A method for plant gene editing without foreign dna
Patent Information
- Application Number
- CN202310103908.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-13
- Publication Date
- 2026-09-11
- Estimated Expiration
- 2043-02-13
AI Technical Summary
但该方法需要遗传转化和嫁接,操作技术复杂,嫁接也受物种限制
[0016] This invention combines the Agrobacterium rhizogenes-induced hairy root transformation system with TLS (tRNA-like sequence) mobile element-mediated mobile CRISPR/Cas9 gene editing technology. Agrobacterium rhizogenes is transformed with a mobile CRISPR/Cas9 gene editing vector. Agrobacterium rhizogenes infects and roots to produce mobile gene editing elements, which are then transported to newly growing buds, plants, leaves, flowers, fruits, seeds, and other organs to carry out gene editing. This invention develops a simple and efficient plant gene editing method without exogenous DNA.
Smart Images

Figure CN116286946B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and specifically relates to a simple, efficient, tissue culture-free method for editing plant genes without exogenous DNA. Background Technology
[0002] Traditional breeding and molecular design breeding targeting high and stable yields and quality agronomic traits have long been the main methods for crop genetic improvement by researchers and breeding experts. Among these, research using high-precision plant genome editing technology with the CRISPR / Cas9 system to introduce beneficial gene functions or remove detrimental gene functions has made rapid progress. Exogenous DNA-free, DNA-free, or transgene-free genome editing technologies can produce non-transgenic genome-edited plants or animals, eliminating the risks associated with gene editing vector integration into the genome and reducing off-target rates. This largely alleviates concerns about the environmental and food safety aspects of gene-edited products and is of significant value for promoting gene-edited breeding. However, this gene-editing technology, based on genetic transformation, tissue culture, and transgenic element isolation, is expensive and time-consuming, making it unsuitable for most important crops.
[0003] The research paper "Cut-dip-budding delivery system enables genetic modification in plants without tissue culture" discloses an extremely simple cut-dip-budding (CDB) delivery system. This system uses *Agrobacterium rhizogenes* to infect the cut rhizome junction, where the upper part of the rhizome produces transforming roots, which in turn produce transformed plants. The CDB delivery system has successfully enabled genetic transformation of plant species from multiple plant families, including two herbaceous plants (rubbergrass and crown vetch), one tuberous rhizome plant (sweet potato), and three woody plant species (ailanthus, *Aralia elata*, and double-flowered jasmine). These plants were previously difficult or impossible to genetically transform, but the CDB delivery system, under non-sterile conditions, without tissue culture, and using a very simple explant soaking process, enables effective transformation or gene editing in these plants. However, this method requires root induction to bud and the formation of plants, and is limited by species where root induction to bud is difficult, thus preventing the achievement of gene editing without exogenous DNA.
[0004] The research paper, "Heritable transgene-free genome editing in plants by transfer of Cas9 and gRNA transcripts from transgenic donor rootstocks to grafted wild-type shoots," discloses a method for achieving long-distance cross-species gene editing in plants by combining grafting with "mobile" CRISPR editing tools (also known as "gene scissors") using mobile TLS (tRNA-like sequence) and CRISPR tools. This technique can simplify and accelerate the development of new, genetically stable commercial crop varieties. However, this method requires genetic transformation and grafting, is technically complex, and grafting is species-specific.
[0005] Currently, there are no reported simple, efficient, tissue culture-free, and genotype- and species-independent methods for plant gene editing without exogenous DNA. Summary of the Invention
[0006] This invention develops a simple and efficient plant gene editing method without exogenous DNA that requires no tissue culture or grafting and is not limited by genotype or species. It can be applied to all herbaceous and woody plants with stems and the ability to induce hairy roots, and can greatly promote the application of gene editing technology in gene function verification and genetic engineering breeding.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] A plant gene editing method without exogenous DNA involves infecting the vegetative body of a plant with Agrobacterium rhizogenes containing mobile TLS gene editing elements, followed by culturing until the vegetative body germinates transgenic hairy roots. The RNA transcribed from the mobile TLS gene editing elements moves from the roots to the newly grown organs of the vegetative body under the influence of the mobile TLS to edit the plant genome.
