A Highly Active Mutant Pectin Lyase and Its Application
By mutating the gene of pectin lyase and constructing a recombinant vector, the enzyme activity was enhanced, solving the problem of insufficient enzyme activity in existing technologies, and enabling its widespread application in pulping, papermaking, textiles and feed industries.
Patent Information
- Application Number
- CN202310359385.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-13
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2042-04-13
AI Technical Summary
In existing technologies, alkaline pectin lyases have insufficient enzyme activity and thermal stability, which limits their application in pulping, papermaking, textiles, and animal feed.
By performing site-directed mutagenesis on the gene of pectin lyase, mutant pectin lyases PGLA-rep4, PGLA-rep1, and PGLA-rep2 were constructed to improve their enzyme activity. Furthermore, the enzyme activity was significantly enhanced through the construction of recombinant vectors and engineered Escherichia coli.
The recombinant pectin lyase exhibits significantly improved enzyme activity, enhanced adaptability and stability in pulping, papermaking, textiles and animal feed, meeting industrial needs.
Smart Images

Figure CN116286907B_ABST
Abstract
Description
[0001] This invention is a divisional application of application number 202210389716.X, application date 2022.04.13, and invention title "A Highly Active Mutant Pectin Lyase and Its Application". Technical Field
[0002] This invention relates to a highly active mutant pectin lyase and its applications, belonging to the field of bioengineering technology. Background Technology
[0003] Pectinase is a general term for a class of enzymes that catalyze the breakdown of pectin (composed of D-galacturonic acid polymerized by α-1,4 glycosidic bonds) in plants. It mainly includes pectin esterase, polymethylgalacturonase, polygalacturonase, polygalacturonate lyase, and polymethylgalacturonate lyase. Based on application and optimal pH, pectinase can generally be divided into acidic pectinase and alkaline pectinase. Acidic pectinase generally refers to polygalacturonase, with an optimal pH of 3.5–5, and is mainly used in pectin extraction and wine clarification. Alkaline pectinase generally refers to polygalacturonate lyase, with an optimal pH of 8–10. It breaks the α-1,4 glycosidic bonds of pectin molecules through trans-elimination, decomposing the polymeric pectin into smaller galacturonic acid molecules.
[0004] Chinese patent document CN108588061A (application number: 201810396518.X) discloses a low-temperature alkaline pectin lyase mutant with improved specific enzyme activity and thermostability. This pectin lyase mutant involves mutating glutamic acid and lysine at positions 184 and 185 of the wild-type low-temperature alkaline pectin lyase to aspartic acid and serine, respectively, significantly improving the specific enzyme activity and thermostability of the low-temperature alkaline pectin lyase. The method of improving the specific enzyme activity of alkaline pectin lyase through site-directed mutagenesis involved in this invention differs from the method of improving the enzyme activity of alkaline pectin lyase in this invention. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention provides a highly active mutant pectin lyase and its applications.
[0006] The mutant pectin lyases PGLA-rep4, PGLA-rep1, and PGLA-rep2 provided by this invention exhibit significantly enhanced enzyme activity.
[0007] The technical solution of this invention is as follows:
[0008] The nucleotide sequence of the gene encoding a mutant pectin lyase PGLA-rep4 is shown in SEQ ID NO.1.
[0009] The amino acid sequence of a mutant pectin lyase PGLA-rep4 is shown in SEQ ID NO.2.
[0010] A recombinant vector containing the nucleotide sequence of the gene encoding the mutant pectin lyase PGLA-rep4, as shown in SEQ ID NO.1.
[0011] A recombinant bacterium containing the nucleotide sequence of the gene encoding the mutant pectin lyase PGLA-rep4, as shown in SEQ ID NO.1.
[0012] A method for constructing an engineered *Escherichia coli* strain containing the mutant pectin lyase PGLA-rep4 gene includes the following steps:
[0013] (1) The synthesized pET-28a(+)-PGLA plasmid was amplified by forward PCR to amplify the pET-28a(+)-PGLA-4 gene fragment, the nucleotide sequence of which is shown in SEQ ID NO.3;
[0014] (2) The rep4 gene fragment was amplified by forward PCR, and its nucleotide sequence is shown in SEQ ID NO.4;
[0015] (3) The pET-28a(+)-PGLA-4 gene fragment obtained in step (1) and the rep4 gene fragment obtained in step (2) are seamlessly cloned and ligated to obtain the recombinant plasmid pET-28a(+)-PGLA-rep4.
[0016] (4) Prepare Escherichia coli BL21(DE3) competent cells. Transform the recombinant plasmid pET-28a(+)-PGLA-rep4 obtained in step (3) into Escherichia coli BL21(DE3) competent cells and screen for positive clones to obtain engineered Escherichia coli containing the mutant pectin lyase PGLA-rep4.
