Chimera ts cas12a protein and methods of making and using same
By combining the functional domains of the Cas12a protein to design a chimeric TsCas12a protein, the problem of Cas12a protein activity inhibition in the presence of high concentrations of PEG and detergent was solved, achieving high sensitivity and high precision molecular detection and expanding the application of CRISPR/Cas nucleic acid detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-25
- Publication Date
- 2026-04-07
AI Technical Summary
The activity of the existing Cas12a protein is inhibited in systems containing high concentrations of PEG, nonionic detergents, and reducing agents, which limits its application in isothermal amplification systems and simple one-tube detection methods.
Chimeric TsCas12a proteins were designed by combining the functional domains of different Cas12a proteins to form chimeras with high sensitivity and precision, which can maintain activity under these conditions, including combinations of functional domains such as Wedgeregion I, Recognition domain I, Recognition domain II, and PAM-interacting domain.
It enables highly sensitive and accurate molecular detection in systems containing high concentrations of PEG, nonionic detergents, and reducing agents, supporting the application of CRISPR/Cas nucleic acid detection systems.
Smart Images

Figure CN116284436B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and in particular to a chimeric TsCas12a protein, its preparation method, and its applications. Background Technology
[0002] The CRISPR / Cas system is an acquired immune system in prokaryotes used to resist the invasion of foreign genetic elements present in bacteriophages or plasmids. It is a defense mechanism present in most bacteria and all archaea to destroy foreign plasmid or bacteriophage DNA. It is now widely used in genetic engineering, such as in gene editing and molecular diagnostic techniques.
[0003] In molecular diagnostics, the application of Cas12 proteins is particularly widespread and important. The CRISPR / Cas12 system, such as the Cas12a protein, can recognize target dsDNA under crRNA guidance and target T-rich PAM sites for specific cleavage of the target sequence, while also exhibiting non-specific cleavage activity of ssDNA. Molecular diagnostic technologies developed based on Cas12 include DETECTR and HOLMES, with HOLMES further upgraded to HOLMES V2 by replacing Cas12a with Cas12b.
[0004] The three methods described above are similar in principle, with the main difference being the choice of target amplification method. Generally speaking, molecular diagnostic technologies based on Cas12 first amplify and enrich the target nucleic acid using isothermal (RPA or LAMP) or temperature-dependent (PCR) methods; then, the amplification product binds to Cas12-crRNA, activating the Cas12's accessory cleavage function to cleave the ssDNA fluorescent probe, releasing the fluorescent group and forming a detection signal.
[0005] However, studies have shown that there are significant differences among Cpf1 / Cas12a proteins within the same family, with some family members being inactive. The most commonly used Cas12a protein currently is lbaCas12a, whose activity is severely inhibited in systems containing high concentrations of PEG, nonionic detergents, and reducing agents, sometimes even rendering it inoperable. This limits the simultaneous operation of Cas12a proteins with various isothermal amplification systems and poses considerable challenges to the development of simple one-tube methods for isothermal amplification and Cas12a detection. Summary of the Invention
[0006] Therefore, it is necessary to provide a chimeric TsCas12a protein to address the above problems. This chimeric TsCas12a protein can achieve highly sensitive and accurate molecular detection in systems containing high concentrations of PEG, nonionic detergents, and reducing agents.
[0007] The present invention discloses a chimeric TsCas12a protein comprising an active region composed of functional fragments of the amino acid sequences shown in SEQ ID NO.1-SEQ ID NO.11 linked together in sequence.
[0008] The aforementioned chimeric TsCas12a protein contains the following functional fragments in sequence: Wedgeregion I (WED I) region shown in SEQ ID NO.1, Recognition domain I (REC1) region shown in SEQ ID NO.2, Recognition domain II (REC2(Lb)) region shown in SEQ ID NO.3, Wedge region II (WED II) region shown in SEQ ID NO.4, PAM-interacting domain (PI) region shown in SEQ ID NO.5, Wedge region III (WED III) region shown in SEQ ID NO.6, RuvC I region shown in SEQ ID NO.7, Bridge helix (BH) region shown in SEQ ID NO.8, RuvC II region shown in SEQ ID NO.9, Nuclease domain (Nuc(Lb)) region shown in SEQ ID NO.10, and RuvC-III region shown in SEQ ID NO.11.
