) GRP78 was cloned into pcDNA3.1 hygro(+)

[0199] RNA was extracted from the GRP78-highly expressed hepatocellular carcinoma cell line SNU449 using Trizol. The Invirogen SuperScript RT-PCR kit was used. TM The extracted RNA was reverse transcribed using a first-strand synthesis system. Primers used for PCR were then sequenced by adding XhoI sites in the forward direction and XbaI sites in the reverse direction. PCR (initial denaturation: 95°C for 2 min; denaturation: 95°C for 40 s; annealing: 58°C for 40 s; extension: 72°C for 2 min 30 s; 30 cycles) was performed using the forward primer (5'-GATTCTCGAGATGAAGCTCTCCCTGG-3':SEQ ID NO:16) and the reverse primer (5'-GGCCTCTAGACTACAACTCATCTTTT-3':SEQ ID NO:17). After PCR and digestion with XhoI / XbaI, the pcDNA3.1-hygro vector backbone was simultaneously digested with XhoI / XbaI and ligated. Colonies were obtained after bacterial transformation. Each plasmid thus obtained was simultaneously digested with XhoI / XbaI to confirm the size-matching insertion only in plasmid 5 by confirming the insertion. Figure 25 After transfecting the SNU449 hepatocellular carcinoma cell line with pcDNA3.1-GRP78 (number 5), increased GRP78 protein expression was confirmed by Western blotting. Figure 26). Furthermore, sequence analysis of the sample 5 plasmid showed 100% homology with NCBI NM_005347 (Fig. 27).

[0200] 2) Cloning of GRP78 into PLNCX neo

[0201] The following steps were performed to introduce the GRP78 gene into MSC-TERT or MSC-TERT-tetonE1B55K.

[0202] To introduce GRP78 into the retroviral vector pLNCXneo, the pcDNA3.1-GRP78 vector was digested with XhoI / PmeI to extract the GRP78 site, and the GRP78 site was ligated and inserted into the previously digested PLNCXneo with XhoI / PmeI.

[0203] pLNCX neo was originally constructed by increasing the restriction enzyme recognition sites from HindIII-HpaI-ClaI (cloning site in the existing LNCX) to HindIII-PmlI-BstXI-NotI-XhoI-SalI-ApaI-PmeI-HpaI-ClaI ( Figure 28 ).

[0204] In this case, the chain sequence was as follows.

[0205] Upstream 5'- AGCTTCACGTGCCAGCACAGTGGCGGCCGCTCGAGTCGACGGGCCCGTTTAAACGTTAACAT-3', (SEQ ID NO: 18)

[0206] Downstream 5'- CGATGTTAACGTTTAAACGGGCCCGTCGACTCGAGCGGCCGCCACTGTGCTGGCACGTGA-3 (SEQ ID NO: 19).

[0207] To confirm whether LNCXneo-GRP78 was inserted, pLNCXneo (control) and pcDNA3.1-GRP78 (plasmid providing the GRP78 gene) were digested with HindIII / PmeI as a control, the GRP78 fragment from linearized PLNCXneo and pcDNA3.1-GRP78 was ligated and transformed into DH5α competent cells, and then it was confirmed that the pLNCXneo-GRP78 candidate construct (samples 1 to 24) was simultaneously cut and inserted into samples 2, 5, 9, 11, 12, 20, and 21 ( Figure 29 ).

[0208] 3) Construction of MSC-TERT-GRP78 cell line

[0209] Platinum-A packaging cells (Cell Biolabs) were transfected with retroviral vector pLNCXneo-GRP78, and 48 hours later, the culture medium was filtered. Cell clones resistant to G418 (500 μg to 600 μg / ml) were obtained by infecting MSC-TERT with a solution of the culture medium containing the retroviruses obtained by filtration, and then selected to select clones 2 and 4 that clearly expressed GRP78 and MMP2 Figure 30 ).

[0210] 4) Tumor targeting of MSCs carrying transgenes: confirmation of conditions for reaching only the tumor site specifically in a very short time

[0211] ① Verification of tumor targeting of MSC-TERT-GRP78

[0212] 2 x 10 6 SNU398 cells (a liver cancer cell line) were subcutaneously transplanted into the shoulder region of 6-week-old BALB / c thymus nude mice, and 7 days later, 1 x 10 6 MSC-TERT-GRP78 cells infected with a replication-deficient adenovirus expressing firefly luciferase were injected into the tail vein. 150 mg D-luciferin / kg of mice was intraperitoneally injected into the mice in order to use an in vivo imaging system (IVIS) device that recognizes luminescence. After 6 hours of injection into the tail vein, the biodistribution of MSC-TERT-GRP78 infected with an adenovirus expressing luciferase was observed in vivo by imaging using an IVIS spectrum system (PerkinElmer). One feature of this experiment is that MSC-TERT-GRP78 with GRP78 gene transfer was allowed to form a tumor in the shoulder to distinguish it from internal organs such as the liver and lung, thereby accurately distinguishing how much tumor migration ability MSC-TERT-GRP78 has, clearly confirming that the site of arrival of MSC-TERT-GRP78 is concentrated at the tumor tissue site in a very short time, without being adsorbed to other organs Figure 31 ).

[0213] ② Verification of tumor targeting of gene transfer final type MSC-TERT-tetoneE1B55K-GRP78

[0214] 8 x 10 6 A549 cells (a lung cancer cell line), 2 x 10 6 SNU398 cells (a liver cancer cell line), or 2 x 10 6One MiaPaCa-2 cell, a pancreatic cancer cell line, was subcutaneously transplanted into the shoulder region of a 6-week-old BALB / c thymus nude mouse, and 7 days later, 1 x 10 6 6 One MSC-TERT-tetoneE1B55K-GRP78 cell was injected into the tail vein. 150 mg D-luciferin / kg mouse was intraperitoneally injected into the mouse in order to use an in vivo imaging system (IVIS) device that recognizes luminescence. The biodistribution of MSC infected with an adenovirus expressing luciferase was observed in vivo after 6 hours or 24 hours using an IVIS spectrum system (PerkinElmer).

[0215] As a result, similar to the previous targeting experiment ①, a tumor was formed on the shoulder side so as to be distinguished from internal organs such as the liver and lung, clearly demonstrating that the arrival site of the MSC was concentrated at the tumor tissue site in a very short time without being adsorbed to other organs (FIG. 32). From this, it can be seen that the final type of MSC-TERT-tetoneE1B55K-GRP78 including GRP78 can be observed to migrate to the tumor site in a very short time regardless of the type of cancer, and it can be demonstrated that there is a certain intensity difference compared to the luciferase activity intensity value (10 times minimum, 100 times maximum according to the luminescence intensity in the tumor). This indicates that tumor targeting occurs very rapidly and accurately. Here, E1B55K is not expressed because doxycycline is not contained in the diet.

