Molecular markers of malathion resistance in Bactrocera dorsalis and their applications and detection methods
By utilizing the expression level and affinity detection of the BdorOBP28a-2 gene of the fruit fly, the problem of monitoring the resistance of the fruit fly to malathion was solved, and rapid and accurate resistance detection and pesticide residue analysis were achieved.
Patent Information
- Application Number
- CN202310350876.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-04
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2043-04-04
AI Technical Summary
The resistance of the citrus fruit fly to malathion has increased, making it difficult to effectively monitor and control it with existing technologies. The widespread use of chemical pesticides has led to serious problems with insect resistance.
The odor-binding protein BdorOBP28a-2 gene of Bactrocera dorsalis was used as a molecular marker. The expression level of OBP28a-2 gene was detected by RT-qPCR. The affinity of OBP28a-2 protein to malathion was detected by microcalorimetry. A method for rapid detection of malathion resistance in Bactrocera dorsalis was established.
The study provides a method with simple operation, strong detection specificity and high sensitivity, which can quickly and effectively detect the resistance of field populations of the oriental fruit fly to malathion, help monitor resistance at an early stage and provide targets for the development of new insecticides.
Smart Images
Figure CN116287316B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biology and relates to a molecular marker, in particular to a molecular marker of the malathion resistance of the oriental fruit fly and its application and detection method. Background Art
[0002] Insect odorant-binding proteins (OBPs) are hydrophilic carrier proteins that transport hydrophobic odor molecules to olfactory receptor neurons via the hydrophilic lymph fluid. They are crucial proteins in insect olfactory perception. The oriental fruit fly, Bactrocera dorsalis (Hendel), is a major agricultural pest characterized by strong environmental adaptability, a wide host range, and rapid invasion and spread, causing significant economic losses to agricultural production. In recent years, due to the widespread and extensive use of chemical pesticides, the oriental fruit fly's resistance has significantly increased, posing significant challenges to its control. Currently, research on the mechanisms of oriental fruit fly resistance focuses primarily on metabolic resistance and target resistance, primarily focusing on three major detoxification metabolic enzymes. Recent reports have found that odorant-binding proteins, proteins involved in insect olfaction, play a special role in regulating insect resistance to pesticides. Summary of the Invention
[0003] The purpose of the present invention is to address the above problems and provide a molecular marker for the resistance of Bactrocera dorsalis to malathion, its application and detection method.
[0004] In order to achieve its purpose, the present invention adopts the following technical solutions:
[0005] A molecular marker for the resistance of Bactrocera dorsalis to malathion is provided. The molecular marker is the Bactrocera dorsalis odorant-binding protein BdorOBP28a-2 gene, and the nucleotide sequence thereof is shown in SEQ ID NO.23.
[0006] The present invention provides the application of the above-mentioned molecular marker in the detection of malathion content.
[0007] In the above-mentioned application technology scheme, multiple malathion standards of known concentrations are used to detect the affinity between the OBP28a-2 protein and the standards. An affinity curve is fitted with the malathion concentration as the horizontal axis and the affinity detection fluorescence value as the vertical axis to detect the affinity between the test sample containing malathion and the OBP28a-2 protein. The malathion concentration of the test sample is obtained based on the affinity curve of the standards.
[0008] Preferably, the affinity between the OBP28a-2 protein and the malathion sample is detected by microcalorimetry.
[0009] Preferably, the malathion concentration of the sample to be tested is between 1M and 100nM.
[0010] The present invention also provides the application of the molecular marker in the classification of populations sensitive to malathion and populations resistant to citrus fruit fly.
[0011] The present invention also provides a primer pair for detecting the above molecular markers, wherein the primer sequence of the primer pair is as follows: upstream primer: OBP28a-2qPCR F: 5'-GGTGCTGCTGACTCTGACAT-3',
[0012] Downstream primer: OBP28a-2qPCR R: 5′-GCCTCGCAATGATCATCTGG-3′.
[0013] The present invention also provides a kit for detecting the above molecular markers, comprising the above primer pair.
[0014] Preferably, the kit further comprises a total RNA extraction reagent, an RNA reverse transcription reagent, and a real-time fluorescence quantitative PCR amplification reagent.
[0015] Finally, the present invention provides a method for detecting the above-mentioned molecular marker, wherein the expression level of the OBP28a-2 gene of the tested fruit fly is detected using a population sensitive to the pesticide as a control. If the expression level of the OBP28a-2 gene of the tested fruit fly is significantly higher than that of the sensitive population, it can be determined that the tested fruit fly is a population resistant to malathion; if there is no significant difference in the expression level of the OBP28a-2 gene between the tested fruit fly and the sensitive population, it cannot be determined that the tested fruit fly is a population resistant to malathion.