[0009] The functional domains constituting the chimera are all derived from different Cas12a proteins and have high structural homology. Based on the inventors' previous practical work, the model was simulated by computer, and the results of experimental tests were combined to adjust the simulation model. The chimeric TsCas12a protein can achieve highly sensitive and accurate molecular detection in systems containing high concentrations of PEG, non-ionic detergents, and reducing agents.
[0010] In one embodiment, the chimeric TsCas12a protein comprises the amino acid sequence shown in SEQ ID NO. 12. The chimeric TsCas12a protein constructed with this amino acid sequence exhibits good activity.
[0011] The present invention also discloses a nucleotide encoding the above-mentioned chimeric TsCas12a protein, comprising the following nucleotide sequence:
[0012] A) Composed of nucleotide sequences encoding the aforementioned active region fragments; or
[0013] B) A protein whose nucleotide sequence encodes the same sequence as A), but whose nucleotide sequence differs from A's due to the degeneracy of the genetic code; or
[0014] C) A nucleotide sequence modified by substitution, deletion, or addition of one or more bases in the non-conservative region of the nucleotide sequence shown in A) or B) above.
[0015] In one embodiment, the nucleotide comprises the nucleotide sequence shown in SEQ ID NO. 13. It is understood that other sequences can be used for the nucleotides of the chimeric TsCas12a protein, provided that their nucleotide codons can be translated to yield the same chimeric TsCas12a protein; however, the nucleotide sequence shown in SEQ ID NO. 13 has shown good performance.
[0016] The present invention also discloses an expression vector containing the aforementioned nucleotides. It is understood that this expression vector can be any vector commonly used in the art, capable of translating and expressing the nucleotides to obtain the predetermined chimeric TsCas12a protein.
[0017] The present invention also discloses a method for preparing the above-mentioned chimeric TsCas12a protein, comprising the following steps: introducing the above-mentioned nucleotides into an expression vector and transferring them into a prokaryotic expression system for expression, thereby obtaining the protein.
[0018] In one embodiment, the expression vector is a pET-28-ccdB-CmR vector, the prokaryotic expression system is an Escherichia coli expression system, and after the TsCas12a protein is expressed in the prokaryotic expression system, the protein is further purified by gel chromatography.
[0019] This invention also discloses the application of the above-mentioned chimeric TsCas12a protein in a CRISPR / Cas nucleic acid detection system.
[0020] The present invention also discloses a reagent system for CRISPR / Cas nucleic acid detection, comprising gRNA for targeting the target sequence and the aforementioned chimeric TsCas12a protein.
[0021] In one embodiment, the reagent system further includes an additive selected from at least one of PEG, detergent, and reducing agent.
[0022] The reducing agents mentioned above refer to a class of reagents that are easily oxidized and can be used to reduce disulfide bonds in proteins, including dithiothreitol and 2-mercaptoethanol.
[0023] In one embodiment, the adjuvant is selected from: PEG 8000 (mass-volume ratio) at a working concentration of 0.1-5 g / 100 ml, Triton X100 at a working concentration of 0.1-2 v / v%, NP40 at a working concentration of 0.1-2 v / v%, Tween20 at a working concentration of 0.1-2 v / v%, and DTT at a working concentration of 0.1-10 mM.
[0024] Compared with the prior art, the present invention has the following beneficial effects:
[0025] The present invention discloses a chimeric TsCas12a protein, which is obtained by using different functional domains of Cas12 proteins through computer simulation and repeated adjustment tests. This chimeric TsCas12a protein can tolerate high concentrations of PEG, non-ionic detergents and reducing agents, and can be used as a novel CRISPR / TsCas12a system in nucleic acid detection, providing a new and necessary tool for Cas12a-based nucleic acid molecular detection.
[0026] Furthermore, this nucleic acid detection system based on the TsCas12a protein can achieve highly sensitive and accurate molecular detection in systems containing high concentrations of PEG, non-ionic detergents, and reducing agents, which will facilitate the development of this novel CRISPR / TsCas12a system in conjunction with various other one-step isothermal amplification methods. Attached Figure Description
[0027] Figure 1 The results of room temperature activity assays for different chimeric TsCas12a proteins were designed.
[0028] Figure 2 The results of 65℃ activity assays for different chimeric TsCas12a proteins were obtained.
[0029] Figure 3 The results of TsCas12a gene fragment amplification;
[0030] M: DNA Marker; 1: TsCas12a amplified fragment; 2: TsCas12a amplified fragment.
[0031] Figure 4 Design diagram of TsCas12a protein particles;
[0032] Figure 5 Results of TsCas12a protein expression;
[0033] M: protein marker; 1 and 2 are the electrophoresis results of TsCas12a protein expression.