[0017] According to a preferred embodiment of the present invention, in step (1), the forward PCR amplification uses pET-28a(+)-PGLA plasmid as a template, and the nucleotide sequences of the amplification primers are as follows:
[0018] F1:ATCTATATCGATGGTACCATCACCC SEQ ID NO.5;
[0019] R1:ACCCCCCGCACCGCCTGT SEQ ID NO.6;
[0020] According to a preferred embodiment of the present invention, in step (1), the PCR amplification reaction system is as follows, with a total volume of 50 μl:
[0021]
[0022] The PCR amplification procedure is as follows:
[0023] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 3.2 min, 30 cycles; extension at 72℃ for 5 min, storage at 4℃.
[0024] According to a preferred embodiment of the present invention, in step (2), the forward PCR amplification template is the Pel SWU gene fragment, the accession number of the gene sequence in the NCBI database is AB428424, and the nucleotide sequence of the amplification primers is as follows:
[0025] F2:ccacaggcggtgcggggggtCAGACGGTAACCGTAACAACGG SEQ ID NO.7;
[0026] R2:atggtaccatcgatatagatTTTTAAAGGCGTATTTGCATTCTT SEQ ID NO.8;
[0027] According to a preferred embodiment of the present invention, in step (2), the PCR amplification reaction system is as follows, with a total volume of 50 μl:
[0028]
[0029] The PCR amplification procedure is as follows:
[0030] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 15 sec, 30 cycles; extension at 72℃ for 5 min, storage at 4℃.
[0031] According to a preferred embodiment of the present invention, in step (3), the seamless cloning PCR amplification system is as follows, with a total volume of 20 μl:
[0032]
[0033] The seamless cloning procedure is as follows:
[0034] React at 37℃ for 30 minutes, then store at 4℃.
[0035] According to a preferred embodiment of the present invention, in step (4), the method for screening positive clones is as follows: transforming cells are spread on LB solid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Single colonies are picked and inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Then, positive clones with the target gene band are obtained by PCR verification. Then, sequencing is performed, and the strains with correct sequencing results are retained as the target expression strains.
[0036] The nucleotide sequence of the gene encoding a mutant pectin lyase PGLA-rep1 is shown in SEQ ID NO.9.
[0037] The amino acid sequence of a mutant pectin lyase PGLA-rep1 is shown in SEQ ID NO.10.
[0038] A recombinant vector containing the nucleotide sequence of the gene encoding the mutant pectin lyase PGLA-rep1, as shown in SEQ ID NO.9.
[0039] A recombinant bacterium containing the nucleotide sequence of the gene encoding the mutant pectin lyase PGLA-rep1, as shown in SEQ ID NO.9.
[0040] A method for constructing an engineered *Escherichia coli* strain containing the mutant pectin lyase PGLA-rep1 gene includes the following steps:
[0041] ① The pET-28a(+)-PGLA-rep1 plasmid was obtained by direct amplification via reverse PCR, and its nucleotide sequence is shown in SEQ ID NO.11;
[0042] ② Prepare Escherichia coli BL21(DE3) competent cells. Transform the recombinant plasmid pET-28a(+)-PGLA-rep1 obtained in step ① into Escherichia coli BL21(DE3) competent cells, screen for positive clones, and obtain engineered Escherichia coli containing the mutant pectin lyase PGLA-rep1.
[0043] According to a preferred embodiment of the present invention, in step ①, the reverse PCR amplification uses pET-28a(+)-PGLA plasmid as a template, and the nucleotide sequences of the amplification primers are as follows:
[0044] F1-1:CGGGCAAAGTAAATCCGCTTGCCGACTTCAGCTTACAAGGTTTTGCCACTCTC AATG SEQID NO.12;
[0045] R1-1:AAGCGGATTTACTTTGCCCGAGTTTAAGGCAGAAGCCATGGTATATCTCCTTCTTAAAGTTAAAC SEQ ID NO.13;
[0046] According to a preferred embodiment of the present invention, in step ①, the PCR amplification reaction system is as follows, with a total volume of 50 μl:
[0047]
[0048] The PCR amplification procedure is as follows:
[0049] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 3.5 min, 30 cycles; extension at 72℃ for 5 min, storage at 4℃.
[0050] According to a preferred embodiment of the present invention, in step ②, the method for screening positive clones is as follows: transforming cells are plated on LB solid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Single colonies are picked and inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Then, positive clones with the target gene band are obtained by PCR verification. Then, sequencing is performed, and the strains with correct sequencing results are retained as the target expression strains.
[0051] The nucleotide sequence of the gene encoding a mutant pectin lyase PGLA-rep2 is shown in SEQ ID NO.14.
[0052] The amino acid sequence of a mutant pectin lyase PGLA-rep2 is shown in SEQ ID NO.15.
[0053] A recombinant vector containing the nucleotide sequence of the gene encoding the mutant pectin lyase PGLA-rep2, as shown in SEQ ID NO.14.
[0054] A recombinant bacterium containing the nucleotide sequence of the gene encoding the mutant pectin lyase PGLA-rep2, as shown in SEQ ID NO.14.