[0216] This surprising rapid and accurate transportation of the luciferase-expressing MSC-GRP78 to the tumor and targeting to various tumor types greatly improves the possibility of tumor diagnosis using MSC-GRP78. In a primary mouse model, a solid cancer is artificially transplanted subcutaneously and the tumor site is confirmed by allowing the MSC-GRP78 to migrate, but when a tumor is present in the same manner as in the primary mouse model, even in a metastasis model present in vivo, the MSC-GRP78 can be delivered to the tumor site to luminesce, or the tumor can be detected by labeling the tumor with a higher resolution isotope. This can be applied to tumor diagnosis, and it will be possible to construct an OV / MSC complex that can simultaneously perform tumor diagnosis and treatment for a long period of time.

[0217] ③ Confirmation of the infiltration of the final type of MSC-TERT-tetoneE1B55K-GRP78, which is genetically transferred, into the tumor

[0218] It was confirmed that the final type of MSC-TERT-tetoneE1B55K-GRP78 arrived at the tumor site, and the following experiment was performed to confirm whether the MSC actually arrived at the tumor site infiltrated into the tumor tissue.

[0219] First, A549 cells were transplanted into the subcutaneous tissue of mice to form tumors. Then, the final MSC cells (MSC-TERT-tetoneE1B55K-GRP78) were labeled with a fluorescent cell tracking probe (Invitrogen, C34565) and then injected into the tail vein of the mice. At 24 hours, 48 hours, and 72 hours after injection, tumor tissue was removed and sectioned, and then fluorescent sites were confirmed under a fluorescence microscope. As shown in Figure 33 , it was confirmed that there were excess MSCs with GRP78 in the tumor. In the case of MSCs lacking GRP78, it was observed that the MSCs remained mainly on the surface of the tumor with low fluorescence intensity.

[0220] ④ Confirmation of expression of adenovirus-associated proteins in tumor tissue

[0221] Virus was released from MSC-TERT-tetoneE1B55K-GRP78, which had infiltrated into the tumor tissue, to infect tumor cells, and the following experiment was performed to confirm whether the virus replicated and was maintained for a certain period of time after the virus was produced.

[0222] 8 x 10 6 A549 cells, a lung cancer cell line, were transplanted subcutaneously into the flank region of 6-week-old BALB / c athymic mice, and 1 x 10 6 MSC-TERT-tetoneE1B55K-GRP78 cells infected with an oncolytic adenovirus expressing shHSP27-shTGFβ were injected into the tail vein of each of the mice having an average tumor size of 150 mm 3 . Then, 3 days later, 1 x 10 6 MSC-TERT-tetoneE1B55K-GRP78 cells infected with an oncolytic adenovirus expressing shHSP27-shTGFβ1 were additionally injected. Then, 7 days after the second injection, tumors were removed from each group of mice, tumor section samples were reacted with an adenovirus type 5-specific antibody (Abeam, Cambridge, UK), a secondary antibody was used for a DAB color development reaction, and hematoxylin nuclear staining was performed for control staining of immunohistochemistry. In this case, a diet containing doxycycline (625 mg / kg) was fed to all groups as feed.

[0223] As a result, adenovirus-specific proteins Figure 34 were confirmed in most of the confirmed regions. MSCs in the tumor tissue released adenovirus at least 7 days after the tail vein injection, indicating that replication, proliferation, and spread occurred repeatedly, and confirming the possibility that the virus remained until approximately 20 days, at which time the size of the tumor had decreased to almost zero level.

[0224] 5) Establishment of the human adipose-derived MSC-TERT-tetone E1B55K-GRP78 cell line—confirmation of E1B55K expression after treatment with 1.25 μg / mL doxycycline for 48 hours.

[0225] Following infection with retroviral suspensions obtained by co-transfecting GP2-293 packaging cells with the pRetroX-TetOne-E1B55K and pAmpho vector encoding membrane proteins, puromycin selection (0.8 μg / ml to 1.0 μg / ml) was performed. Following infection with retroviral suspensions obtained by re-transfecting platinum-A packaging cells with the retroviral vector pLNCXneo-GRP78, G418 selection (500 μg / ml to 600 μg / ml) was performed. Finally, in the presence of doxycycline (1.25 μg / ml), the final clones exhibiting clear expression of E1B55K and MMP2 proteins were selected. Figure 35 Ultimately, clones 21, 24, 25, and 26 were created.

[0226] In final clone 21, it was demonstrated that doxycycline was effective and sufficient to induce E1B55K concentrations, even at very low concentrations, less than 1 / 10 of the 1.25 μg / ml used, without any leakage. Figure 36 This indicates that it can be reliably turned on / off in vivo, thus inducing viral production at the desired time point, as it is not significantly affected by the amount of doxycycline (which is an in vivo expression inducer) and is highly sensitive to the presence or absence of doxycycline.

[0227] The ability of human adipose MSCs-TERT-tetoneE1B55K-GRP78 (clone 21) to produce virus was demonstrated by increasing the rate of virus production in MSCs after 48 hours of treatment with doxycycline (1.25 μg / ml) following infection with oncolytic adenovirus expressing shHSP27 / shTGFβ1. In this case, differences in virus production based on E4orf6 gene expression were also confirmed. For this experiment, clone 21 MSCs were transfected with either 1 μg of pFlag-CMV2-E4orf6 (with the E4orf6 gene subcloned) or 1 μg of pFlag-CMV2 as controls. Following additional infection with oncolytic adenovirus expressing shHSP27 / shTGFβ1, cells were treated with doxycycline (1.25 μg / ml, 48 hours), and the total viral load in the harvested suspension and remaining cells was determined by titration. As a result, in the final clone 21, treatment with doxycycline confirmed a nearly 10-fold increase in viral yield, and differences in viral yield were observed based on the presence or absence of E4orf6 gene transfection. Figure 37). That is, according to the E4orf6 external expression induction, the virus production amount was reduced. This seems to indicate that the E1B55K alone acts to cause an increase in virus production, and functions as an inhibitor in virus production caused by complex formation of E4ORF6 (it has been confirmed that the cell death process of MSC induced by E1B55K alone contributes to virus production. The E1B55K / E4orf6 complex interferes with the cell death of MSC, resulting in a missed optimal time for virus production).

[0228] 6) Comparison of efficacy maintenance in human adipose MSC-TERT low passage and high passage

[0229] In the process of mass-producing 200 bottles or more of the master cell bank cell line, it was necessary to confirm that the efficacy of MSC was maintained. That is, by Western blotting, from a sample of each cell lysate obtained at low passage (p13) and high passage (p23), it was confirmed whether the biomarker called a marker related to tumor homing, which is a characteristic of MSC caused by the passage difference of the final MSC-TERT-tetoneE1B55K-GRP78, was maintained.

[0230] As a result, it was confirmed that there was no difference in the expression of proteins called tumor homing markers even when the number of passages was increased to 20 times Figure 38 ).