[0034] Figure 6The results show the purification of TsCas12a protein.
[0035] M: protein marker; 1: TsCas12a purified protein (10 pmol).
[0036] Figure 7 The results of nucleic acid testing of TsCas12a in a normal system.
[0037] Figure 8 The results of nucleic acid detection of TsCas12a in a system containing 5g / 100ml PEG-8K are presented.
[0038] Figure 9 The results of nucleic acid detection of TsCas12a in a system containing 2v / v% Tritonx-100.
[0039] Figure 10 The results of nucleic acid detection of TsCas12a in a system containing 2v / v% NP-40.
[0040] Figure 11 The results of nucleic acid detection of TsCas12a in a system containing 2v / v% Tween-20.
[0041] Figure 12 The results are for nucleic acid detection of TsCas12a in a system containing 10 mM DTT. Detailed Implementation
[0042] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.
[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0044] Unless otherwise specified, all reagents used in the following examples are commercially available; and all methods used in the following examples are conventional methods unless otherwise specified.
[0045] Isopropyl thio-D-galactoside (IPTG) used in the following examples was purchased from Sigma-Aldrich. NiSepharose FF was purchased from GE Healthcare. Protein purification consumables were purchased from BorgL Optoelectronics. Amicon 4 30kDa ultrafiltration tubes were purchased from Millipore. Phusion DNA polymerase, restriction endonucleases, and T4 ligase were purchased from Thermo Fisher Scientific. PCR clean-up and gel extraction kits were purchased from Qiagen Biotechnology. Gene fragments were synthesized by Anhui General Biotechnology Co., Ltd.
[0046] The term "gRNA" refers to guide RNA, which guides the Cas protein to specifically bind to the target DNA sequence.
[0047] The term "Cas12a" (formerly "Cpf1") refers to a crRNA-dependent endonuclease, which is a type VA enzyme in the CRISPR system.
[0048] The term "PAM" refers to the protospacer adjacent motif, which is an important component of the CRISPR / Cas system for specifically recognizing target DNA.
[0049] The design principle of the gRNA used in this invention is as follows: when selecting the gRNA target sequence, the 5' end of the target sequence should have a 5'-TTTN-3' sequence, and the target sequence itself, the target sequence and the other sequences should not form a stable secondary structure.
[0050] In the following examples, the CRISPR / TsCas12a-based nucleic acid detection method is as follows: The nucleic acid sample to be tested, TsCas12a protein, gRNA, a non-specific single-stranded fluorescent probe, and the required reaction buffer are mixed to form a reaction system for detection. Specifically, the reaction system is placed in a qPCR instrument (Tianlong) for fluorescence analysis, with the fluorescence value of the reaction wells read at an excitation wavelength of 530 nm and an emission wavelength of 580 nm.
[0051] More specifically, the detection system includes: 2 μl DNA amplification product, 20 nM TsCas12a, 22.5 nM gRNA, 100 nM nonspecific single-stranded DNA fluorescent probe, and detection buffer. The final concentration (i.e., working concentration) of each component of the buffer in the detection system is: 20 mM Tris, 60 mM NaCl, 10 mM MgCl2, pH 7.3. The reaction conditions are 37 °C for 90 min.
[0052] Example 1
[0053] Computer simulation was used to design the chimeric TsCas12a protein.
[0054] Using LbCas12a (Lachnospiraceae bacterium) as a template, the researchers performed multiple sequence alignment screening to analyze Cas12a sequences from different sources. Through structural prediction, they decomposed different functional domains in different sequences.
[0055] Based on this, after combining the sequences, the sequence that is closest to the parameters of LbCas12a (Lachnospiraceaebacterium) is identified through structural prediction.
[0056] The researchers initially sought to find a Cas12a sequence that could withstand 60-70°C. In the process, they unexpectedly discovered that the new sequence had excellent anti-inhibitory effects against substances such as PEG.
[0057] Following the above method, multiple chimeric TsCas12a proteins were designed, and recombinant proteins were expressed, purified, and tested for activity using E. coli. The protein design was then adjusted based on the activity test results. Some of the designed chimeric TsCas12a proteins and their activity testing methods are as follows.
[0058] 1. Experimental Methods
[0059] 1) Cas system preparation: Prepare the Cas system according to the formula in the table below, and perform fluorescence testing on a microplate reader (room temperature) or a macroporous PCR instrument.
