Use of a lipopolysaccharide in the specific induction of cells to produce il24

Abstract

The application belongs to the technical field of induced expression, and discloses application of lipopolysaccharide in specific induction of cells to produce IL24. The application applies lipopolysaccharide in specific induction of cells to produce IL24. It is found that lipopolysaccharide (LPS) of Porphyromonas gingivalis can specifically induce fibroblasts to produce IL24. Compared with IL-1β, IL17A and other cytokines that can induce cells to produce IL24 in the prior art, P.g-LPS is simpler to obtain and has lower cost. The application provides a new idea for treating tumor diseases by inducing IL24.

Description

Technical Field

[0001] This invention relates to the field of induced expression technology, specifically to the application of a lipopolysaccharide in specifically inducing cells to produce IL24. Background Technology

[0002] IL-24 (interleukin-24), also known as melanoma differentiation-associated gene 7 (mda-7), plays a crucial role in inhibiting tumor growth. IL-24 inhibits tumorigenesis through several pathways: Directly, it induces tumor cell apoptosis via endogenous mitochondrial pathways, including: IL-24 induction leads to loss of mitochondrial function and a decrease in membrane potential, resulting in ROS production and tumor cell apoptosis; and the endoplasmic reticulum pressure pathway, where IL-24 stimulation activates the tumor cell conserved protein UPR, leading to GADD gene expression and subsequent tumor cell apoptosis. Furthermore, in some malignant tumors, IL-24 can indirectly inhibit tumor cell invasion and migration through mechanisms such as gap junctions, immune responses, ischemic necrosis, apoptosis, and phagocytosis. For example, IL-24 can activate CD8+. + T cells exert a remote bystander effect, inhibiting the growth of distant tumor cells. IL24 can also suppress tumorigenesis through other pathways, such as inhibiting tumor angiogenesis and mediating other immunological effects. Due to these advantages, IL24 has become a preferred anti-cancer gene for gene therapy and has significant clinical value. While IL24 has been reported to be produced by various cells in the body, research on the factors that induce its production is currently lacking. Summary of the Invention

[0003] The purpose of this invention is to overcome the shortcomings of the prior art and provide an application of lipopolysaccharide in specifically inducing cells to produce IL24.

[0004] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0005] In one aspect, the present invention utilizes lipopolysaccharide in the specific induction of IL24 production in cells.

[0006] This invention discovers that lipopolysaccharide (LPS) from *Porphyromonas gingivalis* can specifically induce fibroblasts to produce IL24. Compared to existing technologies that can induce IL24 production by cytokines such as IL-1β and IL-17A, Pg-LPS is simpler to obtain and less expensive.

[0007] In a preferred embodiment of the application described in this invention, the lipopolysaccharide is extracted from Porphyromonas gingivalis.

[0008] Furthermore, the *Porphyromonas gingivalis* strain is *Porphyromonas gingivalis* ATCC33277.

[0009] Furthermore, the extraction method includes the following steps:

[0010] (1) The *Porphyromonas gingivalis* was revived and cultured in an anaerobic incubator;

[0011] (2) Lipopolysaccharide was extracted using a lipopolysaccharide extraction kit;

[0012] (3) The extracted lipopolysaccharide was treated with 70% ethanol and proteinase K, dialyzed with ultrapure water, centrifuged, and made into freeze-dried powder.

[0013] Furthermore, in step (1), the resuscitation is performed using brain and heart immersion culture medium; the culture conditions are 80% N2, 10% H2, 10% CO2, and the time is 36 to 48 hours.

[0014] Furthermore, in step (3), the dialysis is performed using ultrapure water at 4°C for 36 to 48 hours.

[0015] In a preferred embodiment of the application described in this invention, the cell is a fibroblast.

[0016] In a preferred embodiment of the application described in this invention, the lipopolysaccharide is co-cultured with the cells.

[0017] Furthermore, the concentration of the lipopolysaccharide is 0.1–10 μg / mL.

[0018] Secondly, this invention relates to the application of lipopolysaccharide in the preparation of drugs that inhibit tumors by specifically inducing cells to produce IL24. This invention provides a new approach to treating tumor diseases by inducing IL24.

[0019] In a preferred embodiment of the application described in this invention, the lipopolysaccharide is extracted from Porphyromonas gingivalis.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] This invention discovers that lipopolysaccharide (LPS) from *Porphyromonas gingivalis* can specifically induce fibroblasts to produce IL-24. Compared to existing cytokines such as IL-1β and IL-17A that can induce IL-24 production, Pg-LPS is simpler to obtain and less expensive. This invention provides a new approach for treating tumor diseases by inducing IL-24. Attached Figure Description

[0022] Figure 1To detect the expression of IL24 mRNA in fibroblasts after stimulating them with lipopolysaccharide from Porphyromonas gingivalis (Pg-LPS) and lipopolysaccharide from Escherichia coli (E. coli-LPS), real-time quantitative PCR was performed on the cells.