[0231] Example 4: Anti-cancer efficacy of MSC-TERT-tetoneE1B55K-GRP78 infected with oncolytic adenovirus

[0232] 8 x 10 6 A549 cells, a lung cancer cell line, were subcutaneously transplanted into the flank of 6-week-old BALB / c athymic mice, and mice with an average tumor size of 150 mm 3 were divided into groups of 10 mice per group. 1 x 10 6 MSC-TERT-tetoneE1B55K-GRP78 cells infected with oncolytic adenovirus expressing shHSP27-shTGFβ1 were injected into the tail vein of the mice. Then, 3 days later, 1 x 10 6 MSC-TERT-tetoneE1B55K-GRP78 cells infected with oncolytic adenovirus expressing shHSP27-shTGFβ1 were intravenously injected. The group transplanted with only tumor cells (untreated) and the group injected with the final MSC-TERT-tetoneE1B55K-GRP78 (MSC only) were used as controls. In this case, a diet containing doxycycline (625 mg / kg) was fed as feed to all groups.

[0233] As a result, it was observed that when comparing the anti-tumor effect obtained by direct intratumoral injection of the oncolytic virus (Ad-3484-shHSP27-shTGFβ1) (the state is the delay in the growth rate of tumor size compared to the control, the tumor size itself is reduced without regression) as Figure 39 shown, compared to the untreated tumor or the control in which the final MSC was injected into the tail vein alone, when the oncolytic virus (Ad-3484-shHSP27-shTGFβ1) in the final MSC-TERT-tetoneE1B55K-GRP78 was injected into the tail vein, the tumor size was significantly reduced, and the tumor almost disappeared within a few days, and it can be seen that the tumor almost disappeared 20 days after injection, and then the tumor slightly grew again in a few individuals. The anti-tumor effect of the oncolytic virus (Ad-3484-shHSP27-shTGFβ1) in the final MSC-TERT-tetoneE1B55K-GRP78 was more reliably confirmed by individual photographs of each group of mice and photographs of tumors taken for each group after removing the tumors one month after the first injection of OV / MSC (FIG. 40).

[0234] Example 5: Confirmation of adsorption to organs other than tumors

[0235] After confirming that tumor targeting occurred very effectively, in order to more specifically confirm the amount of capture in the major organs (lungs, liver, spleen, etc.) other than tumors, migration to the tumor site, elapsed time, etc., the copy number of the adenovirus gene was measured for the amount of adenovirus in each major organ including tumors at each time period. The viral genome plasmid DNA was defined as a standard known DNA, and was confirmed by drawing a standard curve (in the case of the viral DNA of the oncolytic adenovirus currently used, 1 copy is 10 3 pg).

[0236] To this end, MSC-TERT-GRP78 (1 × 10 6 ) infected with the YSC-02 oncolytic virus of Reference Example 1 were single-dose injected through the tail vein after infection with the replication-defective E1B55K virus, and samples were collected by date (0, 1, 2, 3, 4, 5, 10, and 15 days). The collected tissues (tumor, lung, liver, spleen, kidney, heart) were immediately stored in liquid nitrogen, and genomic DNA was extracted from each tissue under the same conditions on the day when the tissue sampling was completed. In order to confirm whether the gene is expressed using the extracted genomic DNA, real-time PCR was performed using primers for the E4 ORF gene. The primers for screening the E4 ORF here are as follows.