[0060] Table 1. Cas system
[0061]
[0062]
[0063] Note: The ASFV-F4 RPA product is the RPA amplification product of the African swine fever virus DNA genome sequence fragment (SEQ ID NO.14) at a concentration of 0.1 ng / μL. The ASFV-F4 gRNA is the gRNA (SEQ ID NO.15) that targets the above amplification product.
[0064] When using the microplate reader, LbCas12a protein (purchased from NEB, catalog number M0653S) was used as the control group, and Cas12a protein was tested at doses of 0.5, 1, and 2 μg / system, respectively.
[0065] 2. Experimental Results
[0066] 2.1 Results of room temperature reaction (ELISA reader): Cas protein was tested at concentrations of 0.5, 1, and 2 μg / system, respectively.
[0067] The results are as follows Figure 1 As shown, A and G represent the signal values obtained by measuring the changes of different proteins at room temperature over time. The results show that OGE72552.1 ( Figure 1 B) and PIN99799.1 Figure 1 D) It is reactive at room temperature, and PIN99799.1 exhibits activity even at low concentrations.
[0068] 2.2 65℃ reaction results (PCR instrument): Cas protein was tested at concentrations of 1, 2, and 3 μg / system.
[0069] The results are as follows Figure 2 As shown, A and G represent the signal values obtained by testing the changes of different proteins at 65℃ over time. Figure 2 The protein in group B is active at room temperature; therefore, during the PCR instrument heating process, the positive group exhibited weak cleavage activity, leading to an increase in background. However, no fluorescence growth trend was observed at 65°C, indicating inactivation at that temperature. The results show that the aforementioned protein is inactive at 65°C.
[0070] Table 2. Results of activity assays for the designed chimeric TsCas12a protein
[0071]
[0072] Note: A280 refers to the protein concentration detected by 280nm ultraviolet light.
[0073] Of the proteins mentioned above, the sequence of HCC23018.1 is shown in SEQ ID NO.16, the sequence of OGE72552.1 is shown in SEQ ID NO.17, the sequence of PIN76207.1 is shown in SEQ ID NO.18, the sequence of PIN99799.1 is shown in SEQ ID NO.19, the sequence of PSO43265.1 is shown in SEQ ID NO.20, the sequence of PWM1415.1 is shown in SEQ ID NO.21, and the sequence of WP115006085 is shown in SEQ ID NO.22.
[0074] Among the proteins mentioned above, OGE72552.1 and PIN99799.1 exhibited significant accessory cleavage activity. Sequence analysis revealed consecutive Wedge region I (WED I), Recognition domain I (REC1), Wedge region II (WED II), PAM-interacting domain (PI), Wedge region III (WED III), RuvC I, and Bridge helix (BH) regions in these two sequences, respectively.
[0075] The above-mentioned Domain was fused with LbaCas12a to obtain a new TsCas12a sequence, which is the chimeric TsCas12a protein with the amino acid sequence shown in SEQ ID NO.12. In further experimental exploration, it was unexpectedly discovered that the chimeric TsCas12a protein can tolerate high concentrations of PEG, non-ionic detergents and reducing agents. Based on this, its performance in tolerating detergents was verified by experiments.
[0076] Example 2
[0077] Cloning and expression of the TsCas12a gene.
[0078] 1. PCR amplification of the TsCas12a sequence
[0079] (1) The full-length chimeric TsCas12a gene fragment as shown in SEQ ID NO.13 was artificially synthesized (commissioned to Anhui General Biosynthesis).
[0080] (2) Design primers
[0081] Upstream and downstream primers were designed based on the TsCas12a sequence.
[0082] Upstream primer: catatggcggccgcaatgca (SEQ ID NO.23);
[0083] Downstream primer: ctcgagggcgcgcctagccctt (SEQ ID NO.24).
[0084] (3) PCR amplification
[0085] Using the aforementioned upstream and downstream primers, the target fragment was amplified by PCR using high-fidelity DNA polymerase (Phusion DNA polymerase) at different annealing temperatures. The results are attached. Figure 3 As shown, the target PCR band is approximately 3800 bp.
[0086] 2. Construction of recombinant plasmid pET-28a-TsCas12a
[0087] (1) Purification of PCR amplification products: The PCR amplification products were purified using a purification kit (Clean up kit) from Qiagen.
[0088] (2) Double digestion was performed using Thermo's rapid restriction endonucleases NcoI and XhoI;
[0089] (3) The enzyme digestion products were purified and recovered using the Qiagen MiniElute kit.