[0023] Figure 2 To detect the expression of IL24 protein in fibroblasts after stimulating them with lipopolysaccharide from Porphyromonas gingivalis (Pg-LPS) and lipopolysaccharide from Escherichia coli (E. coli-LPS), respectively, immunofluorescence was performed on the cells. In the figure, Vimentin is a marker of fibroblasts, and DAPI is used to label the cell nucleus.

[0024] Figure 3 Western blot analysis was performed on fibroblasts stimulated with different concentrations of Porphyromonas gingivalis lipopolysaccharide (Pg-LPS) to detect the expression of IL24 protein in the cells; β-Actin is the internal reference protein in the figure. Detailed Implementation

[0025] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0026] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0027] Example 1: Extraction of lipopolysaccharide (Pg-LPS) from Porphyromonas gingivalis

[0028] The extraction method for lipopolysaccharide (Pg-LPS) from *Porphyromonas gingivalis* is as follows:

[0029] Porphyromonas gingivalis (ATCC 33277) was purchased from the Institute of Microbiology, Chinese Academy of Sciences. Pg was revived in brain heart infusion medium (BHI, BD, USA) and cultured in an anaerobic incubator (80% N2, 10% H2, 10% CO2) for 48 hours. Pg-LPS was extracted using a lipopolysaccharide extraction kit (Invitrogen, USA). The extracted Pg-LPS was treated with 70% ethanol and proteinase K (Amer esco, USA), followed by dialyzing with ultrapure water at 4°C for 48 hours, centrifugation, and preparation into a lyophilized powder. The prepared Pg-LPS was subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The electrophoresis method is as follows:

[0030] (1) Prepare a 10 μg / mL Pg-LPS solution using sterile phosphate-buffered saline (PBS).

[0031] (2) SDS-PAGE gel electrophoresis and imaging

[0032] ① Take the above protein sample and add 5× Loading buffer according to the ratio, and denature at 100℃ for 10 minutes;

[0033] ② Prepare the SDS-PAGE electrophoresis gel according to the kit instructions. Place the electrophoresis gel in the electrophoresis tank, add the electrophoresis buffer, and remove the comb. Add 10 μL of Pg-LPS sample to each lane and add 3 μL of protein pre-stained marker to the lanes on both sides of the sample.

[0034] ③ Turn on the power and maintain a constant voltage of 70V for electrophoresis until the Maker reaches the separation gel position. Adjust the voltage to 110V and electrophoresis for about 70 minutes. Stop electrophoresis when the Maker reaches the bottom of the electrophoresis gel.

[0035] Next, the SDS-PAGE gel was silver stained, and the specific steps are as follows:

[0036] (1) Fixation: Take 125 mL of ultrapure water, add 25 mL of acetic acid and 100 mL of methanol to prepare a fixative solution, and fix the gel in the fixative solution for 60 minutes.

[0037] (2) Soaking: Add 75 mL of methanol, 0.5 g of anhydrous sodium thiosulfate, 17 g of sodium acetate, and 28.18 g of sodium acetate trihydrate to 165 mL of ultrapure water. Add 100 μL of formaldehyde diluted 10 times to every 10 mL of solution, and soak the gel in the solution for 30 minutes;

[0038] (3) Washing: Wash three times with ultrapure water, 10 minutes each time;

[0039] (4) Silver staining: Add 0.625g of silver nitrate to 250mL of ultrapure water to prepare a silver staining solution, and place the gel in the silver staining solution for 20 minutes;

[0040] (4) Color development: Add 6.25g of anhydrous sodium carbonate to 250mL of ultrapure water to prepare a color development solution. Add 150μL of formaldehyde diluted 10 times to every 25mL of color development solution. Use the color development solution to develop the gel color. Stop the color development when the bands are clearly visible.

[0041] Observation revealed that the purified Pg-LPS showed clear bands in the low molecular weight region (around 15KD) on SDS-PAGE gel, with no obvious impurity bands, indicating that the purified Pg-LPS had high purity.

[0042] Prepare Pg-LPS solution using sterile phosphate-buffered saline (PBS) at the required concentration for subsequent experiments.

[0043] Example 2: Culture of fibroblasts

[0044] The culture method for fibroblasts is as follows:

[0045] Gingival tissue obtained during orthodontic tooth extraction was collected, minced, and spread evenly at the bottom of a culture dish. High-glucose DMEM medium (Biosharp, China) containing 10% fetal bovine serum was added. The medium was changed every three days. When the fibroblasts filled the bottom of the culture dish, the cells were digested and passaged. The fourth generation of cells was collected for experiments.