[0016] The technical solution of the above method includes the following steps: extracting total RNA of the to-be-tested oriental fruit fly, reversing it into cDNA, using the cDNA as a template, performing qPCR amplification with the above primer pair, using the pesticide-sensitive population of oriental fruit fly as a control, and determining the expression level of the OBP28a-2 gene in the to-be-tested object; when the expression level of the OBP28a-2 gene in the to-be-tested object is significantly higher than that in the sensitive population, it can be determined that the to-be-tested oriental fruit fly is a population resistant to malathion.
[0017] Preferably, in the above method and technical solution, the qPCR amplification reaction system is: NovoStart SYBR qPCR SμperMix Plμs 5.0μL, 0.3μL each of 10μM upstream / downstream primers, 0.5μL of cDNA template, and nuclease-free water to 10μL; the qPCR amplification conditions are: pre-denaturation at 95°C for 2min; denaturation at 95°C for 30s, annealing and extension at 60°C for 30s, 40 cycles; 60°C for 30s, 95°C for 15s to form a melting curve.
[0018] The inventor's laboratory previously identified odorant-binding protein genes of the oriental fruit fly, including OBP28a-2, OBP49a, OBP56g, and OBP57e. The present invention used RT-qPCR to detect the expression levels of OBPs highly expressed in the feet of the oriental fruit fly in different populations and under malathion induction modes. The results showed that OBP28a-2 expression was significantly upregulated in malathion-resistant populations, and OBP28a-2 expression was also significantly increased after malathion induction. OBP28a-2 produced by CRISPR / Cas9 - / - The mutants showed increased adult sensitivity to malathion. Subsequently, we tested the in vitro affinity of the OBP28a-2 protein for insecticides. The results showed that OBP28a-2 has a strong affinity for malathion, suggesting that OBP28a-2 is involved in regulating the sensitivity of the fruit fly to malathion. This study found that the odorant-binding protein OBP28a-2 of the fruit fly regulates its resistance to malathion. Furthermore, OBP28a-2 can serve as an indicator gene to monitor the fruit fly's resistance to malathion. Furthermore, the protein synthesized in vitro can be used to detect malathion levels.
[0019] The present invention has the following beneficial effects: it first identifies and verifies that the odor-binding protein gene OBP28a-2 of the fruit fly regulates the fruit fly's resistance to malathion, broadens the understanding of the functions of the fruit fly's odor-binding protein, and provides exploratory ideas for the identification of odor-binding proteins related to other agents. Upregulated expression of the odor-binding protein OBP28a-2 is used as an indicator of increased malathion resistance, and the difference in resistance is indicated by the fold increase. By utilizing the OBP28a-2 protein in vitro and using an affinity test method, a new method for trace detection of malathion content is provided, which can be applied as a new method for detecting malathion residues in agricultural products, crops, etc.
[0020] The present invention establishes a molecular marker method for rapidly detecting malathion resistance in the fruit fly (Bactrocera dorsalis). The method is simple to operate, exhibits strong specificity and sensitivity, and can simultaneously test a large number of samples. It can quickly and effectively detect whether field populations of the fruit fly are resistant to malathion. This method facilitates early monitoring of insecticide resistance in field populations of the fruit fly and provides a new target for the development of new insecticides. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 is the expression pattern of odorant binding proteins under different conditions.
[0022] Figure 2 It is OBP28a-2 - / - Electrophoresis results of mutant lines.
[0023] Figure 3 It is OBP28a-2- / - Malathion bioassay results of mutant lines.
[0024] Figure 4 These are the results of SDS-PAGE and western blot of OBP28a-2 protein.
[0025] Figure 5 This is the result of affinity test between OBP28a-2 protein and malathion agent. DETAILED DESCRIPTION
[0026] The present invention will be further described below with reference to the embodiments, but the present invention is not limited thereto.
[0027] The experimental methods in the following examples are conventional methods unless otherwise specified; the chemical and biological reagents used are conventional chemical and biological reagents in the art and are commercially available unless otherwise specified.
[0028] Malathion: solid standard, purchased from LGC Technology (Shanghai) Co., Ltd., 99.4% purity, chemical formula C 10 H 19 O6PS2, CAS registration number 121-75-5.
[0029] Example 1. Determination of Malathion LC Based on the Film Method 50
[0030] Malathion technical (99.4% purity) was dissolved in acetone to prepare a stock solution: 0.1 g of the technical was dissolved in 10 mL of acetone to obtain a 10,000 mg / L stock solution. This stock solution was diluted to six different concentrations (125 mg / L, 100 mg / L, 75 mg / L, 50 mg / L, 25 mg / L, and 12.5 mg / L). 0.8 mL of each dilution was then placed in six 100 mL glass vials. The vials were immediately rolled for 5 minutes to evenly distribute the residual dilution over the inner surface of the vials. The vials were then left open for 2 hours to allow the acetone to evaporate, and then covered with cotton. The vials containing the insecticide were subsequently used in toxicity tests; the vials treated with acetone served as controls.
