A SNP site tightly linked to the PMMoV resistance gene L3 in pepper, KASP molecular marker and its application

Abstract

The present invention relates to the technical field of plant molecular genetic breeding, and specifically to a SNP site tightly linked to the pepper PMMoV resistance gene L3, a KASP molecular marker, and their applications. The pepper PMMoV resistance gene L3 is tightly linked to a KASP marker called Pep(L3)-k92, and the primers corresponding to the KASP molecular marker Pep(L3)-k92 include two front primers A1 and A2 and a shared back primer C. The present invention has discovered a KASP-type molecular marker specifically targeting the pepper PMMoV resistance gene L3 based on KASP typing technology. The KASP molecular marker of the present invention can omit the artificial inoculation identification step for pepper PMMoV disease resistance. DNA testing of pepper plants at the seedling stage is sufficient to determine whether the pepper PMMoV disease resistance gene contains the disease-resistant gene. This technology can be widely applied to molecular marker-assisted breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of plant molecular genetic breeding, and in particular to a tightly linked SNP site of a pepper PMMoV resistance gene L3, a KASP molecular marker and applications thereof. Background Art

[0002] Pepper mild mottle virus (PMMoV), a member of the tobacco mosaic virus genus, has been detected in numerous major pepper-producing regions in my country in recent years, with detection rates increasing. This has posed a serious threat to the development of the pepper industry. Early symptoms of PMMoV infection are subtle, often consisting of mild chlorosis. Later on, symptoms become more pronounced, causing leaf shrinkage, deformation, mottled patterns, or yellow-green mosaics. Fruit can also become smaller, misshapen, mottled, or even necrotic, with the tendency to fall off easily, severely impacting pepper yield and quality. The virus can be transmitted through infected seeds, susceptible plants, and infected soil. It can survive for 25 years on dry, diseased plant debris, making its control extremely difficult.

[0003] Breeding for disease resistance is one of the most effective ways to combat this viral disease. This primarily relies on the discovery and utilization of resistance resources. Traditional crop breeding is inefficient, labor-intensive, and time-consuming. Molecular marker-assisted breeding, based on genotypic screening of germplasm resources, avoids or reduces phenotypic selection errors and can significantly improve breeding efficiency. Currently, RAPD, AFLP, SCAR, and CAPS markers linked to the PMMoV resistance gene L3 have been developed or transformed.

[0004] KASP (Kompetitive Allele Specific PCR) typing technology was developed in recent years and can accurately genotype SNPs and InDels at specific sites in the genome. It has the advantages of high sensitivity, high throughput, low cost, and rapidity. However, no KASP-type molecular marker based on KASP typing technology has been found specifically for the PMMOV resistance gene L3 in pepper.

[0005] Therefore, a SNP site tightly linked to the PMMoV resistance gene L3 in pepper, KASP molecular marker and application technology need further study. Summary of the Invention

[0006] The present invention aims to solve the above problems and provides a SNP site tightly linked to a pepper mild mottle virus disease resistance gene, its KASP molecular marker, its application in identifying pepper mild mottle virus disease-resistant pepper varieties, and an identification method. The molecular marker is used to quickly and accurately screen for materials containing disease-resistant genes in offspring populations at the molecular level. The identification method has high accuracy and efficiency.

[0007] A SNP site tightly linked to the PMMoV-resistant gene L3 of pepper, the nucleotide sequence of the SNP is shown in SEQ ID NO.1, the base type of the SNP site is C or A, and it is the 92nd base in SEQ ID NO.1.

[0008] A KASP molecular marker tightly linked to the PMMoV-resistance gene L3 in pepper is disclosed. A high-throughput KASP molecular marker Pep-(L3)-k92 is designed based on SNP site differences. The KASP molecular marker Pep-(L3)-k92 comprises front primers A1 and A2 and a back primer C. The nucleotide sequence of the front primer A1 is shown in SEQ ID NO.2: 5′-TTTACCTGTAAATCACAGTGAAATC-3′; the nucleotide sequence of the front primer A2 is shown in SEQ ID NO.3: 5′-TTTACCTGTAAATCACAGTGAAATA-3′; and the nucleotide sequence of the back primer C is shown in SEQ ID NO.4: 5′-CACAAACATAAAATGTAATCATGAA-3′.