[0237] Forward 5'-CGTGGTCAAACT CTACAGCC-3': SEQ ID NO:20

[0238] Reverse 5'-GCATGAGCATGACTACGATG-3':SEQ ID NO:21

[0239] As can be seen from Figure 41, although there are significant individual differences, it can be observed that when oncolytic viruses enter tumor tissue, the range within the individual tissue is 10. 4 Up to 10 10 Almost all of the virus was adsorbed and absorbed in the tumor tissue, compared to the few to ten copies found in all other organs. sequence list <110> Yonsei University Industry-Academia Collaboration Group <120> Mesenchymal stem cells capable of enhancing tumor targeting and mass production of viruses <130> X21U18C0183 <150> KR 10-2020-0139918 <151> 2020-10-27 <160> 31 <170> KoPatentIn 3.0 <210> 1 <211> 1965 <212> DNA <213> Homo sapiens <400> 1 atgaagctct ccctggtggc cgcgatgctg ctgctgctca gcgcggcgcg ggccgaggag 60 gaggacaaga aggaggacgt gggcacggtg gtcggcatcg acctggggac cacctactcc 120 tgcgtcggcg tgttcaagaa cggccgcgtg gagatcatcg ccaacgatca gggcaaccgc 180 atcacgccgt cctatgtcgc cttcactcct gaaggggaac gtctgattgg cgatgccgcc 240 aagaaccagc tcacctccaa ccccgagaac acggtctttg acgccaagcg gctcatcggc 300 cgcacgtgga atgacccgtc tgtgcagcag gacatcaagt tcttgccgtt caaggtggtt 360 gaaaagaaaa ctaaaccata cattcaagtt gatattggag gtgggcaaac aaagacattt 420 gctcctgaag aaatttctgc catggttctc actaaaatga aagaaaccgc tgaggcttat 480 ttgggaaaga aggttaccca tgcagttgtt actgtaccag cctattttaa tgatgcccaa 540 cgccaagcaa ccaaagacgc tggaactatt gctggcctaa atgttatgag gatcatcaac 600 gagcctacgg cagctgctat tgcttatggc ctggataaga gggaggggga gaagaacatc 660 ctggtgtttg acctgggtgg cggaaccttc gatgtgtctc ttctcaccat tgacaatggt 720 gtcttcgaag ttgtggccac taatggagat actcatctgg gtggagaaga ctttgaccag 780 cgtgtcatgg aacacttcat caaactgtac aaaaagaaga cgggcaaaga tgtcaggaaa 840 gacaatagag ctgtgcagaa actccggcgc gaggtagaaa aggccaaacg ggccctgtct 900 tctcagcatc aagcaagaat tgaaattgag tccttctatg aaggagaaga cttttctgag 960 accctgactc gggccaaatt tgaagagctc aacatggatc tgttccggtc tactatgaag 1020 cccgtccaga aagtgttgga agattctgat ttgaagaagt ctgatattga tgaaattgtt 1080 cttgttggtg gctcgactcg aattccaaag attcagcaac tggttaaaga gttcttcaat 1140 ggcaaggaac catcccgtgg cataaaccca gatgaagctg tagcgtatgg tgctgctgtc 1200 caggctggtg tgctctctgg tgatcaagat acaggtgacc tggtactgct tgatgtatgt 1260 ccccttacac ttggtattga aactgtggga ggtgtcatga ccaaactgat tccaaggaac 1320 acagtggtgc ctaccaagaa gtctcagatc ttttctacag cttctgataa tcaaccaact 1380 gttacaatca aggtctatga aggtgaaaga cccctgacaa aagacaatca tcttctgggt 1440 acatttgatc tgactggaat tcctcctgct cctcgtgggg tcccacagat tgaagtcacc 1500 tttgagatag atgtgaatgg tattcttcga gtgacagctg aagacaaggg tacagggaac 1560 aaaaataaga tcacaatcac caatgaccag aatcgcctga cacctgaaga aatcgaaagg 1620 atggttaatg atgctgagaa gtttgctgag gaagacaaaa agctcaagga gcgcattgat 1680 actagaaatg agttggaaag ctatgcctat tctctaaaga atcagattgg agataaagaa 1740 aagctgggag gtaaactttc ctctgaagat aaggagacca tggaaaaagc tgtagaagaa 1800 aagattgaat ggctggaaag ccaccaagat gctgacattg aagacttcaa agctaagaag 1860 aaggaactgg aagaaattgt tcaaccaatt atcagcaaac tctatggaag tgcaggccct 1920 cccccaactg gtgaagagga tacagcagaa aaagatgagt tgtag 1965 <210> 2 <211> 3399 <212> DNA <213> Homo sapiens <400> 2 atgccgcgcg ctccccgctg ccgagccgtg cgctccctgc tgcgcagcca ctaccgcgag 60 gtgctgccgc tggccacgtt cgtgcggcgc ctggggcccc agggctggcg gctggtgcag 120 cgcggggacc cggcggcttt ccgcgcgctg gtggcccagt gcctggtgtg cgtgccctgg 180 gacgcacggc cgccccccgc cgccccctcc ttccgccagg tgtcctgcct gaaggagctg 240 gtggcccgag tgctgcagag gctgtgcgag cgcggcgcga agaacgtgct ggccttcggc 300 ttcgcgctgc tggacggggc ccgcgggggc ccccccgagg ccttcaccac cagcgtgcgc 360 agctacctgc ccaacacggt gaccgacgca ctgcggggga gcggggcgtg ggggctgctg 420 ctgcgccgcg tgggcgacga cgtgctggtt cacctgctgg cacgctgcgc gctctttgtg 480 ctggtggctc ccagctgcgc ctaccaggtg tgcgggccgc cgctgtacca gctcggcgct 540 gccactcagg cccggccccc gccacacgct agtggacccc gaaggcgtct gggatgcgaa 600 cgggcctgga accatagcgt cagggaggcc ggggtccccc tgggcctgcc agccccgggt 660 gcgaggaggc gcgggggcag tgccagccga agtctgccgt tgcccaagag gcccaggcgt 720 ggcgctgccc ctgagccgga gcggacgccc gttgggcagg ggtcctgggc ccacccgggc 780 aggacgcgtg gaccgagtga ccgtggtttc tgtgtggtgt cacctgccag acccgccgaa 840 gaagccacct ctttggaggg tgcgctctct ggcacgcgcc actcccaccc atccgtgggc 900 cgccagcacc acgcgggccc cccatccaca tcgcggccac cacgtccctg ggacacgcct 960 tgtcccccgg tgtacgccga gaccaagcac ttcctctact cctcaggcga caaggagcag 1020 ctgcggccct ccttcctact cagctctctg aggcccagcc tgactggcgc tcggaggctc 1080 gtggagacca tctttctggg ttccaggccc tggatgccag ggactccccg caggttgccc 1140 cgcctgcccc agcgctactg gcaaatgcgg cccctgtttc tggagctgct tgggaaccac 1200 gcgcagtgcc cctacggggt gctcctcaag acgcactgcc cgctgcgagc tgcggtcacc 1260 ccagcagccg gtgtctgtgc ccgggagaag ccccagggct ctgtggcggc ccccgaggag 1320 gaggacacag acccccgtcg cctggtgcag ctgctccgcc agcacagcag cccctggcag 1380 gtgtacggct tcgtgcgggc ctgcctgcgc cggctggtgc ccccaggcct ctggggctcc 1440 aggcacaacg aacgccgctt cctcaggaac accaagaagt tcatctccct ggggaagcat 1500 gccaagctct cgctgcagga gctgacgtgg aagatgagcg tgcgggactg cgcttggctg 1560 cgcaggagcc caggggttgg ctgtgttccg gccgcagagc accgtctgcg tgaggagatc 1620 ctggccaagt tcctgcactg gctgatgagt gtgtacgtcg tcgagctgct caggtctttc 1680 ttttatgtca cggagaccac gtttcaaaag aacaggctct ttttctaccg gaagagtgtc 1740 tggagcaagt tgcaaagcat tggaatcaga cagcacttga agagggtgca gctgcgggag 1800 ctgtcggaag cagaggtcag gcagcatcgg gaagccaggc ccgccctgct gacgtccaga 1860 ctccgcttca tccccaagcc tgacgggctg cggccgattg tgaacatgga ctacgtcgtg 1920 ggagccagaa cgttccgcag agaaaagagg gccgagcgtc tcacctcgag ggtgaaggca 1980 ctgttcagcg tgctcaacta cgagcgggcg cggcgccccg gcctcctggg cgcctctgtg 2040 ctgggcctgg acgatatcca cagggcctgg cgcaccttcg tgctgcgtgt gcgggcccag 2100 gacccgccgc ctgagctgta ctttgtcaag gtggatgtga cgggcgcgta cgacaccatc 2160 ccccaggaca ggctcacgga ggtcatcgcc agcatcatca aaccccagaa cacgtactgc 2220 gtgcgtcggt atgccgtggt ccagaaggcc gcccatgggc acgtccgcaa ggccttcaag 2280 agccacgtct ctaccttgac agacctccag ccgtacatgc