[0031] To test toxicity, 5-day-old adult B. dorsalis flies were cryoanesthetized for 2 minutes. Then, 15-20 flies were placed in each vial. The vials were plugged with cotton to prevent escape, with three replicates per treatment. The vials containing the live B. dorsalis flies were placed in an incubator (temperature: 27 ± 0.5°C; relative humidity: 70 ± 5%; photoperiod: 14 hours light / 10 hours dark). In each case, the flies were exposed to the insecticide for 2 hours, then removed and placed in a clean cage for 24 hours. Mortality was then counted. Flies were considered dead when only one or none of their legs moved when touched with a soft-bristled brush. Mortality after insecticide treatment was considered to have occurred when the control group showed 10% mortality. The live test results are shown in Table 1, with a median lethal concentration of 44.44 mg / L.
[0032] Table 1. Malathion bioassay results
[0033]
[0034] Example 2. Expression patterns of OBPs at different developmental stages
[0035] Total RNA was extracted from two whole insects and the expression profiles of OBPs genes were detected in resistant and sensitive populations. The sensitive population refers to the population that was collected and transferred to the laboratory in 2009 and then reared and propagated without any pesticide exposure. The resistant population was collected and transferred to the laboratory in 2008 and screened by treating each generation with malathion. The malathion concentration in each generation increased continuously. The resistance of the currently used resistant population is 50 times that of the sensitive population. The malathion LC 50 The value reached 6600 mg / L. TRIzol reagent was used to extract total RNA from Bactrocera dorsalis. Two whole insects were placed in a 1.5 mL nuclease-free centrifuge tube, treated with liquid nitrogen, and 500 μL of TRIzol was added. The mixture was ground into a homogenate and incubated at room temperature for 5-10 minutes. 200 μL of chloroform was then added, vortexed for 15 seconds, and incubated at room temperature for 2-3 minutes. The mixture was centrifuged at 12000 g for 15 minutes at 4°C. The supernatant was aspirated, 500 μL of isopropanol was added, and the mixture was gently shaken to mix. The mixture was incubated at room temperature for 10 minutes. The mixture was centrifuged at 12000 g for 10 minutes at 4°C, the supernatant was discarded, and the white precipitate was retained. 1 mL of 75% ethanol was added to wash the white precipitate. The mixture was centrifuged at 7600 g for 5 minutes at 4°C, and the supernatant was discarded. The precipitate was dried at room temperature for 5-10 minutes, and 30-100 μL of nuclease-free water was added to dissolve the precipitate and mixed by pipetting. 1.5 μL RNA was taken and tested for concentration and purity using Nanodrop ONE (ThermoFisher, USA). 5 μL was taken for agarose gel electrophoresis to detect RNA integrity. Qualified RNA was stored in a -80°C refrigerator for future use.
[0036] Qualified RNA samples were treated with RQI DNase kit (Promega, USA) to remove genomic DNA from the samples. The obtained pure RNA samples were then purified according to First-strand cDNA synthesis was performed by reverse transcription according to the instructions of RT reagent Kit (Takara, Japan).
[0037] To determine whether OBPs can be induced by malathion, the OBPs were extracted and purified by acetone and LC. 50 Total RNA from four adult legs after 2 hours of malathion (44.44 mg / L) induction (the induction method was the same as in Example 1: the adults were placed in a glass bottle coated with malathion). Three biological replicates were used for each treatment. RNA extraction and cDNA were obtained using the same methods as above.
[0038] All primers for OBPs were designed using the online website Primer3 (http: / / primer3.ut.ee / ). RT-qPCR experiments and results were evaluated using Bactrocera dorsalis RPS3 (GenBank: XM_011212815) and α-tublin (GenBank: GU269902) as internal reference genes. The OBPs tested included OBP28a-2, OBP49a, OBP56g, and OBP57e. The gene names and primer sequences corresponding to the primers are listed in Table 2:
[0039] Table 2. Sequence Listing
[0040]
[0041] The synthesized cDNA was used as a template, and rps3 and α-tubulin were used as internal reference genes. The reaction system was as follows: 5.0 μL of NovoStart SYBR qPCR SμperMix Plμs (Brand: Jinan, China), 0.3 μL each of upstream and downstream primers (10 μM), 0.5 μL of cDNA template, and nuclease-free water was added to 10 μL.
[0042] PCR program: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 30 s, annealing and extension at 60°C for 30 s, 40 cycles; 60°C for 30 s, 95°C for 15 s (to form a melting curve).
