Snp molecular marker of sif gene related to growth traits of portunus trituberculatus and application thereof

By screening SNP molecular markers on the SIF gene of the swimming crab *Portunus trituberculatus*, combined with multiplex PCR and high-throughput sequencing, genetic improvement of the growth traits of *Portunus trituberculatus* was achieved, solving the problems of slow growth and germplasm degradation, and increasing growth rate.

CN116287295BActive Publication Date: 2025-10-17HEBEI UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310117057.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-15
Publication Date
2025-10-17
Estimated Expiration
2043-02-15

AI Technical Summary

Technical Problem

The swimming crab (Portunus trituberculatus) suffers from slow growth, genetic degradation, and poor resistance to adverse conditions, making it difficult to effectively improve its growth traits using existing technologies.

Method used

By mining SNP molecular markers on the SIF gene on chromosome 3 of the swimming crab *Portunus trituberculatus*, and combining multiplex PCR and high-throughput sequencing technologies, markers such as SNP3_9896582, SNP3_9896589, SNP3_9949209, and SNP3_9959513 were screened out. Genotyping and association analysis were performed, and individuals with dominant alleles were selected for breeding.

Benefits of technology

It significantly improved the growth rate of the three-spined swimming crab's carapace width, carapace length, body height, and weight, achieving genetic improvement of growth traits with high accuracy and unaffected by the aquaculture environment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004078931380000021
    Figure BDA0004078931380000021
  • Figure BDA0004078931380000051
    Figure BDA0004078931380000051
  • Figure BDA0004078931380000052
    Figure BDA0004078931380000052
Patent Text Reader

Abstract

The application discloses a group of Portunus trituberculatus SIF The application discloses a SNP marker related to growth traits and application thereof in genetic breeding. The SNP molecular marker comprises SNP3_9896582, the sequence of which is shown as SEQ ID NO. 1; SNP3_9896589, the sequence of which is shown as SEQ ID NO. 3; SNP3_9949209, the sequence of which is shown as SEQ ID NO. 3; and SNP3_9959513, the sequence of which is shown as SEQ ID NO. 4. The SNP molecular marker is associated with the full carapace width, back shell length, body height or body weight traits of Portunus trituberculatus. The SNP marker involved in the application is high in efficiency and accuracy, and can be used as a growth trait related molecular marker to assist genetic breeding of growth traits of Portunus trituberculatus.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of aquatic animal genetic breeding, and particularly relates to a SNP marker related to a growth trait on a SIF gene of Portunus trituberculatus and application thereof in breeding. BACKGROUND

[0002] Portunus trituberculatus, commonly known as Portunus trituberculatus, white crab, occupies an important position in the marine aquaculture industry in China. China is the largest producer of Portunus trituberculatus in the world. According to the data of the 2021 United Nations Food and Agriculture Organization (FAO), China's Portunus trituberculatus production in 2019 was 45.838 million tons, accounting for 99.5% of the world's total production. Portunus trituberculatus not only has important economic value, but also has delicious taste and unique flavor. Its edible parts such as muscle and hepatopancreas contain rich minerals, and are deeply loved by consumers. However, in recent years, due to the phenomenon of degeneration of germplasm, slow growth, poor stress resistance and other phenomena, which seriously hinder the sustainable development of Portunus trituberculatus industry.

[0003] With the development of DNA sequencing technology, the use of high-throughput molecular markers in aquatic animal genetic breeding has become an inevitable way to develop modern aquaculture, accelerating the process of breeding good strains. In previous studies, researchers identified a number of growth-related SNP markers, QTL and candidate genes in Portunus trituberculatus through transcriptome sequencing technology and genetic linkage map, and carried out molecular marker-assisted breeding research (Liu Lei, 2014.). However, growth traits are complex, controlled by multiple genes, and the genetic mechanism of growth traits is not yet clear.

[0004] Single nucleotide polymorphism (SNP) is an important molecular genetic marker that can directly reflect genetic variation in DNA sequence. Due to its high genetic diversity, strong stability and less environmental impact, SNP molecular marker-assisted breeding has been widely used in aquatic animal breeding. With the publication of the Portunus trituberculatus genome, high-throughput sequencing of Portunus trituberculatus using reference genomes can significantly improve the accuracy of sequence alignment and obtain more SNP markers, providing an important basis for fine mapping of growth-related genes and genetic improvement of growth traits. Therefore, mining molecular markers affecting the growth traits of Portunus trituberculatus plays an important role in establishing a molecular marker-assisted breeding system.