[0009] Based on the above scheme, a FAM fluorescent tag sequence is added to the 5' end of the front primer A1, and a HEX fluorescent tag sequence is added to the 5' end of the front primer A2; the FAM fluorescent tag sequence is shown in SEQ ID NO.5: 5'-GAAGGTGACCAAGTTCATGCT-3'; the HEX fluorescent tag sequence is shown in SEQ ID NO.6: 5'-GAAGGTCGGAGTCAACGGATT-3'.

[0010] Based on the same inventive concept, the present invention provides the application of a SNP site tightly linked to the pepper PMMoV resistance gene L3 in the breeding of pepper PMMoV-resistant pepper varieties.

[0011] Based on the same inventive concept, the present invention provides the application of KASP molecular markers in identifying PMMoV-resistant pepper varieties.

[0012] Based on the same inventive concept, the present invention also provides the use of KASP molecular markers in identifying PMMoV-resistant pepper varieties. The identification method for PMMoV-resistant pepper varieties is as follows:

[0013] Step 1: Detection: Use the primers labeled Pep-(L3)-k92 with KASP to perform PCR amplification and genotyping on the genomic DNA of the pepper offspring population material to be tested;

[0014] Step 2: Result judgment: If the fluorescence signal data of the amplified product of the pepper to be tested is clustered on the X-axis in the typing cluster diagram in the typing result and appears blue, then the pepper to be tested contains the disease-resistant gene L3, the SNP typing is a C:C homozygous genotype, and the PMMoV disease resistance phenotype of the pepper is "resistant"; if the fluorescence signal data of the amplified product of the pepper to be tested appears green in the typing cluster diagram, then the pepper to be tested does not contain the disease-resistant gene L3, the SNP typing is an A:A homozygous genotype, and the PMMoV disease resistance phenotype of the pepper is "susceptible"; if the fluorescence signal data of the amplified product of the pepper to be tested appears red in the typing cluster diagram, then the pepper to be tested contains the disease-resistant gene L3, the SNP typing is a C:A heterozygous genotype, and the PMMoV disease resistance phenotype of the pepper is "resistant". Purple points indicate unsuccessful typing, and gray points represent blank controls.

[0015] Based on the above scheme, the KASP-labeled PCR amplification system was 4.055 μL, including 2 μL of DNA template, 2 μL of KASP V4.0 2X Master mix 96 / 384Low Rox, and 0.055 μL of primer mixture. The primer mixture system was 50 μL, including 15 μL of primer C, 6 μL of primer A1, 6 μL of primer A2, and 23 μL of sterile H2O, where the primer concentration was 100 μmol·L. -1 ;

[0016] The PCR amplification procedure for the KASP marker is:

[0017]

[0018] Based on the above scheme, the KASP V4.0 2X Master mix 96 / 384 Low Rox is composed of fluorescent probe A, fluorescent probe B, quencher probe A and quencher probe B, high-fidelity Taq enzyme, and dNTPs; the sequence of the fluorescent probe A is shown in SEQ ID NO.7 as 5′-GAAGGTGACCAAGTTCATGCT-3′, with a fluorescent group FAM linked to its 5′ end; the sequence of the fluorescent probe B is shown in SEQ ID NO.8 as 5′-GAAGGTCGGAGTCAACGGATT-3′, with a fluorescent group HEX linked to its 5′ end; the sequence of the quencher probe A is shown in SEQ ID NO.9 as 5′-AGCATGAACTTGGTCACCTTC-3′, with a quencher group Q linked to its 3′ end; the sequence of the quencher probe B is shown in SEQ ID NO.10 as 5′-AATCCGTTGACTCCGACCTTC-3′, with a quencher group Q linked to its 3′ end.

[0019] Based on the above scheme, if the genotyping test results are not obvious, you can add a program of 94°C for 20 seconds, 57°C for 60 seconds, 3 cycles; 37°C for 1 minute, and then read the data.

[0020] Based on the above scheme, the KASP PCR amplification reaction is read using a Roche 480 fluorescence quantitative instrument to perform KASP genotyping, read the fluorescence data, and import the data into the software for genotyping. The genotyping data processing software is KlusterCaller software.