[0090] (4) The purified and recovered product was ligated into the pET28a-ccdB-CmR vector, which had also undergone double digestion with NcoI and XhoI, to obtain the recombinant plasmid pET-28a-TsCas12a; its design diagram is shown below. Figure 4 As shown.
[0091] The pET-28-ccdB-CmR vector used was preserved in our laboratory. It was based on the prokaryotic expression vector pET28a (purchased from Bioon distributor), and was modified by adding the NotI-ccdB-CmR-AscI sequence between the Hind III and Xho I restriction sites according to conventional methods to prepare the pET-28-ccdB-CmR vector.
[0092] 3. Identification of recombinant plasmid pET-28a-TsCas12a
[0093] To verify the correctness of the pET-28a-TsCas12a recombinant vector, we performed enzyme digestion and sequencing on the recombinant plasmid pET-28a-TsCas12a.
[0094] Enzyme digestion identification was performed using single digestion with Asc I or NotI and double digestion with Asc I or NotI, respectively. The experimental results showed that the size of the digestion products in all experimental groups was consistent with the expectation, so it can be preliminarily determined that the vector we obtained is the correct pET-28a-TsCas12a vector.
[0095] In addition, sequencing results also showed that the TsCas12a sequence was correctly cloned into pET28a.
[0096] 4. Prokaryotic expression of TsCas12a protein
[0097] (1) The correctly identified recombinant plasmid pET-28a-TsCas12a was transformed into the BL21(DE3) expression strain (purchased from Transgen). The recombinant strain was obtained after positive identification.
[0098] (2) Pick single clones of the recombinant bacteria and incubate them overnight at 37°C in 50 mL LB medium. Inoculate the overnight bacteria into 1 L LB medium at a 1:100 inoculation rate and incubate at 37°C until OD600 = 0.6. Incubate in an ice-water bath for 30 min, add IPTG to a final concentration of 0.5 mM, and continue incubation at 15°C for 4 h. Collect the bacterial cells by centrifugation and store at -80°C.
[0099] 5. Detect and optimize TsCas12a protein expression.
[0100] The recombinant plasmid pET-28a-TsCas12a was transformed into BL21(DE3), and protein expression was induced at 37℃ with 0.2 mM IPTG. The expressed bacterial cells were then analyzed by electrophoresis. The results are as follows: Figure 5 As shown, this indicates that the TsCas12a protein was obtained.
[0101] Example 3
[0102] Purification of TsCas12a protein
[0103] 1. Purification method of TsCas12a protein
[0104] After induction, the bacterial culture was centrifuged, and the bacterial resuspended in lysis buffer. The culture was then sonicated (70% amplitude, 2s On / 4s Off, 3 minutes, Sonics 750W sonicator), and the supernatant was separated by centrifugation. The protein lysis supernatant was loaded onto an equilibrated Ni Sepharose FF column, and impurities were washed away with lysis buffer greater than 30 column volumes. Elution buffer was then applied, and the protein was purified using a Superdex 200, Tricorn 10 / 300 gel chromatography column. SDS-PAGE analysis was performed after elution to observe the results and the purified Cas12a protein. The lysis buffer contained 50 mM Tris-HCl, pH 8.0, 300 mM NaCl, 5% glycerol, and 20 mM imidazole. The elution buffer contained 50 mM Tris-HCl, pH 8.0, 300 mM NaCl, 5% glycerol, and 250 mM imidazole.
[0105] The obtained protein was diluted three-fold with 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, and 5% glycerol, and concentrated using a 30 kDa ultrafiltration tube. After adding glycerol to a final concentration of 50%, it was aliquoted and flash-frozen in liquid nitrogen at -80°C.
[0106] 2. Results of TsCas12a protein purification
[0107] After optimizing the purification steps, a large-scale purification was performed again, and the target band was approximately 130 kDa. (See attached image) Figure 6 As shown, the purification purity and yield are relatively high.
[0108] Example 4
[0109] Activity detection of TsCas12a based on the CRISPR / Cas12a system.
[0110] 1. Preparation of target nucleic acid fragments
[0111] The target nucleic acid fragment can be amplified by PCR amplification, recombinase polymerase amplification (RPA), NASBA isothermal amplification or loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), helicase-dependent amplification (HDA), and nicking enzyme amplification reaction (NEAR). The following example uses recombinase polymerase amplification.