[0005] Studies have shown that SIF (Protein still life, isoforms C / SIF type 2-like) is an important candidate gene related to growth traits of aquatic animals. It is a guanine nucleotide exchange factor located on chromosome 3 of Portunus trituberculatus, which can regulate synaptic differentiation by activating Rho-like G proteins to affect the organization of actin cytoskeleton. SUMMARY

[0006] The purpose of the present application is to provide a set of SNP molecular markers related to growth traits of SIF gene of Portunus trituberculatus and application thereof.

[0007] To achieve the above purpose, the technical scheme adopted by the present application is:

[0008] A set of SNP molecular markers related to growth traits of SIF gene of Portunus trituberculatus, the SNP molecular markers are located on SIF gene of chromosome 3 of Portunus trituberculatus, and include SNP3_9896582, SNP3_9896582, SNP3_9949209 and SNP3_9959513; wherein:

[0009] The SNP3_9896582 has the nucleotide sequence shown in SEQ ID NO. 1 in the sequence listing, and the marker is located at the position of 118bp of the sequence of SEQ ID NO. 1, which is a T / G type SNP marker;

[0010] The SNP3_9896589 has the nucleotide sequence shown in SEQ ID NO. 2 in the sequence listing, and the marker is located at the position of 111bp of the sequence of SEQ ID NO. 2, which is an A / C type SNP marker;

[0011] The SNP3_9949209 has the nucleotide sequence shown in SEQ ID NO. 3 in the sequence listing, and the marker is located at the position of 89bp of the sequence of SEQ ID NO. 3, which is a T / G type SNP marker;

[0012] The SNP3_9959513 has the nucleotide sequence shown in SEQ ID NO. 4 in the sequence listing, and the marker is located at the position of 68bp of the sequence of SEQ ID NO. 4, which is a G / A type SNP marker;

[0013] The SNP molecular markers SNP3_9896582 and SNP3_9896582 are both associated with the whole carapace width, carapace length, body height and body weight traits of Portunus trituberculatus, and SNP3_9949209 and SNP3_9959513 are both associated with the whole carapace width, body height and body weight traits of Portunus trituberculatus.

[0014] The advantageous allele genotypes of each of the above SNP molecular markers are TT, AA, TG and GG, that is, the individuals with TT, AA, TG and GG genotypes have faster growth speed than individuals with other genotypes.

[0015] The application also provides a primer pair for detecting the above-mentioned SNP molecular markers of the application:

[0016] The primer pair for detecting the SNP molecular markers SNP3_9896582 and SNP3_9896589 is the same, and the nucleotide sequences thereof are shown as SEQ ID NO. 5-6;

[0017] The nucleotide sequences of the primer pair for detecting the SNP molecular marker SNP3_9949209 are shown as SEQ ID NO. 7-8;

[0018] The nucleotide sequences of the primer pair for detecting the SNP molecular marker SNP3_9959513 are shown as SEQ ID NO. 9-10.

[0019] Specifically, the sequences of the primer pairs are shown in the following table:

[0020]

[0021] The application of the above-mentioned SNP molecular markers or primer pairs in the breeding or genetic breeding of Portunus trituberculatus growth traits. That is, one or more of the above-mentioned growth-related SNP molecular markers are selected for genotyping of breeding individuals, and individuals with advantageous allele genotypes or individuals with more advantageous allele genotypes are selected for breeding, so as to improve the growth speed (full carapace width, dorsal carapace length, body height and body weight growth speed) of the breeding individuals.

[0022] The specific analysis steps include:

[0023] (1) Extracting genomic DNA of the population to be analyzed;

[0024] (2) Using the genomic DNA of the population to be analyzed as a template, performing multiplex PCR amplification and high-throughput sequencing using the primer pairs of the SNP molecular markers;

[0025] (3) Performing correlation analysis of SNP genotype data and phenotype data:

[0026] When amplifying the sample to be tested, if the primer pair of the SNP molecular marker SNP3_9896582 can amplify the TT genotype, it indicates that the sample to be tested is a Portunus trituberculatus strain with better full carapace width, dorsal carapace length, body height and body weight traits associated with the genotype TT;

[0027] When the primer pair of the SNP molecular marker SNP3_9896589 is used to amplify the sample to be tested, if the AA genotype can be amplified, it indicates that the sample to be tested is a Portunus trituberculatus strain with better full carapace width, body height and body weight traits associated with the AA genotype;