[0021] The present invention has the following advantages: Based on the KASP typing technique, a tightly linked KASP-type molecular marker specifically targeting the PMMoV-resistance gene L3 in pepper has been discovered. This molecular marker can be used to rapidly and accurately screen pepper offspring populations for materials containing the disease-resistance gene at the molecular level. The KASP molecular marker of the present invention can eliminate the artificial inoculation and identification step for PMMoV-resistance in peppers; DNA testing of pepper plants at the seedling stage is sufficient to determine whether the pepper PMMoV-resistance gene is present. This technology can be widely applied to molecular marker-assisted breeding. Furthermore, compared with traditional CAPS markers, the KASP molecular marker and detection method of the present invention are simple to operate, have less stringent requirements on sample quality and reaction conditions, and offer the advantages of high sensitivity, high accuracy, and high throughput. This allows for large-scale sample testing, shortening identification time and improving genetic breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only one embodiment of the present invention. Those skilled in the art can also derive other implementation drawings based on the provided drawings without inventive effort.

[0023] Figure 1 : Schematic diagram of the alignment of amplified sequences of PMMoV-resistant and susceptible pepper materials; among them, 254 (PM799Nori3), 282 (0516), 283 (Klais) and 316 (PI152225) are resistant materials, and 285 (Qiemen), 322 (83-58), 276 (77013) and 323 (Screw Pepper M) are susceptible materials; there are 10 SNPs (light blue) in the sequence, and a C / A mutation at 92 bp;

[0024] Figure 2: SNP typing results of KASP marker Pep(L3)-k92 in disease-resistant materials, susceptible materials and F1 hybrid combinations; the blue points clustered close to the X-axis are pepper PMMoV-resistant materials (C:C genotype), the green points clustered close to the Y-axis are pepper PMMoV-susceptible materials (A:A genotype), the red points clustered in the middle are F1 hybrid combination materials, which are pepper PMMoV-resistant materials, genotype heterozygous (C:A genotype) heterozygous plants, and the gray points represent blank controls (NTC).

[0025] Figure 3 : Typing results of some offspring using the high-throughput KASP molecular marker Pep(L3)-k92; the blue points clustered close to the X-axis are pepper PMMoV-resistant materials (C:C genotype), the green points clustered close to the Y-axis are pepper PMMoV-susceptible materials (A:A genotype), the red points clustered in the middle are pepper PMMoV-resistant materials, genotype heterozygous (C:A genotype) heterozygous plants, purple points indicate unsuccessful typing, and gray points indicate blank controls (NTC). DETAILED DESCRIPTION

[0026] The present invention will be further described below with reference to the accompanying drawings and examples:

[0027] Example 1: Obtaining SNP sites associated with the PMMoV resistance gene L3 in pepper

[0028] Four disease-resistant pepper materials were selected: 254 (PM799 Nori3), 282 (0516), 283 (Claires), and 316 (PI152225);

[0029] Four susceptible pepper materials were selected: 285 (Qiamen), 322 (83-58), 276 (77013), 323 (Screw Pepper M), and four F1 materials (0516*83-58; 0516*Qiamen; Kress*77013; Kress*Qiamen).

[0030] After sowing the four resistant and four susceptible peppers, young leaves were collected at the seedling stage and genomic DNA was extracted using the CTAB method. Using the genomic DNA as a template, PCR amplification was performed using a marker (087H3T7) closely linked to the PMMoV resistance gene reported by Yang et al. (Yang HB, Liu WY, Kang WH, Jahn M, Kang BC. Development of SNP markers linked to the L locus in Capsicum spp. by a comparative genetic analysis. Molecular breeding, 2009, 24(4): 433–446.) using the genomic DNA as a template. The following reaction system and reaction procedure were used. The SNP loci closely linked to the PMMoV resistance gene involved in the present invention have not been disclosed.

[0031] The PCR reaction volume was 20 μL, and the reaction system consisted of: 10 μL 2× Taq Master Mix, 1 μL each of upstream and downstream primers (10 μmol / L), 2 μL template DNA (50 ng / μL), and 6 μL ddH₂O. The upstream primer was 087H3T7F: CCTTTGCCTGCATTATTCTTG, and the downstream primer was L4-087H3T7R: GCCCAAATTTATTCCCAAATGC.

[0032] The PCR reaction program was as follows: pre-denaturation at 94°C for 4 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 45 s; extension at 72°C for 7 min; and storage at 4°C.

[0033] The amplified product was commissioned to BGI Genomics Co., Ltd. for bidirectional sequencing. The sequencing results were compared and analyzed using DNAMAN software. It was found that the amplified sequence had 10 SNP sites between the resistant and susceptible materials. Figure 1 and SEQ ID NO. 1. Based on the suitability of primer design conditions and verification of phenotypes in the materials, the 92 bp SNP variation C / A site was finally selected as the site for identifying PMMoV resistance in pepper and used to design the KASP marker.

