Preparation method and application of a transition metal nitride modified carbon nitride acceptor-donor type photoelectrode
By combining the transition metal nitride with graphite phase carbon nitride to form an acceptor-donor-type photoelectrode, the problems of high cost and low sensitivity of detection of pesticide residues in water environments in the prior art are solved, and efficient and rapid pesticide residue detection is achieved.
Patent Information
- Application Number
- CN202310129718.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-15
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2043-02-15
AI Technical Summary
The method of detecting pesticide residues in water environments in the prior art is costly and time-consuming, making it difficult to achieve fast, simple and high-sensitivity detection, and the photoelectric signal amplification effect of graphite phase carbon nitride-based photoelectrode is poor.
By recombining transition metal nitrides such as CoN, Mo2N or WN with g-C3N4, an acceptor-donor-type photoelectrode is formed. The transition metal nitride acts as an electron acceptor to promote photogenerated charge transfer and improves photoelectric performance through a wide light response range.
It realizes high sensitivity detection of pesticide residues in water environments, improves the amplification effect of photoelectric signals and the selectivity of sensors, and is suitable for rapid detection.
Smart Images

Figure CN116297748B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of photoelectrochemistry and analytical detection technology, and specifically relates to a method for preparing an acceptor-donor photoelectrode of transition metal nitride-modified carbon nitride and its use in detecting pesticide residues, which can achieve highly sensitive and highly selective detection of pesticide residues in aquatic environments. Background Art
[0002] In recent years, pesticides have been widely used in agricultural applications and environmental disease prevention to prevent, control, or eliminate pests and weeds. While pesticide use can prevent and control agricultural and forestry pests and diseases, it also pollutes agricultural products and the ecological environment. Most pesticide residues remain in the environment during use, entering the food chain and ultimately adversely affecting human health. To date, commonly used methods for detecting pesticide residues include gas chromatography, enzyme-linked immunosorbent assay (ELISA), capillary chromatography, liquid chromatography, and capillary electrophoresis. These methods offer high sensitivity but are costly and time-consuming, requiring cumbersome sample pretreatment and impractical for rapid detection of large numbers of samples. Therefore, there is a need for rapid, simple, and highly sensitive methods for detecting pesticide residues in aquatic environments. A recently developed method for detecting pesticide residues is a photoelectrochemical aptamer sensing system based on graphitic carbon nitride (GCN). It holds great potential for application.
[0003] As a metal-free semiconductor material, graphitic carbon nitride (g-C3N4) possesses a unique chemical structure, well-positioned conduction / valence bands, excellent optical properties, and exceptional stability. Furthermore, its chemical and band structure are easily tunable. Therefore, g-C3N4 has shown promising applications in a wide range of fields, including photocatalysis and photoelectric sensing. However, the core of these applications—efficient electro-optical conversion—requires the fabrication of g-C3N4 photoelectrodes that amplify the photoelectric signal, which remains a significant challenge. Some transition metal nitrides (TMNs), such as Cu3N, Ta3N5, and Zn3N2, possess narrow or no band gaps, separating occupied and unoccupied energy levels. These TMNs can generate electron-hole pairs through interband transitions. Upon photon absorption, electrons are excited from fully occupied energy bands to partially occupied conduction bands, or from the conduction band to the lowest unoccupied band, typically exhibiting a wide photoresponse range and good electrical conductivity. When TMN is combined with g-C3N4, the light response range of the g-C3N4-based photoelectrode can be improved, thereby generating a large number of carriers. At the same time, TMN retains the properties of the parent metal and can effectively promote the migration and separation of photogenerated carriers, thereby significantly improving the photoelectric performance of the g-C3N4-based photoelectrode. This type of TMN can be introduced as an electron acceptor onto the g-C3N4 donor surface, driving electrons from the donor unit (g-C3N4) to the acceptor unit. The holes and electrons on the g-C3N4 can be effectively separated, improving the photoelectric performance of the material and ultimately increasing the sensitivity of the sensor.
[0004] Therefore, the development of a transition metal nitride-modified carbon nitride acceptor-donor photoelectrode not only provides an efficient photoelectric signal amplification strategy for the construction of g-C3N4-based photoelectrochemical aptamer sensors, but also effectively improves the sensitivity of pesticide residue detection in aquatic environments, which is of great significance for protecting human life and health and maintaining a good ecological environment. Summary of the Invention
[0005] The present invention aims to address the problems existing in the prior art and provide a method for preparing an acceptor-donor photoelectrode of transition metal nitride-modified carbon nitride and its application in constructing a photoelectrochemical aptamer sensor for detecting pesticide residues in aquatic environments.