[0028] When the primer pair of the SNP molecular marker SNP3_9949209 is used to amplify the sample to be tested, if the TG genotype can be amplified, it indicates that the sample to be tested is a Portunus trituberculatus strain with better full carapace width, body height and body weight traits associated with the TG genotype;

[0029] When the primer pair of the SNP molecular marker SNP3_9959513 is used to amplify the sample to be tested, if the GG genotype can be amplified, it indicates that the sample to be tested is a Portunus trituberculatus strain with better full carapace width, body height and body weight traits associated with the GG genotype.

[0030] On the basis of the growth trait-related candidate gene SIF obtained by the previous simplified genome sequencing in the laboratory, the present application further mines the single nucleotide polymorphism (SNP) markers related to the growth of Portunus trituberculatus by combining multiple PCR and high-throughput sequencing technology to identify SNP sites, design SNP-specific primers and perform growth trait association analysis.

[0031] The SNP molecular marker provided by the present application is located on the SIF gene of the 3rd autosome of Portunus trituberculatus, and compared with the SNP molecular markers at other positions of the gene, the marker is significantly related to the growth traits of Portunus trituberculatus (P<0.05), the PCR amplification is more stable, and the marker has the advantages of high accuracy and being not affected by the breeding environment when applied to the growth trait improvement of Portunus trituberculatus, and has a good application prospect in the genetic breeding of Portunus trituberculatus. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 is the average body weight distribution diagram of individuals with different genotypes in the full-sibling family population, wherein the TG genotype and the TT genotype are amplified by the primer pair of the SNP molecular marker SNP3_9896582, and the AA genotype and the AC genotype are amplified by the primer pair of the SNP molecular marker SNP3_9896589. DETAILED DESCRIPTION

[0033] The following examples are used to further illustrate the present application, but do not limit the present application in any form.

[0034] Example 1: Obtaining of the SNP molecular marker

[0035] (1) Source of Portunus trituberculatus samples and measurement of growth trait phenotype values

[0036] The three-sib swimming crab samples came from a full-sib family material collected in Huanghua City, Hebei Province in September 2022, including 184 three-sib swimming crab individuals. When the three-sib swimming crab was about 100 mm long, each three-sib swimming crab sample was weighed and phenotypic traits were measured, including four important growth traits: full carapace width, carapace length, body height and weight. At this time, the average values ​​of the various traits of the three-sib swimming crab samples were measured as follows: full carapace width: 142.43±13.92 mm, carapace length: 66.42±7.32 mm, body height: 34.26±3.18 mm, and body weight: 160.14±52.89 g.

[0037] (2) Extraction and detection of genomic DNA from swimming crab samples

[0038] The muscle tissue DNA of the 184 swimming crabs (Portunus trituberculatus) was extracted using a marine animal genome extraction kit (Tiangen, Beijing). The specific operation steps were referred to the kit instructions. The concentration of the DNA of each individual was measured using a nucleic acid concentration meter NanoDrop2000, and the quality and integrity of the DNA were tested by 1% agarose gel electrophoresis. The DNA of all individuals was diluted to 50 ng / μl for later use.

[0039] (3) Development of SNP molecular markers and genotyping

[0040] Based on our laboratory's previous simplified genome sequencing results for the swimming crab (P. trituberculatus), we identified a candidate gene (SIF) associated with growth traits in the crab. The 184 DNA samples and SIF gene sequences extracted from the crab were sent to Shanghai Yihe Applied Biotechnology Co., Ltd. for SNP screening, specific primer design, high-throughput sequencing, genotyping, and growth trait association analysis.

[0041] Specifically, SNP sites were identified in the exons, 5'UTR and 3'UTR regions of the SIF gene. Through primer design, PCR amplification, high-throughput sequencing and other steps, data filtering was performed based on the minimum allele frequency (MAF) > 0.05 and the detection rate (call rate) > 70%. A total of 38 growth candidate SNP sites were screened out, and specific primers were designed for these SNP sites.

[0042] (4) Association analysis between SNP markers and growth traits

[0043] The association between different SNP markers and the growth traits (carapace width, carapace length, body height and body weight) of Portunus trituberculatus was analyzed by using the general linear model (GLM) in TASSEL2.1 software. First, the Q value of 184 samples of Portunus trituberculatus was calculated by using the STRUCTURE software and the CLUMPP software. Then, the Q value of each sample was used as a covariate, and the P value less than 0.05 was used as a significant marker.