[0055] A method for constructing an engineered *Escherichia coli* strain containing the mutant pectin lyase PGLA-rep2 gene includes the following steps:
[0056] <1> The synthesized pET-28a(+)-PGLA plasmid was amplified by forward PCR to create the pET-28a(+)-PGLA-2 gene fragment, the nucleotide sequence of which is shown in SEQ ID NO.16.
[0057] <2> The rep2 gene fragment was amplified by forward PCR, and its nucleotide sequence is shown in SEQ ID NO.17;
[0058] <3> Steps <1> The pET-28a(+)-PGLA-2 gene fragment obtained in step (2) was seamlessly cloned and ligated with the rep2 gene fragment obtained in step (2) to obtain the recombinant plasmid pET-28a(+)-PGLA-rep2.
[0059] <4> To prepare Escherichia coli BL21(DE3) competent cells, the following steps were performed. <3> The recombinant plasmid pET-28a(+)-PGLA-rep2 was transformed into Escherichia coli BL21(DE3) competent cells, and positive clones were screened to obtain engineered Escherichia coli containing the mutant pectin lyase PGLA-rep2.
[0060] According to a preferred embodiment of the present invention, the steps are as follows: <1> In the forward PCR amplification, pET-28a(+)-PGLA plasmid was used as a template. The nucleotide sequences of the amplification primers are as follows:
[0061] F1-1-1:GGGGGTGATGTGGTGACCG SEQ ID NO.18;
[0062] R1-1-1:CATGGTATATCTCCTTCTTAAAGTTAAACA SEQ ID NO.19;
[0063] According to a preferred embodiment of the present invention, the steps are as follows: <1> The PCR amplification reaction system is as follows, with a total volume of 50 μl:
[0064]
[0065] The PCR amplification procedure is as follows:
[0066] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 3.2 min, 30 cycles; extension at 72℃ for 5 min, storage at 4℃.
[0067] According to a preferred embodiment of the present invention, the steps are as follows: <2> In the forward PCR amplification, the template was the Pel SWU gene fragment, whose accession number in the NCBI database is AB428424. The nucleotide sequences of the amplification primers are as follows:
[0068] F1-1-2:taagaaggagatataccatgGCTTCTGCCTTAAACTCGGGC SEQ ID NO.20;
[0069] R1-1-2: acggtcaccacatcacccccTTCTCCCGCCCGTTGTTCC SEQ ID NO.21;
[0070] According to a preferred embodiment of the present invention, the steps are as follows: <2> The PCR amplification reaction system is as follows, with a total volume of 50 μl:
[0071]
[0072] The PCR amplification procedure is as follows:
[0073] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 15 sec, 30 cycles; extension at 72℃ for 5 min, storage at 4℃.
[0074] According to a preferred embodiment of the present invention, the steps are as follows: <3> The seamless cloning PCR amplification system is as follows, with a total volume of 20 μl:
[0075]
[0076] The seamless cloning procedure is as follows:
[0077] React at 37℃ for 30 minutes, then store at 4℃.
[0078] According to a preferred embodiment of the present invention, the steps are as follows: <4> In this study, the method for screening positive clones was as follows: transformed cells were plated on LB solid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Then, positive clones with the target gene band were obtained by PCR verification. Sequencing was then performed, and the strains with correct sequencing results were retained as the target expression strains.
[0079] Application of the above-mentioned recombinant bacteria or the engineered Escherichia coli strain prepared by the above construction method in the production of alkaline pectin lyase.
[0080] Beneficial effects
[0081] The mutant pectin lyases PGLA-rep4, PGLA-rep1, and PGLA-rep2 provided by this invention have improved enzyme activity and have broad application prospects in pulping, papermaking, textiles, feed and other fields. Attached Figure Description
[0082] Figure 1 The image shows the enzyme activity detection results under different pH conditions in Example 4.
[0083] Figure 2The image shows the enzyme activity detection results under different temperature conditions in Example 4.
[0084] Figure 3 The graph shows the enzyme activity detection results under different pH conditions in Example 5.
[0085] Figure 4 The image shows the enzyme activity detection results under different temperature conditions in Example 5.
[0086] Figure 5 The image shows the enzyme activity detection results under different pH conditions in Example 6.
[0087] Figure 6 The graph shows the enzyme activity detection results under different temperature conditions in Example 6.
[0088] Figure 7 The graph shows the enzyme activity detection results under different pH conditions in Comparative Example 1.
[0089] Figure 8 The image shows the enzyme activity detection results under different temperature conditions in Comparative Example 1. Detailed Implementation
[0090] The technical solution of the present invention will be further described below with reference to the embodiments, but the scope of protection of the present invention is not limited thereto.
[0091] Unless otherwise described in the embodiments, all other aspects are based on existing technologies in the field.
[0092] The accession number for the pectin lyase Pel SWU gene sequence in the NCBI database is AB428424.