[0043] The final relative expression was 2 -ΔΔCt The expression patterns of four genes in different populations and under malathion induction were detected: the expression pattern of OBP28a-2 in long-term malathion-resistant populations and sensitive populations, and the quantitative results are as follows: Figure 1As shown in A, according to statistical analysis, the expression level of OBP28a-2 in the resistant population was significantly upregulated, 6 times higher than that in the sensitive population; the expression pattern of OBP28a-2 under short-term malathion stress, and its quantitative results are shown in Figure 1 As shown in Figure B, the expression of this gene also showed significant upregulation under chemical stress, with OBP28a-2 expression increasing by 1-fold compared to the acetone control. The results of this example demonstrate that OBP28a-2 is highly expressed in the resistant population and, after induction, also responds to malathion, showing significant upregulation.
[0044] Example 3. OBP28a-2 - / - Malathion bioassay of mutant strains
[0045] 1. Embryo Injection
[0046] Based on the Bactrocera dorsalis genome, the exons of OBP28a-2 were predicted using https: / / i5k.nal.usda.gov / , and two gRNA targets were selected in the first and second exons. The corresponding gRNAs were synthesized in vitro using the GeneArt Precision gRNA Synthesis Kit (Invitrogen, USA) according to the manufacturer's instructions and purified.
[0047] The gRNA sequences are:
[0048] gRNAF4 (SEQ ID NO.13):
[0049] 5'-TAATACGACTCACTATATAGACTAGAGCGGAGGAGTGCCG-3',
[0050] gRNA R4 (SEQ ID NO. 14):
[0051] 5'-TTCTAGCTCTAAAACCGGCACTCCTCCGCTCTAGT-3',
[0052] gRNAF8 (SEQ ID NO.15):
[0053] 5'-TAATACGACTCACTATATAGGTACCAGCGTCCAGTAAGGA-3',
[0054] gRNA R8 (SEQ ID NO. 16):
[0055] 5'-TTCTAGCTCTAAAACTCCTTACTGGACGCTGGTAC-3'.
[0056] Dilute and mix the synthesized gRNA and Cas9 protein on ice according to the test concentration. The final concentration of gRNA and Cas9 enzyme is 500-600 ng / μL. After completion, store at -80℃ for future use.
[0057] The embryo injection method of the oriental fruit fly is as follows: use orange juice to make an egg-luring device to lure eggs of the oriental fruit fly during the egg-laying period for 20 minutes; collect the eggs laid within 20 minutes, soak the eggs in a mixture of sodium hypochlorite and ultrapure water in a ratio of 1:2 for 90 seconds, then rinse repeatedly with ultrapure water, and soak the treated eggs in ultrapure water; use a brush to pick 10-20 eggs and arrange them neatly on a clean glass slide, dry them in a drying box for 2-3 minutes, and add halocarbon oil to keep the embryos moist; use a pipette to inject the mixture of gRNA and Cas9 into a capillary glass needle, and install the glass needle on a microinjection instrument for embryo injection.
[0058] The injected G0 embryos were placed in an incubator and raised under normal conditions. After 48 h, the hatched larvae were picked up and placed on larval feed and raised in an incubator (temperature: 27 ± 0.5°C; relative humidity: 70 ± 5%; photoperiod: 14 h light / 10 h dark).
[0059] 2. Mutant Screening
[0060] A total of 120 eggs were injected, of which 8 successfully developed into adults. After being reared to 9 days of age, the eight maternal adults were crossed with wild-type worms. After collecting 200-300 first-generation eggs, genomic DNA from the maternal adults was extracted using the TIANamp Genomic DNA Kit (Tiangen, Germany) and PCR amplified to detect heritable mutations in the G0 generation. Specific procedures were performed according to the manufacturer's instructions. Mutant screening primers were designed before and after the gRNA target site, and PCR amplification was performed using genomic DNA as a template. The primer sequences are as follows:
[0061] KO-Jc F2 (SEQ ID NO. 17): 5'-ATGGCCAAATTCATTCTATTCG-3', KO-Jc R2 (SEQ ID NO. 18): 5'-GTACTGCAATATCGGCGCA-3'.
[0062] The PCR reaction system was as follows: 12.5 μL of T3 Super PCR Mix (Beijing Qingke Biotechnology Co., Ltd.), 1 μL each of 10 μM upstream and downstream primers, 5 μL of DNA template, and 25 μL of nuclease-free water. The PCR program was as follows: 98°C pre-denaturation for 3 minutes; 35 cycles of denaturation at 98°C for 15 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 15 seconds; extension at 72°C for 5 minutes, and storage at 12°C. PCR products were electrophoresed on 1% agarose gels for band detection, and PCR product polymorphism was used to determine the gene editing status of G0 individuals. Three adults showed multiple bands, suggesting possible mutants.
[0063] The corresponding offspring generation individuals were then reared to adulthood. Genomic DNA from the hind legs of the oriental fruit fly was extracted using the InstaGene™ Matrix kit (Bio-rad, USA). The specific steps are as follows: Cut the hind legs of the oriental fruit fly adults and place them in a 200 μL centrifuge tube. Add 20 μL of InstaGene™ Matrix to the centrifuge tube and incubate at 56°C for 1 hour. Rapidly shake the sample for 30 seconds, centrifuge for 30 seconds, and incubate at 100°C for 10 minutes. Rapidly shake the sample for 15 seconds, centrifuge for 15 seconds; aspirate the supernatant and save it as a DNA template for later use. PCR amplification and mutant detection methods are the same as those for the parent generation. The detection methods for subsequent offspring are the same.