[0006] The present invention achieves the above technical objectives through the following technical means.
[0007] A transition metal nitride-modified carbon nitride acceptor-donor photoelectrode combines a type of transition metal nitride (CoN, Mo2N, or WN) with g-C3N4. The transition metal nitride has strong electron absorption capacity and can act as an electron acceptor, promoting the transfer of photogenerated charge from the electron donor (g-C3N4) to the electron acceptor. Furthermore, it has a small band gap and a wide photoresponse range, which facilitates the extraction of photogenerated charge. The introduction of CoN nanoparticles allows the composite material to generate a large number of charge carriers, resulting in excellent photoelectric performance and amplification of the photoelectrode material's photoelectric signal.
[0008] A method for preparing a transition metal nitride modified carbon nitride acceptor-donor photoelectrode is carried out according to the following steps:
[0009] (1) Preparation of g-C3N4 material: A certain amount of carbon and nitrogen sources were weighed and placed in a covered crucible and calcined at high temperature in a muffle furnace to obtain g-C3N4;
[0010] (2) Preparation of transition metal nitride TMN (CoN, Mo2N or WN) / g-C3N4 composite materials:
[0011] First, a certain amount of transition metal salt and hexamethylenetetramine are added to ionized water and stirred to form solution A;
[0012] Secondly, a certain amount of g-C3N4 was added to ionized water and stirred evenly to form solution B;
[0013] Solution A and solution B are stirred evenly and transferred to a polytetrafluoroethylene-lined reactor for a constant-temperature hydrothermal reaction. After the reaction is completed, the reactor is removed and naturally cooled to room temperature. The product is centrifuged, washed, and dried to obtain a transition metal hydroxide / g-C3N4 precursor. The addition of hexamethylenetetramine can provide a weakly alkaline environment to the reaction system, forming a regular transition metal hydroxide with relatively moderate stability, making the subsequent nitride conversion more controllable.
[0014] Then, the transition metal hydroxide / g-C3N4 precursor was calcined at high temperature in an ark under an ammonia atmosphere in a tube furnace to obtain a TMN / g-C3N4 acceptor-donor composite material.
[0015] (3) Preparation of TMN (CoN, Mo2N or WN) / g-C3N4-conductive glass (ITO) photoelectrode:
[0016] A certain amount of TMN / g-C3N4 acceptor-donor composite material is uniformly dispersed in deionized water by ultrasonication to obtain a stable suspension; then a certain amount of the above suspension is dropwise applied to the surface of the ITO electrode and dried at room temperature to obtain the TMN / g-C3N4-ITO photoelectrode.
[0017] In step (1), the carbon and nitrogen source is one or more mixtures of thiourea, cyanamide, dicyandiamide, melamine or urea; the calcination rate is 1-10°C / min, the calcination temperature is 450-650°C, and the holding time is 2-8h.
[0018] In step (2), the transition metal salt is cobalt nitrate hexahydrate, cobalt chloride, molybdenum chloride, ammonium molybdate tetrahydrate, phosphomolybdic acid hydrate, ammonium tungstate hydrate or phosphotungstic acid hydrate; the usage ratio of the transition metal salt, hexamethylenetetramine, g-C3N4 and deionized water is 0.01-0.2mmol:0.01-0.2mmol:0.01-0.1g:20mL; the constant temperature hydrothermal reaction temperature is 100-200°C, and the constant temperature reaction time is 8-24h; the flow rate of ammonia is 10-100mL / min; the calcination temperature is 300-450°C, the calcination rate is 1-10°C / min, and the insulation time is 1-8h.
[0019] In step (3), the concentration of the suspension is 0.2-4 mg / mL, and the drop-coating amount is 20-70 μL.
[0020] Another objective of the present invention is to provide a transition metal nitride-modified carbon nitride acceptor-donor photoelectrode for use in constructing a photoelectrochemical sensor for detecting pesticide residues in aquatic environments. To enhance sensor selectivity, a π-π interaction exists between the g-C3N4 material and an aptamer, anchoring the aptamer corresponding to the target to the surface of the carbon nitride-based photoelectrode, thereby specifically recognizing the target.
[0021] The specific steps are as follows:
[0022] (4) Construction of TMN / g-C3N4 / aptamer-ITO sensor:
[0023] The atrazine aptamer, diazinon aptamer or profenofos aptamer aptamer is drop-coated on the surface of the TMN / g-C3N4-ITO photoelectrode prepared in step (3). After incubation at room temperature for a certain period of time, the unanchored aptamer on the electrode surface is rinsed with deionized water and dried at room temperature to obtain a TMN / g-C3N4 / aptamer-ITO photoelectrode sensor.