[0093] Example 1
[0094] Construction of the mutant pectin lyase PGLA-rep4 gene
[0095] (i) Using pET-28a(+)-PGLA DNA as a template, PCR amplification was performed to obtain the replacement gene vector fragment pET-28a(+)-PGLA-4, the nucleotide sequence of which is shown in SEQ ID NO.3;
[0096] The PCR primer sequences are as follows:
[0097] F1:ATCTATATCGATGGTACCATCACCC SEQ ID NO.5;
[0098] R1:ACCCCCCGCACCGCCTGT SEQ ID NO.6;
[0099] The PCR amplification system described is shown in Table 1:
[0100] Table 1
[0101]
[0102] The PCR amplification procedure is as follows:
[0103] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 3.2 min, 30 cycles; extension at 72℃ for 5 min, storage at 4℃;
[0104] The PCR products were examined by agarose gel electrophoresis. The length was approximately 6000 bp. The gel was recovered using the SanPrep DNA Gel Extraction Kit (Shanghai Sangon Biotech). The recovered products were stored at -20°C for later use.
[0105] (ii) Using the DNA of the pectin lyase Pel SWU gene as a template, PCR amplification was performed to obtain the replacement gene fragment rep4, the nucleotide sequence of which is shown in SEQ ID NO.4;
[0106] The PCR primer sequences are as follows:
[0107] F2:ccacaggcggtgcggggggtCAGACGGTAACCGTAACAACGG SEQ ID NO.7;
[0108] R2:atggtaccatcgatatagatTTTTAAAGGCGTATTTGCATTCTT SEQ ID NO.8;
[0109] The PCR amplification system described is shown in Table 2:
[0110] Table 2
[0111]
[0112] The PCR amplification procedure is as follows:
[0113] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 15 sec, 30 cycles; extension at 72℃ for 5 min, storage at 4℃.
[0114] The PCR products were examined by agarose gel electrophoresis. The length was approximately 100 bp. The gel was recovered using the SanPrep DNA Gel Extraction Kit (Shanghai Sangon Biotech). The recovered products were stored at -20°C for later use.
[0115] (iii) The pET-28a(+)-PGLA-4 replacement vector fragment obtained in step (i) and the rep4 replacement fragment obtained in step (ii) were seamlessly cloned to obtain the pET-28a(+)-PGLA-rep4 plasmid. The gene sequence of pectin lyase PGLA-rep4 is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2.
[0116] The amplification system for the seamless cloning described above is shown in Table 3:
[0117] Table 3
[0118]
[0119] The seamless cloning procedure is as follows:
[0120] React at 37℃ for 30 minutes, then store at 4℃.
[0121] The PCR product was examined by agarose gel electrophoresis. The product was 6148 bp in length. The gel was recovered using the SanPrep DNA Gel Extraction Kit (Shanghai Sangon Biotech). The recovered product was stored at -20°C for later use.
[0122] Example 2
[0123] Preparation of competent Escherichia coli
[0124] (i) Pick a single colony of Escherichia coli BL21(DE3) and inoculate it into LB medium, and incubate overnight at 37°C at 220 r / min;
[0125] (ii) Pipette 0.1 mL of bacterial culture into 10 mL of LB medium and incubate at 300 rpm and 37°C until OD reaches 100%. 600 Reaching 0.6–0.8;
[0126] (iii) Take 1 mL of OD 600 Transfer the bacterial culture to a concentration of 0.6–0.8 to a 1.5 mL sterile centrifuge tube, centrifuge at 12000 rpm for 2 min, and thoroughly remove the supernatant.
[0127] (iv) Add 100 μL of ice-cold SSCS (One-Step Rapid Preparation Kit for Competent Cells, Shanghai Sangon Biotech Co., Ltd.), and gently suspend the bacterial cells to prepare competent cells.
[0128] (v) Aliquot the prepared competent cells into 100 μL tubes and store at -80°C for later use.
[0129] Example 3
[0130] Chemical transformation of Escherichia coli BL21(DE3) with the PGLA-rep4 gene
[0131] First, the concentration of pET-28a(+)-PGLA-rep4 plasmid was determined using a nucleic acid ultra-micro spectrophotometer. After reaching a concentration of 300 μg / mL, chemical transformation was performed. The resulting cells were then revived and cultured at 37°C for 1 h using resuscitation medium. 100 μL of the resuscitation medium was then spread on LB solid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Positive recombinant colonies with kanamycin resistance were then screened.
[0132] Liquid resuscitation medium, with the following components per liter:
[0133] 10g peptone, 5g yeast powder, 10g sodium chloride, 91g sorbitol, 69.4g mannitol, and the remainder water.
[0134] Culture and identification of positive recombinant bacteria
[0135] The above positive recombinant colonies were picked and inoculated into liquid LB medium containing 50 μg / mL kanamycin resistance and cultured overnight at 37°C. After the culture was completed, recombinant bacterial DNA was extracted using a kit provided by Shanghai Bioengineering Co., Ltd., and PCR amplification was performed using the obtained genome as a template and F1 and R2 as primers. The amplification products were verified by agarose gel electrophoresis.