[0009] Furthermore, the plant is a plant with a stem and capable of inducing hairy roots.
[0010] Furthermore, the plant is either a herbaceous plant or a woody plant. Preferably, the herbaceous plants are cabbage, chili peppers, tomatoes, cucumbers, onions, wheat, rice, etc.; and the woody plants are apples, pears, peaches, etc.
[0011] like Figure 1 As shown, in this invention, the above method includes the following steps:
[0012] Step 1: Design sgRNA based on the target gene to be edited, and synthesize sgRNA expression cassettes with mobile TLS;
[0013] Step 2: Insert the sgRNA expression cassette obtained in Step 1 into the CRISPR / Cas9 gene editing vector backbone, and add a mobile TLS sequence to the end of the Cas9 protein gene to construct a gene editing element containing a mobile TLS sequence. Then, transform Agrobacterium rhizogenes containing the mobile TLS gene editing element into Agrobacterium rhizogenes.
[0014] Step 3: The transformed Agrobacterium rhizogenes from Step 2 is used to infect the vegetative parts of plants, such as hypocotyls, stems, and branches. After culturing, the vegetative parts germinate transgenic hairy roots. The culture continues, and the RNA transcribed by the mobile TLS gene editing element moves from the root to the newly grown organs of the vegetative parts under the guidance of the mobile TLS to edit the plant genome.
[0015] In one embodiment of the present invention, the DMP9 gene of cabbage, pepper and tomato was used as the target gene, the mobile element TLS2 was selected, and pYLCRISPR / Cas9P35S-N was used as the gene editing vector backbone to perform plant gene editing, thereby realizing plant gene editing without foreign DNA.
[0016] This invention combines the Agrobacterium rhizogenes-induced hairy root transformation system with TLS (tRNA-like sequence) mobile element-mediated mobile CRISPR / Cas9 gene editing technology. Agrobacterium rhizogenes is transformed with a mobile CRISPR / Cas9 gene editing vector. Agrobacterium rhizogenes infects and roots to produce mobile gene editing elements, which are then transported to newly growing buds, plants, leaves, flowers, fruits, seeds, and other organs to carry out gene editing. This invention develops a simple and efficient plant gene editing method without exogenous DNA.
[0017] Compared with existing methods, the method of the present invention does not require tissue culture, grafting, and root-induced shoots, is not limited by genotype or species, is simple to operate, and can be applied to all herbaceous and woody plants with stems that can induce hairy roots. It can greatly promote the application of gene editing technologies such as CRISPR / Cas9 and Cpf1 in gene function verification and genetic engineering breeding. Attached Figure Description
[0018] Figure 1 This is a schematic diagram of the process of the mobile CRISPR / Cas9 gene editing method mediated by Agrobacterium rhizogenes and TLS mobile elements in this invention.
[0019] Figure 2 This is a diagram of the mobile CRISPR / Cas9 gene editing vector in Example 1.
[0020] Figure 3 This is a sequence alignment diagram of the DMP9 gene editing sites detected in cabbage, chili peppers, and tomatoes in Example 1. Detailed Implementation
[0021] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the present invention. Experimental methods not specifically described in the embodiments and reagents not specified in the formulations are all performed according to conventional conditions in the art.
[0022] Example 1
[0023] 1. Construction of gene editing vectors and transformation with Agrobacterium rhizogenes
[0024] 1.1 Design of target gene sgRNA
[0025] Knocking out the plant DMP9 gene can construct a plant haploid inducible line. In this example, the DMP9 homologous genes of Chinese cabbage, pepper and tomato were selected. The sgRNA sequences of the DMP9 genes of Chinese cabbage, pepper and tomato were designed using the design tool of Huazhong Agricultural University (http: / / cbi.hzau.edu.cn / crispr / ). The software selected the primer sequences according to parameters such as on-target / off-target scores, location (geneexon, intron, UTR or inttergenic) and CG content (30%-80% CG content) as shown in Table 1.