[0064] After electrophoresis, it was found that there were obvious multiple bands. It was sent to Qingke Company for sequencing and found that there were mixed peaks at the target site. Heterozygous individuals with obvious multiple bands were selected and hybridized with heterozygous individuals. The offspring were raised to adults and their genotypes were tested. Homozygous individuals with large fragment knockout were obtained. Figure 2 It is OBP28a-2 - / - Electrophoresis results of the mutant strain. The sequencing results are as follows:
[0065] Wild-type nucleotide sequence (SEQ ID NO. 19): 5'-AATTTTATGACTAGAGCGGAGGAGTGCCGTGGCGAAGTGGGTGCTGCTGACTGT GAGTATAAGAATCACTATAATTCAATATTGATGAATTATACCTAGCGTTATCTAAACCGCAGCTGACATTCAGGACATAGTCGCAAAAGTACCAGCGTCCAGTAAGGAAGGCAAATGCTTGCGCTCCTGTTTGATGAAAAAATATGGCGCGGTAAGTATTTATTTTACATGATAATATTTTATGTCATTACTACCAACATATTTTATTTGACGTTCCTCAGATGGAT-3';
[0066] Homozygous nucleotide sequence (SEQ ID NO. 20): 5′-AATTTTATGACTAGAGCGGAGGAGTGGGAAGGCAAATGCTTGCGCTCCTGTTTGA TGAAAAAATATGGCGCGGTAAGTATTTATTTTACATGATAATATTTTATGTCATTACTAC CAACATATTTTATTTGACGTTCCTCAGATGGAT-3′.
[0067] 3. Mutant Bioassay
[0068] In order to determine whether the mutant B. dorsalis has a change in sensitivity to malathion, the mutant was isolated and tested by LC according to the bioassay method in Example 1. 50 (44.44 mg / L) were exposed to malathion for 2 hours and 24 hours before the mortality rate was measured. Figure 3 As shown, OBP28a-2 exposed to malathion - / + (heterozygous mutant with OBP28a-2 gene knockout) and OBP28a-2 - / - The survival rates of the mutants (homozygous knockout of the OBP28a-2 gene) were 62% and 80%, respectively. Compared with wild-type oriental fruit flies treated with malathion, the mortality rates were significantly increased by 22% and 40%. Example 4. Heterologous expression of the OBP28a-2 protein
[0069] The open reading frame sequence information of OBP28a-2 was obtained from the internal database of the inventor's laboratory (the Bactrocera dorsalis OBPs gene library) and full-length primers were designed to amplify the full-length sequence. The full-length amplification primers are as follows:
[0070] OBP28a-2F2 (SEQ ID NO.21): 5'-ATGGCCAAATTCATTCTATT-3',
[0071] OBP28a-2R2 (SEQ ID NO. 22): 5'-TCAGTCAAACTTTTGCATACCGT-3'.
[0072] The target gene was amplified using cDNA from the foot of Bactrocera dorsalis as a template. The reaction system consisted of 12.5 μL of 2× PrimeSTAR Max Premix (TaKaRa, Japan), 9.5 μL of nuclease-free water, 1 μL each of forward and reverse primers, and 2 μL of cDNA, for a total of 25 μL. Reaction conditions included initial denaturation at 98°C for 3 min, followed by 35 cycles of denaturation at 98°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 30 s. Finally, the reaction was extended at 72°C for 5 min, and then stored at 12°C.
[0073] The ORF sequence of the BdorOBP28a-2 gene was obtained by sequencing (SEQ ID NO. 23): 5'-ATGGCCAAATTCATTCTATTCGCCGCCTTATGTATTTTGAGTGCCGCTGTCTCCAAC GCTGCTTTCAACAAAGAAGAGGCTATAAAAAATTTTATGACTAGAGCGGAGGAGTGCCGTGGCGAAGTGGGTGCTGCTGACTCTGACATTCAGGACATAGTCGCAAAAGTACCAGCGTCCAGTAAGGAAGGCAAATGCTTGCGCTCCTGTTTGATGAAAAAATATGGCGCGATGGATAGTAATGGCAAGTTTGTT AAGTCGGTCGTCGATCAGCATGCACAGGACTTCACTGACGGTGATGCAGATAAATTGAAGACAGCTCGTGAAATTATCGACGCTTGCGCCGATATTGCAGTACCAGATGATCATTGCGAGGCAACTGAAGTGTATGGCAAATGCTTTATGGATCAAGCGAAAGCTCACGGTATGCAAAAGTTTGACTTTTGA-3'.