gacagttcgt ggctcacctg 2340 caggagacca gcccgctgag ggatgccgtc gtcatcgagc agagctcctc cctgaatgag 2400 gccagcagtg gcctcttcga cgtcttccta cgcttcatgt gccaccacgc cgtgcgcatc 2460 aggggcaagt cctacgtcca gtgccagggg atcccgcagg gctccatcct ctccacgctg 2520 ctctgcagcc tgtgctacgg cgacatggag aacaagctgt ttgcggggat tcggcgggac 2580 gggctgctcc tgcgtttggt ggatgatttc ttgttggtga cacctcacct cacccacgcg 2640 aaaaccttcc tcaggaccct ggtccgaggt gtccctgagt atggctgcgt ggtgaacttg 2700 cggaagacag tggtgaactt ccctgtagaa gacgaggccc tgggtggcac ggcttttgtt 2760 cagatgccgg cccacggcct attcccctgg tgcggcctgc tgctggatac ccggaccctg 2820 gaggtgcaga gcgactactc cagctatgcc cggacctcca tcagagccag tctcaccttc 2880 aaccgcggct tcaaggctgg gaggaacatg cgtcgcaaac tctttggggt cttgcggctg 2940 aagtgtcaca gcctgtttct ggatttgcag gtgaacagcc tccagacggt gtgcaccaac 3000 atctacaaga tcctcctgct gcaggcgtac aggtttcacg catgtgtgct gcagctccca 3060 tttcatcagc aagtttggaa gaaccccaca tttttcctgc gcgtcatctc tgacacggcc 3120 tccctctgct actccatcct gaaagccaag aacgcaggga tgtcgctggg ggccaagggc 3180 gccgccggcc ctctgccctc cgaggccgtg cagtggctgt gccaccaagc attcctgctc 3240 aagctgactc gacaccgtgt cacctacgtg ccactcctgg ggtcactcag gacagcccag 3300 3360. acgcagctga gtcggaagct cccggggacg acgctgactg ccctggaggc cgcagccaac ccggcactgc cctcagactt caagaccatc ctggactga <210> 3 <211> 1491 <212> DNA <213> Remove the 5-year-old <400> 3 atggagcgaa gaaacccatc tgagcgggga gtacctgctg gattttctgg ccatgcatct gtggagagcg gttgtgagac acaagaatcg cctgctactg ttgtcttccg tccgcccggc gataataccg acggaggagc agcagcagca gcaggagga gccaggcggc ggcggcagga gcagagccca tggaacccga gagccggcct ggaccctcgg gaatgaatgt tgtacaggtg gctgaactgt atccagaact gagacgcatt ttgacaatta cagaggatgg gcaggggcta aagggggtaa agggggagcg gggggcttgt gaggctacag aggaggctag gaatctagct tttagcttaa tgaccagaca ccgtcctgag tgtattactt ttcaacagat caaggataat tgcgctaatg agcttgatct gctggcgcag aagtattcca tagagcagct gaccacttac tggctgcagc caggggatga ttttgaggag gctattaggg tatatgcaaa ggtggcactt 540 aggccagatt gcaagtacaa gatcagcaaa cttgtaaata tcaggaattg ttgctacatt 600 tctgggaacg gggccgaggt ggagatagat acggaggata gggtggcctt tagatgtagc 660 atgataaata tgtggccggg ggtgcttggc atggacgggg tggttattat gaatgtaagg 720 tttactggcc ccaattttag cggtacggtt ttcctggcca ataccaacct tatcctacac 780 ggtgttagct tctatgggtt taacaatacc tgtgtggaag cctggaccga tgtaagggtt 840 cggggctgtg ccttttactg ctgctggaag ggggtggtgt gtcgccccaa aagcagggct 900 tcaattaaga aatgcctctt tgaaaggtgt accttgggta tcctgtctga gggtaactcc 960 agggtgcgcc acaatgtggc ctccgactgt ggttgcttca tgctagtgaa aagcgtggct 1020 gtgattaagc ataacatggt atgtggcaac tgcgaggaca gggcctctca gatgctgacc 1080 tgctcggacg gcaactgtca cctgctgaag accattcacg tagccagcca ctctcgcaag 1140 gcctggccag tgtttgagca taacatactg acccgctgtt ccttgcattt gggtaacagg 1200 aggggggtgt tcctacctta ccaatgcaat ttgagtcaca ctaagatatt gcttgagccc 1260 gagagcatgt ccaaggtgaa cctgaacggg gtgtttgaca tgaccatgaa gatctggaag 1320 gtgctgaggt acgatgagac ccgcaccagg tgcagaccct gcgagtgtgg cggtaaacat 1380 attaggaacc agcctgtgat gctggatgtg accgaggagc tgaggcccga tcacttggtg 1440 ctggcctgca cccgcgctga gtttggctct agcgatgaag atacagattg a 1491 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> BamHI / NotI Forward Primer <400> 4 gcggatccat ggagcgaaga aacccatct 29 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> BamHI / NotI Reverse Primer <400> 5 cggccgctca atctgtatct tcatcgct 28 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HindIII Forward Primer <400> 6 gtacaagctt atgactacgt ccggcgttcc 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Xbal reverse primer <400> 7 cacctctaga ctacatgggg gtagagtcat 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CMV30 <400> 8 aatgtcgtaa taaccccgcc ccgttgacgc 30 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Xbal sense primer <400> 9 ttcatctaga atggagcgaa gaaacccatc 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Hindlll antisense primer <400> 10 gacgaagctt tcaatctgta tcttcatcgc 30 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> hCMV forward primer <400> 11 gggaggtcta tataagcaga gctcg 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> pCA14 SV40 reverse primer <400> 12 catgatcgat gctagacgat ccaga 25 <210> 13 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> N-terminal of E1B55K <400> 13 Met Glu Arg Arg Asn Pro Ser Glu Arg Gly Val Pro Ala Gly Phe Ser 1 5 10 15 Gly His Ala Ser Val Glu Ser Gly Cys 20 25 <210> 14 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> E1B55K fusion EcoRI sense primer <400> 14 ccctcgtaaa gaattcatgg agcgaagaaa cccatctgag 40 <210> 15 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> E1B55K fusion BamHI antisense primer <400> 15 gaggtggtct ggatcctcaa tctgtatctt catcgctaga 40 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> XbaI forward primer <400> 16 gattctcgag atgaagctct ccctgg 26 <210> 17 <211> 26 <212> DNA <213> Artificial sequence <220> <223> XbaI reverse primer <400> 17 ggcctctaga ctacaactca tctttt 26 <210> 18 <211> 62 <212> DNA <213> Artificial sequence <220> <223> pLNCX neo top strand <400> 18 agcttcacgt gccagcacag tggcggccgc tcgagtcgac gggcccgttt aaacgttaac 60 at 62 <210> 19 <211> 60 <212> DNA <213> Artificial sequence <220> <223> pLNCX neo bottom strand <400> 19 cgatgttaac gtttaaacgg gcccgtcgac tcgagcggcc gccactgtgc tggcacgtga 60 60 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <220> <223> E4 ORF forward primer <400> 20 cgtggtcaaa ctctacagcc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> E4 ORF reverse primer <400> 21 gcatgagcat gactacgatg 20 <210> 22 <211> 912 <212> DNA <213> Artificial Sequence <220> <223> Flag-E4orf6 <400> 22 gactacaaag acgatgacga caagcttatg actacgtccg gcgttccatt tggcatgaca 60 ctacgaccaa cacgatctcg gttgtctcgg cgcactccgt acagtaggga tcgtctacct 120 ccttttgaga cagaaacccg cgctaccata ctggaggatc atccgctgct gcccgaatgt 180 aacactttga caatgcacaa cgtgagttac gtgcgaggtc ttccctgcag tgtgggattt 240 acgctgattc aggaatgggt tgttccctgg gatatggttc taacgcggga ggagcttgta 