[0046] Example 3: Effect of Pg-LPS on IL24 expression in fibroblasts

[0047] 1. Using E. coli lipopolysaccharide (E. coli-LPS) as a control, the expression of IL24 mRNA in fibroblasts was detected by real-time quantitative PCR after co-culturing 10 μg / ml of Pg-LPS extracted in Example 1 with fibroblasts cultured in Example 2 for 6 hours. The control E. coli lipopolysaccharide (E. coli-LPS) was purchased from MACKLIN (China).

[0048] The real-time quantitative PCR detection method is as follows:

[0049] (1) After digesting and centrifuging each component of fibroblasts, discard the supernatant;

[0050] (2) RNA was extracted from the above fibroblasts using an RNA extraction kit (Omega, USA), and the concentration was initially measured using Nanodrop;

[0051] (3) The RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara Corporation, Japan);

[0052] (4) The RT-qPCR reaction conditions for determining the expression of the target gene using the ABI QuantStudio5 system were set as follows: 95℃ for 1 minute; 95℃ for 20 seconds, 55℃ for 20 seconds, 72℃ for 30 seconds for 40 cycles; 65℃ at 0.2℃ per second to 95℃; 72℃ for 5 minutes.

[0053] (5) The expression of target genes was calculated using the ΔΔCt method with ACTB as an internal reference.

[0054] The primer sequences used are as follows:

[0055] IL24:

[0056] Forward Primer: TGGACTTTAGCCAGACCCTTCT

[0057] Reverse Primer: GGGCCCAAAGTGGAATTCTTG

[0058] ACTB:

[0059] Forward Primer: CCTTCCTGGGCATGGAGTC

[0060] Reverse Primer: TGATCTTCATGTGCTGGGTG

[0061] After stimulating fibroblasts with lipopolysaccharide (Pg-LPS) from *Porphyromonas gingivalis* and lipopolysaccharide (E. coli-LPS), the results of real-time quantitative PCR detection of IL24 mRNA in the cells are as follows: Figure 1 As shown, no significant changes were observed in the co-culture of E. coli lipopolysaccharide (E. coli-LPS) with fibroblasts. However, co-culture of Porphyromonas gingivalis lipopolysaccharide (Pg-LPS) with fibroblasts significantly increased the expression of IL24 mRNA in fibroblasts, indicating that co-culture of Pg-LPS with fibroblasts could significantly induce IL24 mRNA expression.

[0062] 2. Using E. coli lipopolysaccharide (E. coli-LPS) as a control, Pg-LPS extracted in Example 1 was co-cultured with fibroblasts cultured in Example 2. The amount of LPS added was 10 μg / mL. After co-culturing for 6 hours, the production of IL24 protein in fibroblasts was detected by immunofluorescence.

[0063] After stimulating fibroblasts with lipopolysaccharide (Pg-LPS) from *Porphyromonas gingivalis* and lipopolysaccharide (E. coli-LPS), the expression of IL24 protein in the cells was detected by immunofluorescence. The results are as follows: Figure 2 As shown in the figure, Vimentin is a marker for fibroblasts, and DAPI marks the cell nucleus. Co-culturing fibroblasts with Porphyromonas gingivalis lipopolysaccharide (Pg-LPS) significantly increased the production of IL24 protein in fibroblasts, and co-culturing Pg-LPS with fibroblasts could significantly induce IL24 protein expression.

[0064] 3. Using β-Actin as an internal reference protein, Pg-LPS extracted in Example 1 was co-cultured with fibroblasts cultured in Example 2. The amount of LPS added was 0 μg / mL, 0.1 μg / mL, 1 μg / mL, and 10 μg / mL. Western blot was used to detect the expression of IL24 protein in fibroblasts after stimulation with different concentrations of Porphyromonas gingivalis lipopolysaccharide (Pg-LPS).

[0065] The Western blot detection method is as follows:

[0066] (1) After digesting the above fibroblasts, transfer them to a 1.5 mL EP tube, centrifuge and discard the supernatant, add an appropriate amount of RIPALysis Buffer, and lyse at 4 °C for 30 minutes.

[0067] (2) After lysis, centrifuge at 12000g speed and 4℃ for 10 minutes and take the supernatant, which is the protein sample;

[0068] (3) Protein concentration was determined using the BCA method.

[0069] ① Dilute the 2 mg / mL protein standard with PBS;

[0070] ② Add 20 μL of diluted protein standard to a flat-bottomed 96-well plate;

[0071] ③ Add 2 μL of the above protein sample to a flat-bottomed 96-well plate, add 18 μL of PBS, and mix well;

[0072] ④ Mix reagents A and B of the BCA kit at a volume ratio of 50:1, add 200 μL of diluted BCA reagent to each well of the protein standard or protein sample, and incubate at 37°C for 30 minutes.