[0034] Example 2: Development of a KASP molecular marker tightly linked to the pepper PMMoV resistance gene L3 and its application in backcross breeding of the pepper PMMoV resistance gene L3

[0035] Based on the above SNP sites, specific primers for the high-throughput KASP molecular marker Pep(L3)-k92 were designed. The specific primer sequences are as follows:

[0036] Former primer A1 is shown in SEQ ID NO.2:

[0037] 5′-TTTACCTGTAAATCACAGTGAAATC-3′,

[0038] Former primer A2 is shown in SEQ ID NO.3:

[0039] 5′-TTTACCTGTAAATCACAGTGAAATA-3′,

[0040] The rear primer C is shown in SEQ ID NO.4:

[0041] 5′-CACAACATAAAATGTAATCATGAA-3′.

[0042] For this SNP site, the following FAM and HEX fluorescent tag sequences were added to the 5' end of the front primer A1 and the front primer A2 respectively:

[0043] The FAM fluorescent tag sequence is shown in SEQ ID NO.5:

[0044] 5'-GAAGGTGACCAAGTTCATGCT-3';

[0045] The HEX fluorescent tag sequence is shown in SEQ ID NO.6:

[0046] 5'-GAAGGTCGGAGTCAACGGATT-3'.

[0047] The corresponding dedicated primer sequence of the KASP high-throughput molecular marker Pep(L3)-k92 related to the PMMoV disease resistance gene L3 of pepper was obtained, and the Beijing Synthesis Department of Shanghai Bioengineering Company was arranged to synthesize it according to the primer sequence:

[0048] Primer 1:

[0049] GAAGGTGACCAAGTTCATGCT TTTACCTGTAAATCACAGTGAAATC (the underlined part is the FAM fluorescent tag sequence);

[0050] Primer 2:

[0051] GAAGGTCGGAGTCAACGGATT TTTACCTGTAAATCACAGTGAAATA (the underlined part is the HEX fluorescent tag sequence)

[0052] Primer 3: CACAAACATAAAATGTAATCATGAA. (Same as primer C)

[0053] The above-mentioned high-throughput KASP molecular marker Pep(L3)-k92 marker was verified in the following four disease-resistant pepper materials: 254 (PM799 Nori3), 282 (0516), 283 (Klais), 316 (PI152225), four disease-susceptible pepper materials: 285 (Qiemen), 322 (83-58), 276 (77013), 323 (Screw Pepper M) and four disease-resistant F1 varieties (0516*83-58; 0516*Qiemen; Klais*77013; Klais*Qiemen).

[0054] (1) KASP-labeled PCR amplification system (4.055 μL):

[0055]

[0056] KASP V4.0 2× Master mix 96 / 384, Low Rox is a product of LGC (UK), catalog number KBS-1016-017. KASP V4.0 2× Master mix 96 / 384, Low Rox consists of fluorescent probe A, fluorescent probe B, quencher probe A, quencher probe B, high-fidelity Taq enzyme, and dNTPs. The sequence of fluorescent probe A is shown in SEQ ID NO.7: 5′-GAAGGTGACCAAGTTCATGCT-3′, with a fluorescent group FAM connected to the 5′ end; the sequence of fluorescent probe B is shown in SEQ ID NO.8: 5′-GAAGGTCGGAGTCAACGGATT-3′, with a fluorescent group HEX connected to the 5′ end; the sequence of quencher probe A is shown in SEQ ID NO.9: 5′-AGCATGAACTTGGTCACCTTC-3′, with a quencher group Q connected to the 3′ end; the sequence of quencher probe B is shown in SEQ ID NO.10: 5′-AATCCGTTGACTCCGACCTTC-3′, with a quencher group Q connected to the 3′ end.

[0057] (2) Primer mixture system (50 μL): The primer concentration is 100 μmol·L -1

[0058] C (primer 3) 15 μL A1 (primer 1) 6μL A2 (primer 2) 6μL <![CDATA[Sterilized H2O]]> 23μL

[0059] (3) 384-well PCR plate amplification, the procedure is as follows:

[0060] Step 1 94℃ 15min Step 2 94℃ 20s Step 3 61℃ 60s Step 4 Go step2 10cyles Step 5 94℃ 20s Step 6 55℃ 60s Step 7 Go step4 3cyles Step 8 37℃ 1min

[0061] (4) Detection of PCR products

[0062] After the KASP PCR amplification reaction, the reading should be performed using a Roche 480 fluorescence quantitative instrument to perform KASP genotyping and read the fluorescence data. If the genotyping effect is not ideal, it is necessary to add the following program: 94°C for 20 seconds, 57°C for 60 seconds, 3 cycles; 37°C for 1 minute, and then read the data.