[0074] Then, based on the signal peptide prediction, primers were designed that had their own signal peptide removed and contained two restriction sites, KpnⅠ and XhoⅠ:
[0075] Kpn I OBP28a-2F (SEQ ID NO. 24): 5'-CGGGGTACCGCTTTCAACAAAGAAGAGG-3', XhoI OBP28a-2R (SEQ ID NO. 25):
[0076] 5'-CCGCTCGAGAAAGTCAAACTTTTGCATACCGT-3'.
[0077] The target gene was amplified using 2× PrimeSTARMax Premix with the foot cDNA as a template, using the same reaction system as above. After electrophoresis, the product was sent to Qingke for sequencing.
[0078] Its sequence after removing the signal peptide (SEQ ID NO. 26): 5'-GCTTTCAACAAAGAAGAGGCTATAAAAAATTTTATGACTAGAGCGGAGGAGTGCC GTGGCGAAGTGGGTGCTGCTGACTCTGACATTCAGGACATAGTCGCAAAAGTACCAGCGTCCAGTAAGGAAGGCAAATGCTTGCGCTCCTGTTTGATGAAAAAATATGGCGCGATGGATAGTAATGGCAAGTTTGTTAAGTCGGTCGTCGATCAGCATGCACAGGA CTTCACTGACGGTGATGCAGATAAATTGAAGACAGCTCGTGAAATTATCGACGCTTGCGCCGATATTGCAGTACCAGATGATCATTGCGAGGCAACTGAAGTGTATGGCAAATGCTTTATGGATCAAGCGAAAGCTCACGGTATGCAAAAGTTTGACTTTTGA-3'.
[0079] 1% agarose gel electrophoresis was used to check whether the size of the target band was correct. The PCR sample containing a single target band was liquid recovered according to the instructions of the TIANGEN universaL DNA Purification Kit (Tiangen), and the concentration and quality of the recovered product were measured using a nucleic acid concentration meter.
[0080] Enzyme Digestion: The purified target gene fragment obtained from the recovered PCR product was then digested with the pET30a vector (Thermo Fisher Scientific) using the following enzyme digestion system: 5 μL of 10× Quickcutsmart Buffer, 1 μL of Kpn I, 1 μL of Xho I, 1 μg of the OBP28a-2 sequence fragment / pET30a vector, and 1 μL of nuclease-free water. The reaction was incubated at 37°C for 8 h. Afterwards, the product was subjected to 1% agarose gel electrophoresis and recovered. The digested product was ligated into the pET30a vector using the following reaction system: 5 μL of 2× Ligation Buffer, 3 μL of the target gene, 1 μL of pET30a, and 1 μL of nuclease-free water.
[0081] The mixed reaction solution was incubated overnight at 16°C in a PCR instrument, and then transformed using Trans5α Chemically Competent Cell (Beijing Quanshijin) according to the instructions. The transformed bacterial solution was spread on LB (containing 50μg / mL kanamycin) solid culture medium and cultured at 37°C with shaking at 200rpm. The specific method of bacterial detection PCR is the same as above. The positive PCR product was sent for testing, and the bacterial solution that passed the sequencing was expanded, plasmid extracted and the bacterial solution was preserved. The recombinant plasmid pET30a-BdorOBP28a-2 was obtained. The recombinant plasmid sequence (partial vector sequence (underlined) + OBP28 sequence (signal peptide removed)) is as follows (SEQID NO.27): 5'-TTCTTCTGGTCTGGTGCCACGCGGTTCTGGTATGAAAGAAACCGCTGCTGCTAAA TTCGAAC GCCAGCACATGGACAGCCCAGATCTGGGTACC GCTTTCAACAAAGAAGAGGCTATAAAAAATTTTATGACTAGAGCGGAGGAGTGCCGTGGCGAAGTGGGTGCTGCTGACTCTGACATTCAGGACATAGTCGCAAAAGTACCAGCGTCCAGTAAGGAAGGCAAATGCTTGCGCTCCTGTTTGATGAAAAAATATGGCGCGATGGATAGTAATGGCAAGTTTG TTAAGTCGGTCGTCGATCAGCATGCACAGGACTTCACTGACGGTGATGCAGATAAATTGAAGACAGCTCGTGAAATTATCGACGCTTGCGCCGATATTGCAGTACCAGATGATCATTGCGAGGCAACTGAAGTGTATGGCAAATGCTTTATGGATCAAGCGAAAGCTCACGGTATGCAAAAGTTTGACTTT CTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACA AAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGG-3'.