300 atcctgagga agtgtatgca cgtgtgcctg tgttgtgcca acattgatat catgacgagc 360 atgatgatcc atggttacga gtcctgggct ctccactgtc attgttccag tcccggttcc 420 ctgcagtgta tagccggcgg gcaggttttg gccagctggt ttaggatggt ggtggatggc 480 gccatgttta atcagaggtt tatatggtac cgggaggtgg tgaattacaa catgccaaaa 540 gaggtaatgt ttatgtccag cgtgtttatg aggggtcgcc acttaatcta cctgcgcttg 600 tggtatgatg gccacgtggg ttctgtggtc cccgccatga gctttggata cagcgccttg 660 cactgtggga ttttgaacaa tattgtggtg ctgtgctgca gttactgtgc tgatttaagt 720 gagatcaggg tgcgctgctg tgcccggagg acaaggcgcc ttatgctgcg ggcggtgcga 780 atcatcgctg aggagaccac tgccatgttg tattcctgca ggacggagcg gcggcggcag 840 cagtttattc gcgcgctgct gcagcaccac cgccctatcc tgatgcacga ttatgactct 900 acccccatgt ag 912 <210> 23 <211> 1196 <212> DNA <213> Artificial Sequence <220> <223> Sample 2- Figure 7 <400> 23 aaccgtcaga attgatctac catggactac aaagacgatg acgacaagct tatgactacg 60 tccggcgttc catttggcat gacactacga ccaacacgat ctcggttgtc tcggcgcact 120 ccgtacagta gggatcgtct acctcctttt gagacagaaa cccgcgctac catactggag 180 gatcatccgc tgctgcccga atgtaacact ttgacaatgc acaacgtgag ttacgtgcga 240 ggtcttccct gcagtgtggg atttacgctg attcaggaat gggttgttcc ctgggatatg 300 gttctaacgc gggaggagct tgtaatcctg aggaagtgta tgcacgtgtg cctgtgttgt 360 gccaacattg atatcatgac gagcatgatg atccatggtt acgagtcctg ggctctccac 420 tgtcattgtt ccagtcccgg ttccctgcag tgtatagccg gcgggcaggt tttggccagc 480 tggtttagga tggtggtgga tggcgccatg tttaatcaga ggtttatatg gtaccgggag 540 gtggtgaatt acaacatgcc aaaagaggta atgtttatgt ccagcgtgtt tatgaggggt 600 cgccacttaa tctacctgcg cttgtggtat gatggccacg tgggttctgt ggtccccgcc 660 atgagctttg gatacagcgc cttgcactgt gggattttga acaatattgt ggtgctgtgc 720 tgcagttact gtgctgattt aagtgagatc agggtgcgct gctgtgcccg gaggacaagg 780 cgccttatgc tgcgggcggt gcgaatcatc gctgaggaga ccactgccat gttgtattcc 840 tgcaggacgg agcggcggcg gcagcagttt attcgcgcgc tgctgcagca ccaccgccct 900 atcctgatgc acgattatga ctctaccccc atgtagtcta gaggatcccg ggtggcatcc 960 ctgtgacccc tccccagtgc ctctcctggc cctggaagtt gccactccag tgcccaccag 1020 ccttgtccta ataaaattaa gttgcatcat tttgtctgac taggtgtcct tctataatat 1080 tatggggtgg aggggggggg tatggaacca aggggcaagt tgggaaaaaa acctgaaggg 1140 cctgcgggtc ttattgggaa ccaaactggg agtgcagtgg accaattttg ggttcc 1196 <210> 24 <211> 960 <212> DNA <213> Artificial Sequence <220> <223> pCA14-E1B55K forward <400> 24 aagacaccgg gaccgatcca gcctggggat cttcgagtcg agggatccct cgagtctaga 60 atggagcgaa gaaacccatc tgagcgggga gtacctgctg gattttctgg ccatgcatct 120 gtggagagcg gttgtgagac acaagaatcg cctgctactg ttgtcttccg tccgcccggc 180 gataataccg acggaggagc agcagcagca gcaggaggaa gccaggcggc ggcggcagga 240 gcagagccca tggaacccga gagccggcct ggaccctcgg gaatgaatgt tgtacaggtg gctgaactgt atccagaact gagacgcatt ttgacaatta cagaggatgg gcaggggcta aagggggtaa agggagcg gggggcttgt gaggctacag aggaggctag gaatctagct tttagcttaa tgaccagaca ccgtcctgag tgtattactt ttcaacagat caaggataat tgcgctaatg agcttgatct gctggcgcag aagtattcca tagagcagct gaccacttac tggctgcagc caggggatga ttttgaggag gctattaggg tatatgcaaa ggtggcactt aggccagatt gcaagtacaa gatcagcaaa cttgtaaata tcaggaattg ttgctacatt tctgggaacg gggccgaggt gggtagt acggaggat gggtggcctt taggtagc 720 atgataaata tgtggccgggg ggtgcttggc atggacgggg tggttattat gaatgtaagg tttactggcc ccaattttag cggtacggtt ttcctggcca ataccaacct tatcctacac ggtgttagct tctatgggtt taacaatacc tgtgtggaag cctggaccga tgtaaggggtt cggggctgtg ccttttactg ctgctggaag ggggtggtgt gtcgccccaa aagcagggct 960 <210> 25 <211> 1017 <212> DNA <213> Artificial Sequence <220> <223> pCA14-E1B55K reverse <400> 25 tttggtccaa ccggggatga tttgaggggg cttttgggtt tttgcaaagg tgcccttagg 60 ccagattgca attacaaaat cagcaaactt gtaaatttca ggaattgttg ctacatttct 120 gggaacgggg ccgaggtgga gatagatacg gaggataggg tggcctttag atgtagcatg 180 ataaatatgt ggccgggggt gcttggcatg gacggggtgg ttattatgaa tgtaaggttt 240 actggcccca attttagcgg tacggttttc ctggccaata ccaaccttat cctacacggt 300 gttagcttct atgggtttaa caatacctgt gtggaagcct ggaccgatgt aagggttcgg 360 ggctgtgcct tttactgctg ctggaagggg gtggtgtgtc gccccaaaag cagggcttca 420 attaagaaat gcctctttga aaggtgtacc ttgggtatcc tgtctgaggg taactccagg 480 gtgcgccaca atgtggcctc cgactgtggt tgcttcatgc tagtgaaaag cgtggctgtg 540 attaagcata acatggtatg tggcaactgc gaggacaggg cctctcagat gctgacctgc 600 tcggacggca actgtcacct gctgaagacc attcacgtag ccagccactc tcgcaaggcc 660 tggccagtgt ttgagcataa catactgacc cgctgttcct tgcatttggg taacaggagg 720 ggggtgttcc taccttacca atgcaatttg agtcacacta agatattgct tgagcccgag 780 agcatgtcca aggtgaacct gaacggggtg tttgacatga ccatgaagat ctggaaggtg 840 ctgaggtacg atgagacccg caccaggtgc agaccctgcg agtgtggcgg taaacatatt 900 aggaaccagc ctgtgatgct ggatgtgacc gaggagctga ggcccgatca cttggtgctg 960 gcctgcaccc gcgctgagtt tggctctagc gatgaagata cagattgaaa gcttgtc 1017 <210> 26 <211> 1172 <212> DNA <213> Artificial sequence <220> <223> Primer E1B55K fused with EcoRI sense <400> 26 ccggggggca gtacctgctg gattctctgg ccatgcatct gtggagagcg gttgtgagac 60 acaagaatcg cctgctactg ttgtcttccg tccgcccggc gataataccg acggaggagc 120 agcagcagca gcaggaggaa gccaggcggc ggcggcagga gcagagccca tggaacccga 180 GAGCCGGCCT GGACCCTCGG GAATGATGTG TTACAGGTGG CTGAACCGTA TCCAGAAGCT 240 GAGACGCATT TTGACAATTA CAGAGGATGG GCAGGGGCTA AAGGGGGTAA AGAGGGAGCG 300 GGGGGCTTGT GAGGCTACAG AGGAGGCTAG GAATCTAGC TTTTAGCTTA ATGACCAGAC A 360 CCGTCCTGAG TGTAATACTT TTCAACAGAT CAAGGATAAT TGCGCTAATG AGCTTGATCT 420 GCTGGCGCAG AAGTAATCCA TAGAGCAGCT GACCACCTAC TGGCTGCAGC CAGGGGATGA 480 TTTTGAGGAG GCTAT TAGGGTATAT GCAAAGGTGG CACTTAGGCC AGATTGCAAGT ACAA 540 GATCAGCAAAC TTGTAATATC AGGAATTGTT GCTACATCT CTGGGAACGG GGCCGAGGT 600 GGAGATAGAT ACGGAGGATAG GGTGGCCTTT AGATGTA GCA TGATAAAT ATGTGGCCGGG 660 G GTGCTTGGC ATGGACGGGG TG GTTATTATG AATGTAAGGTTTACTGGCC CCAATTTTAG 720 CGGTACGGTT TTCCTGGCCA ATACCAACCT TATCCTACAC GGTGT TAGCTTCTAT GG GTT 780 TAACAATACC TGTGTGGAAG CCTGGACCGA TGTAAGGGTT CGGGGCTGTG CCTTTTACTG 840 CTGCTGGAAG GGGGTG GTGTGTCGCCC CCAAAGCAGG CTTCAATTAAG AAATGCCTCTT 900 TGAAAGGTGT ACCTTGGGTA TCCTGTCTGA