[0136] The PCR primer sequences are as follows:
[0137] F1:ATCTATATCGATGGTACCATCACCC SEQ ID NO.5;
[0138] R2:atggtaccatcgatatagatTTTTAAAGGCGTATTTGCATTCTT SEQ ID NO.8;
[0139] The PCR amplification system was 20 μl, as shown in Table 4:
[0140] Table 4
[0141]
[0142] The PCR amplification procedure is as follows:
[0143] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 3.5 min, 30 cycles; extension at 72℃ for 5 min, storage at 4℃;
[0144] Agarose gel electrophoresis was used to examine the PCR products. The results showed that a specific gene band of about 6100 bp was amplified using primers F1 and R2, which is close to the theoretical value of 6148 bp. This indicates that the vector containing the target gene has been successfully transferred into E. coli cells, and engineered E. coli with the mutant pectin lyase PGLA-rep4 gene has been obtained.
[0145] Example 4
[0146] Example 3: Fermentation test of engineered Escherichia coli containing the pectin lyase PGLA-rep4 gene.
[0147] The engineered *E. coli* strain containing the pectin lyase PGLA-rep4 gene was inoculated into 100 mL of LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, and the remainder water) and cultured at 37°C and 220 rpm until the fermentation broth reached its OD value. 600 0.7, then add IPTG (final concentration 0.5mM) and induce for 12h, then take samples. Referring to QB / T 4482-2013, the method for determining alkaline pectin lyase activity, the highest enzyme activity of pectin lyase in the fermentation broth was determined by ultraviolet spectrophotometry (A235) after sample treatment. After treatment at 55℃ and pH 8.5-11.5 for 10min, 3ml of 0.03M phosphate was added to terminate the reaction. The absorbance was measured at 235nm using an ultraviolet spectrophotometer. The results are shown in [Figure number missing]. Figure 1 The optimal temperature for pectin lyase in the fermentation broth was determined by ultraviolet spectrophotometry (A235 method). After treatment at the optimal pH of 11.0 and temperatures ranging from 55℃ to 85℃ (gradient of 5℃) for 10 min, 3 ml of 0.03M phosphate was added to terminate the reaction. The absorbance was measured at 235 nm using an ultraviolet spectrophotometer. The results are shown below. Figure 2 .
[0148] Compared to the original enzyme PGLA (optimal temperature 70℃, optimal pH 11), the optimal pH and optimal temperature of pectin lyase in the fermentation broth of the recombinant *E. coli* strain containing the PGLA-rep4 gene remained unchanged. However, the highest enzyme activity of the recombinant pectin lyase PGLA-rep4 in the fermentation broth was 157.778 U / ml, which was significantly higher than the highest enzyme activity of 104.348 U / ml in the fermentation broth of the original pectin lyase PGLA.
[0149] Example 5
[0150] Construction and fermentation test of the pectin lyase PGLA-rep1 gene
[0151] (i) pET-28a(+)-PGLA plasmid DNA was extracted from Escherichia coli BL21(DE3). Using this genomic DNA as a template, reverse PCR was performed to directly amplify the pET-28a(+)-PGLA-rep1 plasmid, the nucleotide sequence of which is shown in SEQ ID NO.11. The gene sequence of pectin lyase PGLA-rep1 is shown in SEQ ID NO.9, and its amino acid sequence is shown in SEQ ID NO.10.
[0152] The PCR primer sequences are as follows:
[0153] F1-1:CGGGCAAAGTAAATCCGCTTGCCGACTTCAGCTTACAAGGTTTTGCCACTCTC AATG SEQID NO.12;
[0154] R1-1:AAGCGGATTTACTTTGCCCGAGTTTAAGGCAGAAGCCATGGTATATCTCCTTCTTAAAGTTAAAC SEQ ID NO.13;
[0155] The PCR amplification system described above is shown in Table 5:
[0156] Table 5
[0157]
[0158] The PCR amplification procedure is as follows:
[0159] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 3.5 sec, 30 cycles; extension at 72℃ for 10 min, storage at 4℃;
[0160] The PCR product was examined by agarose gel electrophoresis. The product was approximately 6100 bp in length. The gel was recovered using the SanPrep DNA Gel Extraction Kit (Shanghai Sangon Biotech). The recovered product was stored at -20°C for later use.
[0161] Following the method described in Example 3, engineered *E. coli* strains containing the alkali-resistant pectin lyase PGLA-rep1 gene were prepared. The prepared engineered *E. coli* strains containing the alkali-resistant pectin lyase PGLA-rep1 gene were inoculated into 100 mL of LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl) and cultured at 37°C and 220 rpm until the fermentation broth reached its OD value. 600The concentration was set to 0.7, and IPTG (final concentration 0.5 mM) was added for induction for 12 h, followed by sampling. Referring to QB / T 4482-2013, the method for determining the activity of alkaline pectin lyase was used. After sample treatment, the maximum enzyme activity of pectin lyase in the fermentation broth was determined by ultraviolet spectrophotometry (A235 method). After treatment at 55℃ and pH 8.5-11.0 for 10 min, 3 ml of 0.03 M phosphate was added to terminate the reaction. The absorbance was measured at 235 nm using an ultraviolet spectrophotometer. The results are shown in the table below. Figure 3 The optimal temperature for pectin lyase in the fermentation broth was determined by ultraviolet spectrophotometry (A235 method). After treatment at the optimal pH of 10.5 and temperatures ranging from 55℃ to 85℃ (gradient of 5℃) for 10 min, 3 ml of 0.03M phosphate was added to terminate the reaction. The absorbance was measured at 235 nm using an ultraviolet spectrophotometer. The results are shown below. Figure 4 .