[0063] LGC provides instructions for analysis on the Roche 480 Fluorometer, available at www.lgcgenomics.com. The X-axis represents the FAM (465-510) channel, and the Y-axis represents the HEX (533-580) channel. The specific genotype of the gene being tested is determined based on the analysis results as follows: the genotype of samples clustered near the X-axis and displaying blue is the allele associated with the FAM fluorescent tag sequence; the genotype of samples clustered near the Y-axis and displaying green is the allele associated with the HEX fluorescent tag sequence; the genotype of the sample in the middle and displaying red is a heterozygous genotype for both alleles; and the sample in the lower left corner, displayed black, is a blank control in which the template is replaced with H2O.

[0064] Specifically, if Figure 2 As shown in the figure: ① If the fluorescence signal data of the amplified product of the pepper to be tested is clustered on the X-axis in the obtained typing cluster diagram and appears blue, then the pepper to be tested contains the disease-resistant gene L3 (SNP typing is C:C homozygous genotype), and the PMMoV disease resistance phenotype of the pepper is "resistant"; ② If the fluorescence signal data of the amplified product of the pepper to be tested appears green in the obtained typing cluster diagram, then the pepper to be tested does not contain the disease-resistant gene L3 (SNP typing is A:A homozygous genotype), and the PMMoV disease resistance phenotype of the pepper is "susceptible"; ③ If the fluorescence signal data of the amplified product of the pepper to be tested appears red in the obtained typing cluster diagram, then the pepper to be tested contains the disease-resistant gene L3 (SNP typing is C:A heterozygous genotype), and the PMMoV disease resistance phenotype of the pepper is "resistant".

[0065] The high-throughput KASP marker Pep(L3)-k92 was used to identify the genotype of the PMMoV resistance gene L3 in three pepper hybrid populations, including two F2 populations and one BC1 population. The F2 population size was 144 plants. One population was constructed by crossing the PMMoV-resistant material 0516 with the susceptible material 77013; the other was constructed by crossing the PMMoV-resistant material 0516 with the susceptible material 83-58; and the BC1 population was constructed by crossing the PMMoV-susceptible material Qiemen with the disease-resistant material 0516, and then backcrossing the Qiemen as the recurrent parent for one generation. The population size was 72 plants. The results are shown in Tables 1 and Figure 3 .

[0066] Table 1 Genotype detection results of L3 resistance genes in the test materials

[0067]

[0068] As shown in Table 1 and Figure 3 The genotyping results showed that the genotyping results were in line with expectations, and the resistance and susceptible typing results were consistent with the phenotype, indicating that the marker can be used for backcross breeding of disease-resistant gene L3, and can be used to select and identify PMMoV disease-resistant pepper varieties, which can significantly shorten the genetic breeding time and improve the genetic breeding efficiency.

[0069] The present invention is described above by way of examples, but the present invention is not limited to the above specific embodiments. For those skilled in the art, equivalent replacements or changes can be made based on the technical solutions and concepts of the present invention, and all such changes or replacements should fall within the scope of protection of the claims attached to the present invention.

Claims

1. Application of KASP molecular markers in the breeding of PMMoV-resistant pepper varieties, characterized by: A high-throughput KASP molecular marker is designed based on SNP site differences. The KASP molecular marker includes front primers A1 and A2 and a back primer C. The nucleotide sequence of the front primer A1 is shown in SEQ ID NO.2; the nucleotide sequence of the front primer A2 is shown in SEQ ID NO.3; and the nucleotide sequence of the back primer C is shown in SEQ ID NO.

4. A FAM fluorescent tag sequence is added to the 5' end of the front primer A1, and a HEX fluorescent tag sequence is added to the 5' end of the front primer A2; the FAM fluorescent tag sequence is shown in SEQ ID NO.5; the HEX fluorescent tag sequence is shown in SEQ ID NO.6; The SNP typing is a C:C homozygous genotype, and the PMMoV disease resistance phenotype of pepper is "resistant"; the SNP typing is an A:A homozygous genotype, and the PMMoV disease resistance phenotype of pepper is "susceptible"; the SNP typing is a C:A heterozygous genotype, and the PMMoV disease resistance phenotype of pepper is "resistant".