GGGTAAC TCC AGGGTGCGCC ACAATGTGGC 960 CTCCGACTGT GGTTCCTTCA TGCTAGTGAA AAGC TGGCTGTGATTAAGC AT AACATGGT 1020 ATGTGGCAAC TGC GAGGACAG GGCCTCTCAG ATGCTGACCTGCTC G GACGGCAACTGTCA 1080 CCTGCTGAAG ACATTACGT AGCCAGCCCT TTCGCAAGGC TGGCCAGGGT TGAGCATACC 1140 TACTGACCCC CTGTT CCTT GTTTGGGAAA AA 1172 <210> 27 <211> 686 <212> DNA <213> Artificial Sequence <220> <223> PRIMER: E1B55K Internal Primer <400> 27 ACCTGTAA TTGT TTTATT TGGGC GTAGGT CGGGC GTGCTTTTACTGCTGCTGGAAGGGGG 60 TG GTGTGT CG CCCCAA AAGC AGGGCTTCAATTAAGAAATGCCTCTTTGAAAGGTGTACCT 120 TGGGTATCCTGTCTGAGGGTAAC TCC AGGGTGCGCC ACAATGTGGCCTCCGACTGTGGTT 180 GCTT CATGCTAGTGAAAAGC TGGCTGTGATTAAGC AT AACATGGTATGTGGCAACTGC G 240 AGGACAGGGCCTCTCAGATGCTGACCTGCTC G GACGGCAACTGTCACTGCTGAAGACCA 300 ttcacgtagc cagccactct cgcaaggcct ggccagtgtt tgagcataac atactgaccc 360 gctgttcctt gcatttgggt aacaggaggg gggtgttcct accttaccaa tgcaatttga 420 gtcacactaa gatattgctt gagcccgaga gcatgtccaa ggtgaacctg aacggggtgt 480 ttgacatgac catgaagatc tggaaggtgc tgaggtacga tgagacccgc accaggtgca 540 gaccctgcga gtgtggcggt aaacatatta ggaaccagcc tgtgatgctg gatgtgaccg 600 aggagctgag gcccgatcac ttggtgctgg cctgcacccg cgctgagttt ggctctagcg 660 atgaagatac agattgagga tccaga 686 <210> 28 <211> 483 <212> DNA <213> Artificial sequence <220> <223> E1B55K 5' proximal internal reverse primer <400> 28 aaagaattca tggagcgaag aaacccatct gagcggggag tacctgctgg attctctggc 60 catgcatctg tggagagcgg ttgtgagaca caagaatcgc ctgctactgt tgtcttccgt 120 ccgcccggcg ataataccga cggaggagca gcagcagcag caggaggaag ccaggcggcg 180 gcggcaggag cagagcccat ggaacccgag agccggcctg gaccctcggg aatgaatgtt 240 gtacaggtgg ctgaactgta tccagaactg agacgcattt tgacaattac agaggatggg 300 caggggctaa agggggtaaa gagggagcgg ggggcttgtg aggctacaga ggaggctagg 360 aatctagctt ttagcttaat gaccagacac cgtcctgagt gtattacttt tcaacagatc 420 aaggataatt gcgctaatga gctgatctgc gcgcagacgc gccaacaaaa caagagtcca 480 gtc 483 <210> 29 <211> 1246<000103​​​​​​​​​​​​​​​​​​​ ttgttgctac atctctggga acggggccga ggtggagata gatacggagg atagggtggc 360 ctttagatgt agctctggga acggggccga ggtggagata gatacggagg atagggtggc 420 ctttagatgt agctctggga acggggccga ggtggagata gatacggagg atagggtggc 480 ctttagatgt agctttactg gccccaattt tagcggtacg gttttcctgg ccaataccaa 540 ccttatccta cacggtgtta gcttctatgg gtttaacaat acctgtgtgg aagcctggac 600 cgatgtaagg gttcggggct gtgcctttta ctgctgctgg aagggggtgg tgtgtcgccc 660 caaaagcagg gcttcaatta agaaatgcct ctttgaaagg tgtaccttgg gtatcctgtc 720 tgagggtaac tccagggtgc gccacaatgt ggcctccgac tgtggttgct tcatgctagt 780 gaaaagcgtg gctgtgatta agcataacat ggtatgtggc aactgcgagg acagggcctc 840 tcagatgctg acctgctcgg acggcaactg tcacctgctg aagaccattc acgtagccag 900 ccactctcgc aaggcctggc cagtgtttga gcataacata ctgacccgct gttccttgca 960 tttgggtaac aggagggggg tgttcctacc ttaccaatgc aatttgagtc acactaagat 1020 attgcttgag cccgagagca tgtccaaggt gaacctgaac ggggtgtttg acatgaccat 1080 gaagatctgg aaggtgctga ggtacgatga gacccgcacc aggtgcagac cctgcgagtg 1140 tggcggtaaa catattagga accagcctgt gatgctggat gtgaccgagg agctgaggcc 1200 cgatcactlg gtgctggcct gcacccgcgc tgagtttggc ccccgt 1246 <210> 30 <211> 995 <212> DNA <213> Artificial Sequence <220> <223> pcDNA3.1 GRP78 forward <400> 30 tggtggaatt ctgcagatat ccagcacagt ggcggccgct cgagatgaag ctctccctgg 60 tggccgcgat gctgctgctg ctcagcgcgg cgcgggccga ggaggaggac aagaaggagg 120 acgtgggcac ggtggtcggc atcgacctgg ggaccaccta ctcctgcgtc ggcgtgttca 180 agaacggccg cgtggagatc atcgccaacg atcagggcaa ccgcatcacg ccgtcctatg 240 tcgccttcac tcctgaaggg gaacgtctga ttggcgatgc cgccaagaac cagctcacct 300 ccaaccccga gaacacggtc tttgacgcca agcggctcat cggccgcacg tggaatgacc 360 cgtctgtgca gcaggacatc aagttcttgc cgttcaaggt ggttgaaaag aaaactaaac 420 catacattca agttgatatt ggaggtgggc aaacaaagac atttgctcct gaagaaattt 480 ctgccatggt tctcactaaa atgaaagaaa ccgctgaggc ttatttggga aagaaggtta 540 cccatgcagt tgttactgta ccagcctatt ttaatgatgc ccaacgccaa gcaaccaaag 600 acgctggaac tattgctggc ctaaatgtta tgaggatcat caacgagcct acggcagctg 660 ctattgctta tggcctggat aagagggagg gggagaagaa catcctggtg tttgacctgg 720 gtggcggaac cttcgatgtg tctcttctca ccattgacaa tggtgtcttc gaagttgtgg 780 ccactaatgg agatactcat ctgggtggag aagactttga ccagcgtgtc atggaacact 840 tcatcaaact gtacaaaaag aagacgggca aagatgtcag gaaagacaat agagctgtgc 900 agaaactccg gcgcgaggta gaaaaggcca aacgggccct gtcttctcag catcaagcaa 960 gaattgaaat tgagtccttc tatgaaggag aagac 99� <210> 31 <211> l046 <212> DNA <213> Artificial Sequence[[ID=二十九]] [[ID=三十]]<220>[[ID=三十一]] It should be noted that there seems to be an encoding issue with the character "99�" in the original text. It might be a garbled character. This has been translated as best as possible while maintaining the integrity of the original text structure.<223> pcDNA3.1 GRP78 reverse <400> 31 tctatgaagg agaagacttt tctgagaccc tgactcgggc caaatttgaa gagctcaaca 60 tggatctgtt ccggtctact atgaagcccg tccagaaagt gttggaagat tctgatttga 120 agaagtctga tattgatgaa attgttcttg ttggtggctc gactcgaatt ccaaagattc 180 agcaactggt taaagagttc ttcaatggca aggaaccatc ccgtggcata aacccagatg 240 aagctgtagc gtatggtgct gctgtccagg ctggtgtgct ctctggtgat caagatacag 300 gtgacctggt actgcttgat gtatgtcccc ttacacttgg tattgaaact gtgggaggtg 360 tcatgaccaa actgattcca aggaacacag tggtgcctac caagaagtct cagatctttt 420 ctacagcttc tgataatcaa ccaactgtta caatcaaggt ctatgaaggt gaaagacccc 480 tgacaaaaga caatcatctt ctgggtacat ttgatctgac tggaattcct cctgctcctc 540 gtggggtccc acagattgaa gtcacctttg agatagatgt gaatggtatt cttcgagtga 600 cagctgaaga caagggtaca gggaacaaaa ataagatcac aatcaccaat gaccagaatc 660 gcctgacacctgaagaaatcgaaaggatggttaatgatgctgagaagtttgctgaggaag 720 acaaaaagctcaaggagcgcattgatactagaatgagttggaaagctatgcctattctc 780 taaagaatcagattggagataaagaaaagctgggaggtaaactttcctctgaagataagg 840 agaccatggaatgaaagctgta gaagaaaagattgaatggctggaaagccaccaagatgctg 900 acattgaagacttcaaagct aagaagaaggaactggaaga aattgttcaaccaattatca 960 gcaaactctatggaagtgca ggccctcccccaactggtgaagaggatacagcagaaaaag 1020 atgagttgtagtctagagtc ccgtaa 1046