[0162] Compared with the original enzyme PGLA (optimal temperature 70℃, optimal pH 11), the optimal pH of pectin lyase in the fermentation broth of the recombinant E. coli containing the PGLA-rep1 gene decreased to 10.5, but the optimal temperature remained unchanged. Furthermore, the highest enzyme activity of the recombinant pectin lyase PGLA-rep1 in the fermentation broth was 110.918 U / ml, which was significantly higher than the highest enzyme activity of 104.348 U / ml in the fermentation broth of the original pectin lyase PGLA.
[0163] Example 6
[0164] Construction and fermentation test of the pectin lyase PGLA-rep2 gene
[0165] (i) pET-28a(+)-PGLA plasmid DNA was extracted from Escherichia coli BL21(DE3), and PCR amplification was performed using the genomic DNA as a template to obtain the replacement gene vector fragment pET-28a(+)-PGLA-2, the nucleotide sequence of which is shown in SEQ ID NO.16.
[0166] The PCR primer sequences are as follows:
[0167] F1-1-1:GGGGGTGATGTGGTGACCG SEQ ID NO.18;
[0168] R1-1-1:CATGGTATATCTCCTTCTTAAAGTTAAACA SEQ ID NO.19;
[0169] The PCR amplification system described above is shown in Table 5:
[0170] Table 5
[0171]
[0172] The PCR amplification procedure is as follows:
[0173] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 3.2 min, 30 cycles; extension at 72℃ for 10 min, storage at 4℃;
[0174] The PCR product was examined by agarose gel electrophoresis. The product was approximately 6100 bp in length. The gel was recovered using the SanPrep DNA Gel Extraction Kit (Shanghai Sangon Biotech). The recovered product was stored at -20°C for later use.
[0175] (ii) Using the Pel SWU gene fragment as a template, PCR amplification was performed to obtain the replacement gene fragment rep2, the nucleotide sequence of which is shown in SEQ ID NO.17;
[0176] The PCR primer sequences are as follows:
[0177] F1-1-2:taagaaggagatataccatgGCTTCTGCCTTAAACTCGGGC SEQ ID NO.20;
[0178] R1-1-2: acggtcaccacatcacccccTTCTCCCGCCCGTTGTTCC SEQ ID NO.21;
[0179] The PCR amplification system described above is shown in Table 6:
[0180] Table 6
[0181]
[0182] The PCR amplification procedure is as follows:
[0183] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 15 sec, 30 cycles; extension at 72℃ for 5 min, storage at 4℃.
[0184] The PCR products were examined by agarose gel electrophoresis. The length was approximately 100 bp. The gel was recovered using the SanPrep DNA Gel Extraction Kit (Shanghai Sangon Biotech). The recovered products were stored at -20°C for later use.
[0185] (iii) The pET-28a(+)-PGLA-2 fragment obtained in step (i) and the rep2 fragment obtained in step (ii) were seamlessly cloned to obtain the pET-28a(+)-PGLA-rep2 plasmid; the nucleotide sequence of pectin lyase PGLA-rep2 is shown in SEQ ID NO.14, and the amino acid sequence of pectin lyase PGLA-rep2 is shown in SEQ ID NO.15.
[0186] The amplification system for the seamless cloning described above is shown in Table 7:
[0187] Table 7
[0188]
[0189]
[0190] The seamless cloning procedure is as follows:
[0191] React at 37℃ for 30 minutes, then store at 4℃.
[0192] The PCR product was examined by agarose gel electrophoresis. The product was 6178 bp in length. The gel was recovered using the SanPrep DNA Gel Extraction Kit (Shanghai Sangon Biotech). The recovered product was stored at -20°C for later use.
[0193] Following the method in Example 3, engineered *E. coli* strains containing the alkali-resistant pectin lyase PGLA-rep2 gene were prepared. The prepared engineered *E. coli* strains containing the alkali-resistant pectin lyase PGLA-rep2 gene were inoculated into 100 mL of LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl) and cultured at 37°C and 220 rpm until the fermentation broth reached its OD value. 600 The concentration was increased to 0.7, and then IPTG (final concentration 0.5 mM) was added for induction for 12 h, followed by sampling. Referring to QB / T 4482-2013, the method for determining the activity of alkaline pectin lyase was used. After sample treatment, the maximum enzyme activity of pectin lyase in the fermentation broth was determined by ultraviolet spectrophotometry (A235 method). After treatment at 55℃ and pH 8.5-11.0 for 10 min, 3 ml of 0.03 M phosphate was added to terminate the reaction. The absorbance was measured at 235 nm using an ultraviolet spectrophotometer. The results are shown in the table below. Figure 5 The optimal temperature for pectin lyase in the fermentation broth was determined by ultraviolet spectrophotometry (A235 method). After treatment at the optimal pH of 10.5 and temperatures ranging from 55℃ to 85℃ (gradient of 5℃) for 10 min, 3 ml of 0.03M phosphate was added to terminate the reaction. The absorbance was measured at 235 nm using an ultraviolet spectrophotometer. The results are shown below. Figure 6 .