[0073] ⑤ Use an enzyme-linked immunosorbent assay (ELISA) reader to determine the OD value of protein standards or protein samples at a wavelength of 562 nm, and construct a standard curve based on the OD value of the protein standards and calculate the concentration of the protein samples.

[0074] (4) SDS-PAGE gel electrophoresis and imaging

[0075] ① Take the above protein sample and add 5× Loading buffer according to the ratio, and denature at 100℃ for 10 minutes;

[0076] ② Prepare the SDS-PAGE electrophoresis gel according to the kit instructions. Place the electrophoresis gel in the electrophoresis tank, add the electrophoresis buffer, and remove the comb. Add 30 μg of protein sample to each lane and add 3 μL of protein pre-stained marker to the lanes on both sides of the sample.

[0077] ③ Turn on the power and maintain a constant voltage of 70V for electrophoresis until the Maker reaches the separation gel position. Adjust the voltage to 110V and electrophoresis for about 70 minutes. Stop electrophoresis when the Maker reaches the bottom of the electrophoresis gel.

[0078] ④ Cut the PVDF membrane according to the size of the electrophoresis gel, pretreat the PVDF membrane with methanol for 1 minute, and equilibrate the transfer solution for 15 minutes;

[0079] ⑤ Place the following materials in the order of black transfer clamp, sponge, filter paper, electrophoresis gel, PVDF membrane, filter paper, sponge, and white transfer clamp, then clamp the transfer clamp, add transfer solution, turn on the power supply, and transfer the membrane for 80 minutes in an ice bath with a constant current of 200mA.

[0080] ⑥ After the transfer is complete, remove the PVDF membrane and place it in TBST containing 5% BSA, then seal it at room temperature for 1 hour;

[0081] ⑦ After blocking, add the diluted primary antibody, cover with PVDF membrane, and incubate on a shaker at 4°C for 16–18 hours;

[0082] ⑧ Elute with TBST 3 times, 5 minutes each time, add secondary antibody to cover PVDF membrane, incubate at room temperature for 1 hour, elute with TBST 3 times, 5 minutes each time;

[0083] ⑨ Prepare ECL luminescent solution at a 1:1 ratio and place it on a PVDF membrane. Incubate at room temperature in the dark for 3 minutes, then develop and save the image using a chemiluminescence imager.

[0084] Fibroblasts were stimulated with different concentrations of Porphyromonas gingivalis lipopolysaccharide (Pg-LPS), and the expression of IL24 protein was detected by Western blot. Western blot experiments confirmed that the induction of IL24 in fibroblasts by Pg-LPS was concentration-dependent. Compared with stimulation with 0.1 μg / mL Pg-LPS, stimulation with 1 μg / mL Pg-LPS for 6 hours significantly upregulated IL24 expression in fibroblasts. Pg-LPS concentrations of 0.1–10 μg / mL are suitable for stimulating IL24 expression in fibroblasts without affecting fibroblast growth.

[0085] This invention discovers that lipopolysaccharide (LPS) from *Porphyromonas gingivalis* can specifically induce fibroblasts to produce IL-24. Compared to existing cytokines such as IL-1β and IL-17A that can induce IL-24 production, Pg-LPS is simpler to obtain and less expensive. This invention provides a new approach for treating tumor diseases by inducing IL-24.

[0086] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. The application of a lipopolysaccharide in the in vitro specific induction of IL24 production in cells, characterized in that, The lipopolysaccharide was extracted from Porphyromonas gingivalis, the cells were fibroblasts, and the concentration of the lipopolysaccharide was 0.1~10 μg / mL.

2. The application according to claim 1, characterized in that, The *Porphyromonas gingivalis* strain is *Porphyromonas gingivalis* ATCC33277.

3. The application according to claim 1, characterized in that, The extraction method includes the following steps: (1) The *Porphyromonas gingivalis* was revived and cultured in an anaerobic incubator; (2) Extract lipopolysaccharides using a lipopolysaccharide extraction kit; (3) The lipopolysaccharide extracted by treatment with 70% ethanol and proteinase K was dialyzed with ultrapure water, centrifuged, and made into freeze-dried powder.

4. The application according to claim 3, characterized in that, In step (1), the resuscitation is performed using brain and heart immersion culture medium; the culture conditions are 80% N2, 10% H2, 10% CO2, and the time is 36-48 hours; in step (3), the dialysis is performed using 4℃ ultrapure water for dialysis for 36-48 hours.

5. The application according to claim 1, characterized in that, The lipopolysaccharide is co-cultured with the cells.

Images