[0026] Table 1 sgRNA Sequence
[0027]
[0028] Following the method described by Friedrich Kragler's group (Lei Yang et al., 2023), an expression cassette containing the mobile element TLS2 sequence was artificially synthesized, as shown below:
[0029] cgacttgccttccgcacaatacatcatttcttcttagctttttttcttcttcttcgttcatacagtttttttttgtttatcagcttacattttcttgaaccgtagctttcgttttcttctttttaactttccattcggagtttttgtatcttgtttcatagtttgtcccaggattagaatgattaggcatcgaaccttcaagaatttgattgaataaaacatcttcattcttaagatatgaagataatcttcaaaaggcccctgggaatctgaaagaagagaagcaggcccatttatatgggaaagaacaatagtatttcttatataggcccatttaagttgaaaacaatcttcaaaagtcccacatcgcttagataagaaaacgaagctgagtttatatacagctagagtcgaagtagtgATTGGAAAACAGAGGAAAGCGTGTTTtagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcATTATCAGAGTGGTGGTGGGCCCATAACCCACAGGTCCGCTCTGATAAAAAAAAAttttttttgcaaaattttccagatcgatttcttcttcctctgttcttcggcgttcaatttctggggttttctcttcgttttctgtaactgaaacctaaaatttgacctaaaaaaaatctcaaataatatgattcagtggttttgtacttttcagttagttgagttttgcagttccgatgagataaaccaatattaatccaaact(Seq_4);
[0030] Wherein:
[0031] cgacttgccttccgcacaatacatcatttcttcttagctttttttcttcttcttcgttcatacagtttttttttgtttatcagcttacattttcttgaaccgtagctttcgttttcttctttttaactttccattcggagtttttgtatcttgtttcatagtttgtcccaggattagaatgattaggcatcgaaccttcaagaatttgattgaataaaacatcttcattcttaagatatgaagataatcttcaaaaggcccctgggaatctgaaagaagagaagcaggcccatttatatgggaaagaacaatagtatttcttatataggcccatttaagttgaaaacaatcttcaaaagtcccacatcgcttagataagaaaacgaagctgagtttatatacagctagagtcgaagtagtg(Seq_5) is the pU6-26 promoter;
[0032] GAAAACAGAGGAAAGCGT(Seq_6) is sgRNA;
[0033] tagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc(Seq_7) is the gRNA Scaffold sequence;
[0034] ATTATCAGAGTGGTGGTGGGCCCATAACCCACAGGTCCGCTCTGATA(Seq_8) is tRNA MetΔDT (TLS2) sequences;
[0035] ttttttttgcaaaattttccagatcgatttcttcttcctctgttcttcggcgttcaatttctggggtttctcttcgttttctgtaactgaaacctaaaatttgacctaaaaaa aatctcaaataatatgattcagtggttttgtacttttcagttagttgagtttgcagttccgatgagataaaccaatattaatccaaact(Seq_9) is tU6-26terminator sequence.
[0036] 1.2 Construction of a mobile CRISPR / Cas9 gene editing vector
[0037] The gene editing vector backbone was pYLCRISPR / Cas9P35S-N (Addgene Plasmid#66191) from the research group of Academician Liu Yaoguang at South China Agricultural University. Following the method of Friedrich Kragler's research group (Lei Yang et al., 2023), a TLS2 sequence (ATTATCAGAGTGGTGGTGGGCCCATAACCCACAGGTCCGCTCTGATATCGA) was added after the Cas9 protein stop codon to obtain pYLCRISPR / Cas9-TLS2. The synthesized sgRNA expression cassette was then inserted into this vector using the AscI restriction site to obtain a mobile CRISPR / Cas9 gene editing vector. Figure 2 As shown.
[0038] The mobile CRISPR / Cas9 gene editing vector plasmid was transformed into Agrobacterium rhizogenes K599 (NCPPB2659, streptomycin resistance) using the freeze-thaw method. Positive clones were picked from the plate and cultured in 1 mL of LB medium (containing 50 mg / L kanamycin and 50 mg / L streptomycin) at 28 °C and 250 rpm. Then, 200 μL of the culture was transferred to a solid LB plate (containing 50 mg / L kanamycin and 50 mg / L streptomycin) and cultured overnight at 28 °C.