[0082] Example 5. In vitro affinity test of OBP28a-2 protein and malathion agent
[0083] 1. Recombinant Protein Purification
[0084] The recombinant plasmid pET30a-BdorOBP28a-2 obtained in Example 4 was transformed into the expression Escherichia coli BL21 (DE3), and the transformation and bacterial testing methods were the same as in Example 4. Positive clones were added to 400 mL of LB (containing 50 μg / mL kanamycin) liquid medium and cultured with shaking at 37°C, 200 rpm until the OD600 of the culture solution was 0.6-1.0. Isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.5 mM and cultured with shaking at 37°C, 200 rpm for approximately 16 h to induce protein expression. The induced culture solution was centrifuged at 4000 × g for 15 min at 4°C, the supernatant was discarded, and the pellet was resuspended in 25 mL of 1× PBS buffer. The resuspended E. coli cells were disrupted with an ultrasonic cell disruptor (pulse 5 s, interval 3 s, total time 15 min). The cells were centrifuged at 12000 × g for 15 min at 4°C, and the supernatant and pellet were collected for SDS-PAGE electrophoresis to detect protein expression.
[0085] After the buffer in the Ni-NTA column (Thermo Fisher) was drained, 2 mL of 20% alcohol and 1× PBS were added to the column, followed by adding 5 mL of the supernatant containing the recombinant protein to the Ni-NTA column each time until the supernatant was completely drained. The target protein was eluted with 1× PBS buffer containing different concentrations of imidazole (40 mM, 80 mM, 160 mM, 250 mM), and the solution containing the target protein was collected for SDS-PAGE electrophoresis to detect the protein molecular weight. The specific steps were based on the instructions for the SDS-PAGE precast gel (Bio-Rad), using 150 v and 30 min electrophoresis conditions. The Ni-NTA column was then equilibrated with 1× PBS and 20% alcohol and stored at 4°C.
[0086] The SDS-PAGE gel was transferred to a polyvinylidene fluoride (PVDF) membrane immersed in transfer buffer (10 mL transfer buffer, 10 mL anhydrous ethanol, 30 mL pure water mixed) for 2 minutes; the membrane was transferred at 25 V and 200 mA for 3 minutes, and the PVDF membrane was washed with 1×TBST (Tris-HCL and Tween-20 mixture) and then blocked with blocking solution (50 mL 1×TBST + 2.5 g skim milk powder) at 37°C for 1 hour; His-specific antibody (His-tag Antibody) was immersed in the PVDF membrane and incubated at 4°C overnight; the primary antibody was recovered, the PVDF membrane was washed with 1×TBST, and the PVDF membrane was incubated in goat anti-mouse IgG serum (Biyuntian) for 2 hours; the secondary antibody was recovered, the PVDF membrane was washed with 1×TBST, and a 1:1 mixture of A solution and B solution of the ultrasensitive ECL chemiluminescent substrate kit was added dropwise to the PVDF membrane, and the reaction was allowed to proceed for 2-3 minutes, and then the image was taken under the imaging system. Figure 4 The results shown, Figure 4 A is the SDS-PAGE result. M channel represents protein marker. The channel shown in a is the purified protein. The channel shown in b is the empty protein. At the predicted size of 15-20 kDa, only channel a has a clear band. After WB ( Figure 4 B) was labeled with a protein-specific antibody. The color development reaction revealed a specific band at 15-20 kDa, indicating successful recovery of recombinant OBP28a-2 protein. The purified protein was then assayed using a BCA protein concentration assay kit (Beyotime) according to the manufacturer's instructions.
[0087] 2. Analysis of Recombinant Protein Binding to Pesticides
[0088] Recombinant proteins were labeled according to the instructions of the RED-tris-NTA protein labeling kit. Affinity analysis of recombinant proteins and insecticides was performed. Dissolve 2 μL of a 5 μM fluorescent dye solution in 98 μL of 1× PBST buffer to a fluorescent dye concentration of 100 nM. Dilute the recombinant protein to 200 nM in 100 μL of 1× PBST buffer. Mix equal volumes of the fluorescent dye and recombinant protein solution and incubate at room temperature in the dark for 30 min. Dissolve the insecticide in acetone to prepare a 10 mM stock solution for later use. The insecticides used included malathion, avermectin (94% technical, Jiangsu Fengyuan Biological), cypermethrin (20% emulsifiable concentrate, Wellda Chemical), and deltamethrin (97% technical, Schwoder Biological).
[0089] A 10 mM insecticide was diluted with PBST in a 1:1 gradient to form 16 steps (10 mM, 5 mM, 2.5 mM, mM, 1.25 mM, 625 μM, 312.5 μM, 156.25 μM, 78.13 μM, 39.06 μM, 19.53 μM, 9765 nM, 4883 nM, 2441 nM, 1221 nM, 610 nM, 305 nM). The labeled recombinant protein solution was mixed with an equal volume of the insecticide dilution (10 μL each) and incubated for 5-10 min. The sample was siphoned using Monolith™ NT.115 Series capillaries (Nano Temper Technology) and the binding capacity of the recombinant protein to the fluorescent dye was measured on a Monolith NT.115 microcalorimeter (Nano Temper Technology). Parameters were set as: excitation power 60, MST power 40, constant temperature 25°C, and MST time 20 s. The affinity (Kd) of the recombinant protein to the dye was analyzed using MO.AffinityAnalysis (version 2.2.4) software.