2. Application of KASP molecular markers in identifying PMMoV-resistant pepper varieties, characterized by: A high-throughput KASP molecular marker is designed based on SNP site differences. The KASP molecular marker includes front primers A1 and A2 and a back primer C. The nucleotide sequence of the front primer A1 is shown in SEQ ID NO.2; the nucleotide sequence of the front primer A2 is shown in SEQ ID NO.3; and the nucleotide sequence of the back primer C is shown in SEQ ID NO.

4. A FAM fluorescent tag sequence is added to the 5' end of the front primer A1, and a HEX fluorescent tag sequence is added to the 5' end of the front primer A2; the FAM fluorescent tag sequence is shown in SEQ ID NO.5; the HEX fluorescent tag sequence is shown in SEQ ID NO.6; The SNP typing is a C:C homozygous genotype, and the PMMoV disease resistance phenotype of pepper is "resistant"; the SNP typing is an A:A homozygous genotype, and the PMMoV disease resistance phenotype of pepper is "susceptible"; the SNP typing is a C:A heterozygous genotype, and the PMMoV disease resistance phenotype of pepper is "resistant".

3. The use of the KASP molecular marker according to claim 2 in identifying PMMoV-resistant pepper varieties, characterized in that: The identification method of PMMoV-resistant pepper varieties is as follows: Step 1: Detection: Use KASP-labeled primers to perform PCR amplification and genotyping on the genomic DNA of the pepper offspring population material to be tested; Step 2: Result judgment: If the fluorescence signal data of the amplified product of the pepper to be tested is clustered on the X-axis in the typing cluster diagram, it appears blue, and the SNP typing is a C:C homozygous genotype, and the PMMoV disease resistance phenotype of the pepper is "resistant"; if the fluorescence signal data of the amplified product of the pepper to be tested appears green in the typing cluster diagram, the SNP typing is an A:A homozygous genotype, and the PMMoV disease resistance phenotype of the pepper is "susceptible"; if the fluorescence signal data of the amplified product of the pepper to be tested appears red in the typing cluster diagram, the SNP typing is a C:A heterozygous genotype, and the PMMoV disease resistance phenotype of the pepper is "resistant", purple points indicate unsuccessful typing, and gray points indicate blank controls; The KASP PCR amplification reaction was followed by reading using a Roche 480 fluorescence quantification instrument to perform KASP genotyping, read the fluorescence data, and import the data into software for genotyping. The genotyping data processing software was KlusterCaller software.

4. The use of the KASP molecular marker according to claim 3 in identifying PMMoV-resistant pepper varieties, characterized in that: The KASP-labeled PCR amplification system was 4.055 μL, including 2 μL of DNA template, 2 μL of KASP V4.0 2X Mastermix 96 / 384 Low Rox, and 0.055 μL of primer mixture. The primer mixture system was 50 μL, including 15 μL of primer C, 6 μL of primer A1, 6 μL of primer A2, and 23 μL of sterile H2O. The primer concentration was 100 μmol·L. -1 ; The PCR amplification procedure for the KASP marker is: Step 1, 94°C, 15 min; Step 2, 94°C, 20 s; Step 3, 61℃, 60s; Step4, Go step2, 10cyles; Step 5, 94°C, 20s; Step 6, 55℃, 60s; Step7, Go step4, 3 cyles; Step 8, 37℃, 1min.

5. The use of the KASP molecular marker according to claim 4 in identifying PMMoV-resistant pepper varieties, characterized in that: The KASP V4.0 2X Master mix 96 / 384 Low Rox includes fluorescent probe A, fluorescent probe B, quencher probe A, and quencher probe B; the sequence of the fluorescent probe A is shown in SEQ ID NO.7, with a fluorescent group FAM connected to its 5' end; the sequence of the fluorescent probe B is shown in SEQ ID NO.8, with a fluorescent group HEX connected to its 5' end; the sequence of the quencher probe A is shown in SEQ ID NO.9, with a quencher group Q connected to its 3' end; the sequence of the quencher probe B is shown in SEQ ID NO.10, with a quencher group Q connected to its 3' end.

6. The use of the KASP molecular marker according to claim 4 in identifying PMMoV-resistant pepper varieties, characterized in that: If the genotyping test results are unclear, add the program 94°C for 20 seconds, 57°C for 60 seconds, 3 cycles; 37°C for 1 minute, and then read the data.

Images