[0039] 1.3 Agrobacterium rhizogenes infection
[0040] Seeds of Chinese cabbage 49 (heart), Nanjing early pepper, and tomato (micro-TOM variety) with short growth periods, plump seeds, and similar size were selected and sown in sterilized vermiculite substrate. The culture conditions were: 12 hours of light, light intensity 2000–3000 lx, and temperature 25℃. After 7 days, when the two cotyledons were growing well, plants of uniform size were selected. Hypocotyls with two cotyledons were cut, and Agrobacterium rhizogenes containing a mobile CRISPR / Cas9 gene-editing vector plasmid were scraped from LB agar plates and applied to the wound at the base of the hypocotyl. The plants were then cultured in the substrate, keeping the substrate and environment moist. After root development, the Cas9 gene was amplified by PCR to detect the presence of gene-editing elements in the roots. To quickly obtain seeds, plants with positive root systems were cultured for a short growth cycle and the seeds were harvested.
[0041] 1.4 Identification of Gene-Edited Plants
[0042] Two hundred seeds each from positive root systems of cabbage, chili pepper, and tomato were harvested and sown for cultivation. Genomic DNA was extracted from the leaves using the CTAB method. Based on the edited gene sequence, primers containing the edited site were designed for PCR amplification (Table 2). The amplified PCR fragments were purified and recovered using a gel extraction kit, ligated into a T-vector, and transformed into *E. coli*. Three single clones from each sample were selected, cultured, and subjected to culture PCR before being sent to the company for sequencing. The sequencing results were compared with the gene sequence to detect whether the gene site had been edited and to calculate the editing efficiency.
[0043] Table 2 Primer sequences for identifying editing sites in non-heading Chinese cabbage and chili peppers.
[0044]
[0045] like Figure 3 The results showed that in the sequencing results of 200 cabbage seeds, gene mutations occurred near the gene editing site in 2 samples, with a gene editing efficiency of 1.0%; in the sequencing results of 200 pepper seeds, gene mutations occurred in 1 sample, with a gene editing efficiency of 0.5%; and in the sequencing results of 200 tomato seeds, gene mutations occurred in 4 samples, with a gene editing efficiency of 2.0%.
Claims
1. A method for gene editing of a plant without foreign DNA, characterized by, Agrobacterium rhizogenes containing mobile TLS (tRNA like sequence) gene editing elements was used to infect the vegetative parts of plants. The plants were then cultured until transgenic hairy roots sprouted from the vegetative parts. The RNA transcribed by the mobile TLS gene editing elements moved from the roots to the newly grown organs of the vegetative parts to edit the plant genome. Includes the following steps: Step 1: Design sgRNA based on the target gene to be edited, and synthesize sgRNA expression cassettes with mobile TLS; Step 2: Insert the sgRNA expression cassette obtained in Step 1 into the CRISPR / Cas9 gene editing vector backbone, and add a mobile TLS sequence to the end of the Cas9 protein gene to construct a mobile TLS gene editing element. Then, transform the mobile TLS gene editing element into Agrobacterium rhizogenes. Step 3: The transformed Agrobacterium rhizogenes from Step 2 is used to infect the vegetative parts of the plant. After culturing until the vegetative parts germinate transgenic hairy roots, the culture continues. The RNA transcribed by the moving TLS gene editing element moves from the root to the newly grown organs of the vegetative part under the influence of the moving TLS to edit the plant genome. The plant is cabbage, chili pepper, or tomato; The target gene is the DMP9 gene. The sgRNA sequence of BRDMP9 from Chinese cabbage is: GAAAACAGAGGAAAGCGT; The sgRNA sequence of CaDMP9 in chili pepper is: GTGACACTTTGTCTATTTCC; The sgRNA sequence of tomato SlDMP9 is: GAATTACCAATACCAATTGG; The mobile TLS is tRNA MetΔDT ; The CRISPR / Cas9 gene editing vector backbone is pYLCRISPR / Cas9P35S-N.
Citation Information
Patent Citations
Plant gene editing system and method for delivering CRISPR / Cas9 based on mobile RNA
CN120966875A