[0044] The association analysis results show that only the SNP molecular markers SNP3_9896582, SNP3_9896589, SNP3_9949209 and SNP3_9959513 are significantly related to the growth traits of Portunus trituberculatus, as shown in Table 1: the SNP molecular markers SNP3_9896582 and SNP3_9896589 are significantly associated with the four growth traits of Portunus trituberculatus, including carapace width, carapace length, body height and body weight. The SNP molecular markers SNP3_9949209 and SNP3_9959513 are significantly associated with the three growth traits of Portunus trituberculatus, including carapace width, body height and body weight.

[0045] Table 1 Association of SNP molecular markers with growth traits of Portunus trituberculatus

[0046]

[0047] Note: * indicates significant difference (P < 0.05).

[0048] (5) Multiple comparison of growth traits between different genotypes of SNP molecular markers

[0049] The multiple comparison (LSD) of the growth trait phenotypic values between different genotypes of the four SNP molecular markers significantly associated with the growth traits of Portunus trituberculatus was performed by using the SPSS software, and the results are shown in Table 2:

[0050] The SNP molecular marker SNP3_9896582 amplifies two genes TG and TT, and the differences between the four growth traits of Portunus trituberculatus are significant; the average values of carapace width, carapace length, body height and body weight of the TT genotype individuals are significantly higher than those of the TG genotype individuals, indicating that TT is the dominant genotype, and the allele G is better than the allele T, which has a positive effect on the carapace width, carapace length, body height and body weight of Portunus trituberculatus;

[0051] SNP molecular marker SNP3_9896589 amplified AA and AC genotypes, and was significantly different in four growth traits of P. trituberculatus; the average of four growth traits of carapace width, carapace length, body height and body weight of AA genotype individuals was significantly higher than that of AC genotype individuals, indicating that AA was the dominant genotype, and allele A was superior to allele C, which had a positive effect on carapace width, carapace length, body height and body weight of P. trituberculatus;

[0052] SNP molecular marker SNP3_9949209 amplified TG and TT genotypes, and was significantly different in three growth traits of P. trituberculatus; the average of carapace width, body height and body weight of TG genotype individuals was significantly higher than that of TT genotype individuals, indicating that TG was the dominant genotype, and allele G was superior to allele T, which had a positive effect on carapace width, body height and body weight of P. trituberculatus;

[0053] SNP molecular marker SNP3_9959513 amplified GA and GG genotypes, and was significantly different in three growth traits of P. trituberculatus; the average of carapace width, body height and body weight of GG genotype individuals was significantly higher than that of GA genotype individuals, indicating that GG was the dominant genotype, and allele G was superior to allele A, which had a positive effect on carapace width, body height and body weight of P. trituberculatus.

[0054] Table 2 Multiple comparison of growth traits between different genotypes of SNP molecular markers

[0055]

[0056]

[0057] Note: * indicates significant difference (P<0.05).

[0058] The multiple comparison results of growth traits between different genotypes of SNP molecular markers (Table 2) showed that SNP molecular markers SNP3_9896582, SNP3_9896589, SNP3_9949209 and SNP3_9959513 could be used as ideal markers for P. trituberculatus growth trait genetic breeding with carapace width, carapace length, body height and body weight as breeding targets. In addition, TT genotype individuals in marker SNP3_9896582, AA genotype individuals in marker SNP3_9896589, TG genotype individuals in marker SNP3_9949209 and GG genotype individuals in marker SNP3_9959513 could be used as ideal parents for P. trituberculatus molecular marker assisted breeding.

[0059] Example 2 Application of SNP molecular marker SNP3_9896582 in genetic breeding

[0060] (1) Genotyping of the SNP3_9896582 locus of candidate parent individuals

[0061] In December 2022, 80 Portunus trituberculatus were selected as candidate parent individuals from a national Portunus trituberculatus seedling farm in Huanghua City, Hebei Province. After taking the muscle tissue DNA of each Portunus trituberculatus, the target region sequences of each individual were amplified using the following primers:

[0062] SNP3_9896582-F: TCACTCTCACTCTCTCCCTCTAG

[0063] SNP3_9896582-R: TGAACCAGAAATTTAGAAGTGTATCTCAT

[0064] The PCR amplification products were sequenced using a sequencer, and the sequencing primer was SNP3_9896582-F. According to the sequencing peak map, SNP3_9896582 was genotyped. If there was only one T base peak at this position, the genotyping result was TT type; if there was only one G base peak, the genotyping result was GG type; if there were both T base peaks and G base peaks at this position, the genotyping result was TG type.