Claims

1. Mesenchymal stem cells for delivery of an oncolytic adenovirus, wherein the mesenchymal stem cells have introduced a telomerase reverse transcriptase (TERT) gene and an ElB55K gene, the ElB55K gene expressing regulated by a doxycycline or tetracycline-based Tet-one system such that the ElB55K gene is expressed after the mesenchymal stem cells are introduced into the body.

2. The mesenchymal stem cells of claim 1, wherein a glucose-regulated protein 78 (GRP78) gene is additionally introduced.

3. The mesenchymal stem cells of claim 1, wherein the mesenchymal stem cells are of human origin.

4. The mesenchymal stem cells of claim 1, wherein the mesenchymal stem cells are from umbilical cord blood, bone marrow, or fat.

5. A composition for delivery of an anticancer gene comprising the mesenchymal stem cells of any one of claims 1-2 and an oncolytic adenovirus.

6. The composition of claim 5, wherein the cancer is a gastric cancer, a lung cancer, a breast cancer, an ovarian cancer, a liver cancer, a bronchial cancer, a nasopharyngeal cancer, a laryngeal cancer, a pancreatic cancer, a biliary tract cancer, a bladder cancer, a colorectal cancer, a colon cancer, a cervical cancer, a brain cancer, a prostate cancer, a bone cancer, a head and neck cancer, a skin cancer, a kidney cancer, a polyploid cancer, a thyroid cancer, a parathyroid cancer, or a ureter cancer.

7. A pharmaceutical composition for treating a cancer comprising the mesenchymal stem cells of any one of claims 1-2 and an oncolytic adenovirus.

8. The pharmaceutical composition of claim 7, wherein the cancer is a gastric cancer, a lung cancer, a breast cancer, an ovarian cancer, a liver cancer, a bronchial cancer, a nasopharyngeal cancer, a laryngeal cancer, a pancreatic cancer, a biliary tract cancer, a bladder cancer, a colorectal cancer, a colon cancer, a cervical cancer, a brain cancer, a prostate cancer, a bone cancer, a head and neck cancer, a skin cancer, a kidney cancer, a polyploid cancer, a thyroid cancer, a parathyroid cancer, or a ureter cancer.

Citation Information

Patent Citations

  • Control device and method for optimizing indoor air quality

    KR1020200139918A

  • Mesenchymal stem cell line capable of adenoviral infection and replication

    KR102169798B1

  • Mesenchymal stem cells that provide improved tumour targeting and mass production of viruses

    RU2846551C1

  • Mesenchymal stem cell line in which infection and replication of adenovirus are enabled

    WO2019235771A1

  • KR20220056148A