[0194] Compared with the original enzyme PGLA (optimal temperature 70℃, optimal pH 11), the optimal pH of pectin lyase in the fermentation broth of the recombinant E. coli containing the PGLA-rep2 gene decreased to 10.5, but the optimal temperature remained unchanged. Furthermore, the highest enzyme activity of the recombinant pectin lyase PGLA-rep2 in the fermentation broth was 130.048 U / ml, which was significantly higher than the highest enzyme activity of 104.348 U / ml in the fermentation broth of the original pectin lyase PGLA.
[0195] Comparative Example 1
[0196] Construction and fermentation test of recombinant PGLA-rep3 gene
[0197] (i) pET-28a(+)-PGLA plasmid DNA was extracted from Escherichia coli BL21(DE3), and PCR amplification was performed using the genomic DNA as a template to obtain the replacement gene vector fragment pET-28a(+)-PGLA-3, the nucleotide sequence of which is shown in SEQ ID NO.22;
[0198] The PCR primer sequences are as follows:
[0199] F2-1:ATCTATATCGATGGTACCATCACCC SEQ ID NO.23;
[0200] R1-1-1:CATGGTATATCTCCTTCTTAAAGTTAAACA SEQ ID NO.19;
[0201] The PCR amplification system described above is shown in Table 8:
[0202] Table 8
[0203]
[0204]
[0205] The PCR amplification procedure is as follows:
[0206] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 3.2 min, 30 cycles; extension at 72℃ for 5 min, storage at 4℃;
[0207] The PCR product was examined by agarose gel electrophoresis. The product was approximately 6100 bp in length. The gel was recovered using the SanPrep DNA Gel Extraction Kit (Shanghai Sangon Biotech). The recovered product was stored at -20°C for later use.
[0208] (ii) Using the Pel SWU gene fragment as a template, PCR amplification was performed to obtain the replacement gene fragment rep3, the nucleotide sequence of which is shown in SEQ ID NO.24;
[0209] The PCR primer sequences are as follows:
[0210] F1-1-2:taagaaggagatataccatgGCTTCTGCCTTAAACTCGGGC SEQ ID NO.20;
[0211] R2-2:taagaaggagatataccatgGCTTCTGCCTTAAACTCGGGC SEQ ID NO.25;
[0212] The PCR amplification system described above is shown in Table 9:
[0213] Table 9
[0214]
[0215] The PCR amplification procedure is as follows:
[0216] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 15 sec, 30 cycles; extension at 72℃ for 5 min, storage at 4℃.
[0217] The PCR products were examined by agarose gel electrophoresis. The length was approximately 200 bp. The gel was then recovered using the SanPrep DNA Gel Extraction Kit (Shanghai Sangon Biotech). The recovered products were stored at -20°C for later use.
[0218] (iii) The pET-28a(+)-PGLA4-3 fragment obtained in step (i) and the rep3 fragment obtained in step (ii) are seamlessly cloned to obtain the pET-28a(+)-PGLA-rep3 plasmid.
[0219] The amplification system for the seamless cloning described above is shown in Table 10:
[0220] Table 10
[0221]
[0222] The seamless cloning procedure is as follows:
[0223] React at 37℃ for 30 minutes, then store at 4℃.
[0224] The PCR product was examined by agarose gel electrophoresis. The product was 6178 bp in length. The gel was recovered using the SanPrep DNA Gel Extraction Kit (Shanghai Sangon Biotech). The recovered product was stored at -20°C for later use.
[0225] Following the method in Example 3, engineered *E. coli* strains containing the alkali-resistant pectin lyase PGLA-rep3 gene were prepared. The prepared engineered *E. coli* strains containing the alkali-resistant pectin lyase PGLA-rep3 gene were inoculated into 100 mL of LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl) and cultured at 37°C and 220 rpm until the fermentation broth reached its OD value. 600 0.8, then add IPTG (final concentration 0.5mM) for 12h induction, take samples, and determine the maximum enzyme activity of pectin lyase in the fermentation broth by ultraviolet spectrophotometry (A235 method) according to QB / T 4482-2013, referring to the method for determination of alkaline pectin lyase activity. After sample treatment, the maximum enzyme activity of pectin lyase in the fermentation broth was determined by ultraviolet spectrophotometry (A235 method). After treatment at 55℃ and pH 8.5-11.0 for 10min, 3ml of 0.03M phosphate was added to terminate the reaction, and the absorbance value was measured at 235nm using an ultraviolet spectrophotometer. The detection results are shown in the figure. Figure 7 The optimal temperature for pectin lyase in the fermentation broth was determined by ultraviolet spectrophotometry (A235 method). After treatment at the optimal pH of 11.0 and temperatures ranging from 55℃ to 85℃ (gradient of 5℃) for 10 min, 3 ml of 0.03M phosphate was added to terminate the reaction. The absorbance was measured at 235 nm using an ultraviolet spectrophotometer. The results are shown below. Figure 8 .