[0112] Recombinase Polymerase Amplification (RPA): RPA primers were designed using NCBI Primer blast, with amplified fragment size of 80-120 nt. The denaturation temperature of the primers could be 54-67℃, the length was 30-35 nt, and the GC content in the primers was 40-60%. DNA primers were synthesized according to the designed sequence. Primer synthesis was outsourced to Shanghai Jierui Biotechnology Co., Ltd.
[0113] Template sequence:
[0114] TTATCTTAAAAAATTACAGGATATTTATAAGAAGCTTGAGGGTCACCCCTTTCTTTTTAGTCCGTCGAAAACCAATGAAAAAGAGTTTATTACTCTGCTAAACCAAGCCTTGGCCTCGACGCAGCTTTACCGCAGCATACAACAGCTGTTTTTAACGATGTATA AGCTAGATCCCATTGGGTTTGTTAACTATATTAAAGCGAGTAAACAAGAGTATTTATGTCTGTTGATTAATCCTAAACTAGTCACTAAGTTTTTAAAAATAACGAGCTTTAAAATTTACATTAATTTCAGGCTAAAAACTTTCTATATAAGTCCTAATAA(SEQ ID NO.25).
[0115] Primer sequences:
[0116] Upstream primer: TACTCTGCTAAACCAAGCCTTGGCCTCGAC (SEQ ID NO.26)
[0117] Downstream primer: CTCTTGTTTACTCGCTTTAATATAGTTAAC (SEQ ID NO.27)
[0118] Refer to each Basic and The RPA reaction was performed using the BasicRT (TwistDx) kit at 37°C for 30 minutes.
[0119] The product after the reaction was completed was separated and purified using a gel (using the MinElute gel extraction kit (Qiagen)). The purified dsDNA is the target product.
[0120] 2. gRNA design
[0121] gRNA primer sequence design principles: When selecting a target sequence, the 5' end of the target sequence should have a 5'-TTTN-3' sequence; and the target sequence itself, the target sequence itself, and other sequences should not form stable secondary structures. Online software at http: / / www.rgenome.net / cas-designer / can be used to assist in the design process.
[0122] TsCas12a protein recognition does not require tracrRNA, only crRNA. Its gRNA design only requires a crRNA framework and a target sequence, resulting in the following gRNA.
[0123] gRNA sequence: TAATTTCTACTAAGTGTAGATACGATGTATAAGCTAGATCC (SEQ ID NO.28)
[0124] 3. TsCas12a activity detection
[0125] The detection system includes: 2 μl RPA product, 20 nM purified TsCas12a, 22.5 nM gRNA, 100 nM reporter ssDNA strand that fluoresces upon TsCas12a cleavage (i.e., non-specific single-stranded DNA fluorescent probe (DNAseAlert QCSystem Thermo Scientific)), 0.5 μl RNase inhibitor (Promega), and detection buffer (20 mM Tris, 60 mM NaCl, 10 mM MgCl2, pH 7.3).
[0126] A CRISPR / LbaCas12a system (purchased from NEB, catalog number M0653S) was set up as a control group. The detection system included 2 μl RPA product, 45 nM purified LbCas12a, 22.5 nM gRNA, 100 nM reporter DNA strand that can fluoresce upon Cas12a digestion, i.e., a non-specific single-stranded DNA fluorescent probe (DNAseAlert QC System Thermo Scientific), 0.5 μl RNase inhibitor (Promega), and detection buffer (20 mM Tris, 60 mM NaCl, 10 mM MgCl2, pH 7.3).
[0127] The reaction system was placed in a qPCR instrument (Tianlong) and reacted at 37℃ for 90 min. Fluorescence dynamics detection was performed once every 1 minute.
[0128] Test results as follows Figure 7 As shown, TsCas12a also has the same gRNA-mediated specific recognition of target sequences and non-specific single-stranded DNA cleavage activity as LbaCas12a.
[0129] Example 5
[0130] Activity assay of the TsCas12a system in a reaction system containing 5% PEG 8K.