[0065] (2) Preparation of family materials

[0066] According to the above genotyping results, TT type individuals and GG type individuals were selected as parents to prepare TT and GG type homozygous families. In addition, TT type and GG type individuals were used as parent individuals to prepare TG type families. After the larvae of each family were hatched, they were transferred to a 15 m 2 pool for separate cultivation. When the family materials grew to 1 cm, 50 Portunus trituberculatus were randomly selected from each family and placed in a 30 m 2 pool for mixed culture. When the family materials grew to about 10 cm, 200 Portunus trituberculatus were randomly selected from the mixed culture group for determination of their carapace width, carapace length, body height, and body weight.

[0067] (3) SNP3_9896582 marker-assisted selection

[0068] The above individuals were genotyped at the SNP3_9896582 locus. In the above materials, the average values of carapace width, carapace length, body height, and body weight of individuals with TT genotype were significantly higher than those of individuals with TG genotype and GG genotype (Table 3). Therefore, by selecting the TT genotype in the SNP3_9896582 marker, the carapace width, carapace length, body height, and body weight traits of the breeding population can be improved.

[0069] Table 3 Average values of three genotypes at SNP3_9896582 locus in mixed culture group for different growth traits

[0070]

[0071] The use of the growth-related markers of the present patent is illustrated in this example using SNP site SNP3_9896582 as an example, and the use of other sites is similar to this marker.

[0072] Although the present application has been described in detail with particular references to specific embodiments thereof, it should be understood by the skilled in the art that various changes in form or details could be made without departing from the spirit and scope of the application. Therefore, some modifications or improvements made on the basis of the present application without departing from the spirit of the present application shall fall within the scope of the present application.

Claims

1. A group of genes related to the growth traits of swimming crab (Portunus trituberculatus) SIF Gene SNP molecular markers are characterized by: The SNP molecular marker is located on autosome 3 of the swimming crab SIF Genetically, these included SNP3_9896582, SNP3_9896589, SNP3_9949209, and SNP3_9959513; The nucleotide sequence of SNP3_9896582 is shown in SEQ ID NO. 1, wherein position 118 is T / G, wherein the TT genotype is the dominant genotype; The nucleotide sequence of SNP3_9896589 is shown in SEQ ID NO. 2, wherein the 111th position is A / C, wherein the AA genotype is the dominant genotype; The nucleotide sequence of SNP3_9949209 is shown in SEQ ID NO. 3, wherein the 89th position is T / G, wherein the TG genotype is the dominant genotype; The nucleotide sequence of SNP3_9959513 is shown in SEQ ID NO. 4, and the 68th position thereof is G / A, wherein the GG genotype is the dominant genotype.

2. The molecular marker according to claim 1, wherein SNP3_9896582 and SNP3_9896589 are both associated with the total carapace width, carapace length, body height and weight traits of the three-tuberculate swimming crab, and SNP3_9949209 and SNP3_9959513 are both associated with the total carapace width, body height and weight traits of the three-tuberculate swimming crab.

3. A primer pair for detecting the SNP molecular marker according to claim 1, characterized in that: The primer pairs for detecting SNP molecular markers SNP3_9896582 and SNP3_9896589 are the same, and their nucleotide sequences are shown in SEQ ID NO.5-6; The nucleotide sequences of the primer pair for detecting the SNP molecular marker SNP3_9949209 are shown in SEQ ID NOs. 7-8; The nucleotide sequences of the primer pair for detecting the SNP molecular marker SNP3_9959513 are shown in SEQ ID NOs. 9-10.

4. Use of the SNP molecular marker according to claim 1 in growth trait breeding or genetic breeding of Portunus trituberculatus.

5. Use of the SNP-marked primer pair according to claim 3 in growth trait breeding or genetic breeding of Portunus trituberculatus.

Citation Information

Patent Citations

  • Gene polymorphic marker of C-type lectin of portunus trituberculatus and genetic typing method of SNP (Single Nucleotide Polymorphism) molecular markers

    CN103387978A

  • Molecular marker related to genetic sex of portunus trituberculatus

    CN111269975A