[0226] Compared with the original enzyme PGLA (optimal temperature 70℃, optimal pH 11), the optimal pH of pectin lyase in the fermentation broth of the recombinant E. coli engineered bacteria containing the PGLA-rep3 gene was still 11.0, but the optimal temperature dropped to 65℃. Furthermore, the highest enzyme activity of the recombinant pectin lyase PGLA-rep3 in the fermentation broth was 91.014 U / ml, which was significantly lower than the highest enzyme activity of 104.348 U / ml in the fermentation broth of the original pectin lyase PGLA.
[0227] In summary, in Example 4, PGLA-rep4 is formed by replacing 75 bases from position 70 to 144 of the pectin lyase PGLA with 75 bases at the corresponding positions of Pel SWU, i.e., rep4.
[0228] In Example 5, PGLA-rep1 was created by replacing the first 21 bases at the N-terminus of pectin lyase PGLA with the first 51 bases at the N-terminus of Pel SWU, i.e., rep1.
[0229] In Example 6, PGLA-rep2 was created by replacing the first 63 bases at the N-terminus of the pectin lyase PGLA with the first 93 bases at the N-terminus of Pel SWU, i.e., rep2.
[0230] In Comparative Example 1, PGLA-rep3 was created by replacing the first 144 bases at the N-terminus of pectin lyase PGLA4 with the first 174 bases at the N-terminus of Pel SWU, i.e., rep3.
[0231] The enzymatic properties of the original enzyme and the four mutant enzymes are shown in Table 11:
[0232] Table 11
[0233]
[0234] A comparison of the mutant enzymes involved in this invention with those involved in Comparative Example 1 shows that the increase in enzyme activity in the fermentation broth is not directly related to the length of the replacement fragment. The modified pectin lyases PGLA-rep4, PGLA-rep1, and PGLA-rep2 of this invention exhibit increased enzyme activity in their fermentation broths, showing broad application prospects in pulping, papermaking, textiles, and animal feed industries.
Claims
1. A mutant pectin lyase PGLA-rep1 The nucleotide sequence of its encoding gene is shown in SEQ ID NO.
9.
2. A mutant pectin lyase PGLA-rep1 Its amino acid sequence is shown in SEQ ID NO.
10.
3. A recombinant vector comprising the mutant pectin lyase of claim 1. PGLA-rep1 The nucleotide sequence encoding the gene is shown in SEQ ID NO.
9.
4. A recombinant bacterium comprising the mutant pectin lyase of claim 1. PGLA-rep1 The nucleotide sequence encoding the gene is shown in SEQ ID NO.
9.
5. A mutant pectin lyase PGLA-rep1 A method for constructing engineered Escherichia coli strains with specific genes, characterized in that... Includes the following steps: ① pET-28a(+)- was obtained by direct amplification via reverse PCR. PGLA-rep1 The plasmid, whose nucleotide sequence is shown in SEQ ID NO. 11; ②Prepare Escherichia coli BL21(DE3) competent cells by using the recombinant plasmid pET-28a(+)- obtained in step ①. PGLA- rep1 Transformed into E. coli BL21(DE3) competent cells, positive clones were screened to obtain the mutant pectin lyase. PGLA- rep1 Engineered Escherichia coli.
6. The method as described in claim 5, characterized in that, In step ①, reverse PCR amplification is performed using pET-28a(+)- PGLA The plasmid was used as a template, and the amplification primers were F1-1 and R1-1, respectively. The nucleotide sequences of the amplification primers were SEQ ID NO.12 and SEQ ID NO.13, respectively.
7. The method as described in claim 6, characterized in that, In step ①, the PCR amplification reaction system is as follows, with a total volume of 50 μl: 2×Phanta Max Master Mix 25μl F1-110μmol / L2μl R1-110μmol / L2μl Template 2μl dd H2O 19μl; The PCR amplification procedure is as follows: Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 sec, annealing at 60℃ for 15 sec, extension at 72℃ for 3.5 min, 30 cycles; extension at 72℃ for 5 min, storage at 4℃.
8. The method as described in claim 5, characterized in that, In step ②, the method for screening positive clones is as follows: Transformed cells are plated on LB solid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Single colonies are picked and inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. Then, positive clones with the target gene band are obtained by PCR verification. Then, sequencing is performed, and the strains with correct sequencing results are retained as the target expression strains.
9. The use of the recombinant bacteria according to claim 4 in the production of pectin lyase.
Citation Information
Patent Citations
Low temperature alkaline pectinase mutant with improved specific activity and thermal stability
CN108588061A
A low-temperature alkaline pectinase mutant with improved enzyme activity and thermal stability
CN108588061B