[0131] The detection system includes: 2 μl RPA product, 20 nM purified TsCas12a, 22.5 nM gRNA, 100 nM reporter ssDNA strand that fluoresces upon TsCas12a cleavage (i.e., non-specific single-stranded DNA fluorescent probe (DNAseAlert QCSystem Thermo Scientific)), 0.5 μl RNase inhibitor (Promega), and detection buffer (20 mM Tris, 60 mM NaCl, 10 mM MgCl2, 5 g / 100 ml PEG 8K, pH 7.3). Meanwhile, a CRISPR / LbaCas12a system was set up as a control group. The detection system included 2 μl of RPA product, 45 nM of purified LbCas12a, 22.5 nM gRNA, 100 nM of reporter DNA strand that can emit fluorescence when Cas12a is cut, i.e., a non-specific single-stranded DNA fluorescent probe (DNAseAlert QC System ThermoScientific), 0.5 μl of RNase inhibitor (Promega), and detection buffer (20 mM Tris, 60 mM NaCl, 10 mM MgCl2, 5 g / 100 ml PEG 8K, pH 7.3).
[0132] The reaction system was placed in a qPCR instrument (Tianlong) and reacted at 37°C for 1 hour, with fluorescence dynamics detection every minute.
[0133] Test results as follows Figure 8 As shown, LbaCas12a lost its detection activity in the 5g / 100ml PEG 8K system, while the detection results of TsCas12a were not affected by 5g / 100ml PEG 8K.
[0134] Example 6
[0135] Activity assay of the TsCas12a system in a reaction system containing 2% Triton X100.
[0136] The detection system includes: 2 μl RPA product, 20 nM purified TsCas12a, 22.5 nM gRNA, 100 nM reporter ssDNA strand that fluoresces upon TsCas12a cleavage (i.e., non-specific single-stranded DNA fluorescent probe (DNAseAlert QCSystem Thermo Scientific)), 0.5 μl RNase inhibitor (Promega), and detection buffer (20 mM Tris, 60 mM NaCl, 10 mM MgCl2, 2 v / v% Triton X100, pH 7.3). Meanwhile, a CRISPR / LbaCas12a system was set up as a control group. The detection system included 2 μl RPA product, 45 nM purified LbCas12a, 22.5 nM gRNA, 100 nM reporter DNA strand that can emit fluorescence upon Cas12a cleavage, i.e., a non-specific single-stranded DNA fluorescent probe (DNAseAlert QC System Thermo Scientific), 0.5 μl RNase inhibitor (Promega), and detection buffer (20 mM Tris, 60 mM NaCl, 10 mM MgCl2, 2 v / v% Triton X100, pH 7.3).
[0137] The reaction system was placed in a qPCR instrument (Tianlong) and reacted at 37℃ for 90 min. Fluorescence dynamics detection was performed once every 1 minute.
[0138] Test results as follows Figure 9 As shown, LbaCas12a loses its detection activity in a 2v / v% Triton X100 system, while the detection results of TsCas12a are not affected by 2v / v% Triton X100.
[0139] Example 7
[0140] Activity assay of the TsCas12a system in a reaction system containing 2% NP40.
[0141] The detection system includes: 2 μl RPA product, 20 nM purified TsCas12a, 22.5 nM gRNA, 100 nM reporter ssDNA strand that fluoresces upon TsCas12a cleavage, i.e., a non-specific single-stranded DNA fluorescent probe (DNAseAlert QCSystem Thermo Scientific), 0.5 μl RNase inhibitor (Promega), and detection buffer (20 mM Tris, 60 mM NaCl, 10 mM MgCl2, 2 v / v % NP40, pH 7.3). Meanwhile, a CRISPR / LbaCas12a system was set up as a control group. The detection system included 2 μl RPA product, 45 nM purified LbCas12a, 22.5 nM gRNA, 100 nM reporter DNA strand that can emit fluorescence when Cas12a is cut, i.e., a non-specific single-stranded DNA fluorescent probe (DNAseAlert QC System ThermoScientific), 0.5 μl RNase inhibitor (Promega), and detection buffer (20 mM Tris, 60 mM NaCl, 10 mM MgCl2, 2% NP40, pH 7.3).
[0142] The reaction system was placed in a qPCR instrument (Tianlong) and reacted at 37℃ for 90 min. Fluorescence dynamics detection was performed once every 1 minute.
[0143] Test results as follows Figure 10 As shown, the activity of LbaCas12a was inhibited in the 2v / v%NP40 system, while the detection results of TsCas12a were not affected by 2v / v%NP40.