[0090] The OBP28a-2 protein was expressed in vitro, and the affinity of OBP28a-2 to various drugs was tested using microcalorimetry. Figure 5 As shown, OBP28a-2 and malathion can fit the affinity curve well and have strong affinity with a Kd value of 62.39 nM, indicating that OBP28a-2 is involved in regulating the sensitivity of the oriental fruit fly to malathion. This study found that the odor-binding protein OBP28a-2 of the oriental fruit fly regulates the resistance of the oriental fruit fly to malathion, and OBP28a-2 can be used as an indicator gene for the resistance of the oriental fruit fly to malathion.
[0091] Example 6 Detection of Malathion Content in Samples
[0092] A method for detecting the malathion content in a sample is performed according to the following steps: using 16 malathion standards of known concentration in Example 5, the affinity between the OBP28a-2 protein and the standard is detected, and an affinity curve is fitted with the malathion concentration as the horizontal axis and the affinity detection fluorescence value as the vertical axis. The affinity between the test sample containing malathion and the OBP28a-2 protein is detected, and the OBP28a-2 protein is labeled according to the labeling method in Example 5. The test sample is extracted with acetone and diluted 100 times with PBST. The labeled recombinant protein solution is mixed with the test sample in equal volumes (10 μL each), and incubated for 5-10 minutes. The labeled recombinant protein solution is mixed with PBST in equal volumes as a detection reference. The specific detection method is described in Example 5. The fluorescence detection result of the test sample is substituted into the fitted affinity curve to obtain the malathion concentration of the test sample.
[0093] Among them, the affinity of OBP28a-2 protein to malathion samples was detected using microcalorimetry technology.
Claims
1. The application of BdorOBP28a-2 protein in the detection of malathion content is characterized by: Multiple malathion standards of known concentrations are used to detect the affinity of the BdorOBP28a-2 protein for the standards. An affinity curve is fitted with the malathion concentration as the horizontal axis and the affinity detection fluorescence value as the vertical axis. The affinity of the test sample containing malathion and the BdorOBP28a-2 protein is detected, and the malathion concentration of the test sample is obtained based on the affinity curve of the standards. The nucleotide sequence of the gene encoding the BdorOBP28a-2 protein is shown in SEQ ID NO.
23. The malathion concentration of the samples to be tested ranged from 305 nM to 1.25 mM.
2. The use according to claim 1, characterized in that: The affinity of BdorOBP28a-2 protein to malathion samples was detected by microcalorimetry.
3. Use of a reagent for detecting the gene expression level of a molecular marker of resistance to malathion in the classification of malathion-sensitive and resistant populations of the fruit fly, wherein the molecular marker is a gene encoding an odorant-binding protein of the fruit fly. BdorOBP28a-2 The gene, whose nucleotide sequence is shown in SEQ ID NO.
23.
4. The use according to claim 3, characterized in that: The malathion-sensitive population of B. dorsalis was used as a control to detect the BdorOBP28a-2 If the expression level of the gene is BdorOBP28a-2 The gene expression level is significantly higher than that of the sensitive population, which means that the tested B. dorsalis population is resistant to malathion. BdorOBP28a-2 If there is no significant difference in gene expression, it cannot be determined that the tested Bactrocera dorsalis is a malathion-resistant population.
5. The use according to claim 4, characterized in that: The method comprises the following steps: extracting the total RNA of the fruit fly to be tested, converting it into cDNA, using the cDNA as a template, performing qPCR amplification with a primer pair, and using the malathion-sensitive population of the fruit fly as a control to determine the expression of the serotype in the test object. BdorOBP28a-2 The expression level of the gene BdorOBP28a-2 If the gene expression level is significantly higher than that of the sensitive population, it can be determined that the tested Bactrocera dorsalis is a population resistant to malathion; the primer sequence of the primer pair is: Upstream primer: OBP28a-2 qPCR F: 5'-GGTGCTGCTGACTCTGACAT-3', Downstream primer: OBP28a-2 qPCR R: 5′-GCCTCGCAATGATCATCTGG-3′.
6. The use according to claim 5, characterized in that: The qPCR amplification reaction system was as follows: NovoStart SYBRqPCR SuperMix Plus 5.0 μL, 0.3 μL each of 10 μM upstream / downstream primers, 0.5 μL of cDNA template, and nuclease-free water to 10 μL. The qPCR amplification conditions were as follows: pre-denaturation at 95°C for 2 min; 40 cycles of denaturation at 95°C for 30 s, annealing and extension at 60°C for 30 s, and melting curve formation at 60°C for 30 s and 95°C for 15 s.