[0144] Example 8
[0145] Activity assay of TsCas12a system in reaction system containing 2% Tween 20
[0146] The detection system includes: 2 μl RPA product, 20 nM purified TsCas12a, 22.5 nM gRNA, 100 nM reporter ssDNA strand that fluoresces upon TsCas12a cleavage (i.e., non-specific single-stranded DNA fluorescent probe (DNAseAlert QCSystem Thermo Scientific)), 0.5 μl RNase inhibitor (Promega), and detection buffer (20 mM Tris, 60 mM NaCl, 10 mM MgCl2, 2 v / v% Tween 20, pH 7.3). Meanwhile, a CRISPR / LbaCas12a system was set up as a control group. The detection system included 2 μl RPA product, 45 nM purified LbCas12a, 22.5 nM gRNA, 100 nM reporter DNA strand that can emit fluorescence when Cas12a is cut, i.e., a non-specific single-stranded DNA fluorescent probe (DNAseAlert QC System ThermoScientific), 0.5 μl RNase inhibitor (Promega), and detection buffer (20 mM Tris, 60 mM NaCl, 10 mM MgCl2, 2% Tween 20, pH 7.3).
[0147] The reaction system was placed in a qPCR instrument (Tianlong) and reacted at 37℃ for 90 min. Fluorescence dynamics detection was performed once every 1 minute.
[0148] Test results as follows Figure 11 As shown, the activity of LbaCas12a was inhibited in the 2v / v% Tween20 system, while the detection results of TsCas12a were not affected by 2v / v% Tween20.
[0149] Example 9
[0150] Activity assay of the TsCas12a system in a reaction system containing 10 mM DTT
[0151] The detection system includes: 2 μl RPA product, 20 nM purified TsCas12a, 22.5 nM gRNA, 100 nM reporter ssDNA strand that fluoresces upon TsCas12a cleavage (i.e., non-specific single-stranded DNA fluorescent probe (DNAseAlert QCSystem Thermo Scientific)), 0.5 μl RNase inhibitor (Promega), and detection buffer (20 mM Tris, 60 mM NaCl, 10 mM MgCl2, 10 mM DTT, pH 7.3). Meanwhile, a CRISPR / LbaCas12a system was set up as a control group. The detection system included 2 μl RPA product, 45 nM purified LbCas12a, 22.5 nM gRNA, 100 nM reporter DNA strand that can emit fluorescence when cleaved by TsCas12a, i.e., a non-specific single-stranded DNA fluorescent probe (DNAseAlert QC System ThermoScientific), 0.5 μl RNase inhibitor (Promega), and detection buffer (20 mM Tris, 60 mM NaCl, 10 mM MgCl2, 10 mM DTT, pH 7.3).
[0152] The reaction system was placed in a qPCR instrument (Tianlong) and reacted at 37℃ for 90 min. Fluorescence dynamics detection was performed once every 1 minute.
[0153] Test results as follows Figure 12 As shown, the detection results of LbaCas12a and TsCas12a were not affected by 10mM DTT.
[0154] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0155] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A chimeric TsCas12a protein, characterized in that, The amino acid sequence of the chimeric TsCas12a protein is shown in SEQ ID NO.
12.
2. A nucleic acid encoding the chimeric TsCas12a protein of claim 1, characterized in that, It contains the following nucleic acid sequences: A) The nucleic acid sequence encoding the chimeric TsCas12a protein of claim 1; or B) is a protein whose nucleic acid sequence encodes the same sequence as A), but is different from A)'s nucleic acid sequence due to the degeneracy of the genetic code.
3. The nucleic acid according to claim 2, characterized in that, It contains the nucleic acid sequence shown in SEQ ID NO.
13.
4. An expression carrier, characterized in that, It contains the nucleic acid as described in claim 2 or 3.
5. A method for preparing the chimeric TsCas12a protein according to claim 1, characterized in that, The procedure includes the following steps: introducing the nucleic acid described in claim 2 or 3 into an expression vector and then expressing it in a prokaryotic expression system.
6. The preparation method according to claim 5, characterized in that, The expression vector is pET-28-ccdB-CmR vector, and the prokaryotic expression system is an Escherichia coli expression system. After the TsCas12a protein is expressed in the prokaryotic expression system, the protein is further purified by gel chromatography.
7. The application of the chimeric TsCas12a protein according to claim 1 in the preparation of a CRISPR / Cas nucleic acid detection system.
8. A reagent system for CRISPR / Cas nucleic acid detection, characterized in that, Includes gRNA for targeting the target sequence and the chimeric TsCas12a protein as described in claim 1.
9. The reagent system according to claim 8, characterized in that, It also includes additives selected from at least one of PEG, detergents and reducing agents.
Citation Information
Patent Citations
Compositions and methods for modifying genomes
CN109312316A
Novel chimera TsCas12a protein and preparation technology
CN113337489A