[0024] In step (4), the atrazine aptamer sequence is 5′-TGTAC CGTCT GAGCG ATTCG TACGAACGGC TTTGT ACTGT TTGCA CTGGC GGATT TAGCC AGTCA GTGTT AAGGA GTGC-3′; the diazinon aptamer sequence is 5′-NH2-C6-ATCCGTCACACCTGCTCTAATATAGAGGTATTGCTCTTGGACAAGGTACAGGGATGGTGTTGGCTCCCGTAT-3′; and the profenofos aptamer sequence is 5′-(SH)-(CH2)6-AAGCTTTTTTGACTGCAGGTGAAAAAGAG-3′;
[0025] The concentration of the atrazine aptamer, diazinon aptamer or profenofos aptamer is 0.1-4 μmol / L, and the drop-coating volume is 10-30 μL.
[0026] (5) Determination of standard curve:
[0027] The prepared TMN / g-C3N4 / aptamer-ITO photoelectrode sensor was used as the working electrode, Ag / AgCl as the reference electrode, Pt as the counter electrode, and phosphate buffer solution as the electrolyte. The photocurrent of the working electrode was measured under a certain bias voltage in the presence of known concentrations of atrazine, diazinon, or profenofos. A series of concentration-photocurrent correspondences were obtained, and then the standard curve of the sensor for different concentrations of pesticides was obtained.
[0028] (6) A certain amount of the pesticide solution to be tested is added to the electrolyte, and the photocurrent response value of the sensor constructed above is used to convert the photocurrent value into a standard curve to obtain the concentration of the pesticide in the test solution.
[0029] In step (5), the amount of atrazine, diazinon or profenofos added is 10 to 100 μL, and the concentration is 0.0001 fM to 10 pM; in step (6), the amount of the pesticide test solution dropped is 10 to 100 μL.
[0030] In step (5) and step (6), the phosphate buffer solution is prepared by mixing 0.1-1 M sodium dihydrogen phosphate and disodium hydrogen phosphate to adjust the pH to 7.0, and the concentration is 0.1-1 M.
[0031] The present invention has the following advantages:
[0032] (1) Transition metal nitrides act as electron acceptors, realizing the directional and rapid transfer of electrons from the acceptor to the donor g-C3N4. In addition, due to their small band gap, they have a wide light response range, which makes the prepared transition metal nitride-modified carbon nitride acceptor-donor photoelectrode have efficient light absorption ability and rapid charge transfer / separation ability, realizing the amplification of photoelectric signals.
[0033] (2) The present invention takes advantage of the acceptor-donor type material and introduces transition metal nitride as an acceptor on the surface of the donor g-C3N4. Once the acceptor-donor type material based on g-C3N4 is excited by light, the excited electrons will be rapidly extracted from the basal plane of g-C3N4 (electron donor) to the transition metal nitride (electron acceptor). This can reduce charge accumulation by accelerating charge separation, thereby improving the photoelectric performance. The sensitivity of the sensing system for the detection of pesticide residues in the water environment is evaluated, which promotes the application of g-C3N4 materials in the field of photoelectric sensing.
[0034] (3) Given that the acceptor-donor photoelectrode of transition metal nitride / g-C3N4 and the aptamer serve as specific recognition substances, efficient detection of pesticide residues in aquatic environments can be achieved, which has obvious practicality. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 is the X-ray diffraction (XRD) pattern of CoN / g-C3N4 composite material, where a is g-C3N4 and b is CoN / g-C3N4.
[0036] Figure 2 Transmission electron microscopy (TEM) and high magnification transmission electron microscopy (HRTEM) images of CoN / g-C3N4 composite materials, where a is TEM and b is HRTEM image.
[0037] Figure 3 Solid UV diffuse reflectance (DRS) diagram of CoN / g-C3N4 composite material, where a is g-C3N4 and b is CoN / g-C3N4.
[0038] Figure 4 This is the X-ray photoelectron spectroscopy (XPS) diagram of the CoN / g-C3N4 composite material, where a is the full spectrum, and bd are the high-resolution spectra of C1s, N 1s, and Co 2p, respectively.
[0039] Figure 5 The photocurrent diagram of the sensor, where a is g-C3N4-ITO, b is CoN / g-C3N4-ITO, c is CoN / g-C3N4-aptamer-ITO, and d is CoN / g-C3N4-aptamer-ATZ-ITO.
[0040] Figure 6 Electrochemical impedance spectroscopy (EIS) graphs of the sensors, where a is g-C3N4-ITO, b is CoN / g-C3N4-ITO, c is CoN / g-C3N4-aptamer-ITO, and d is CoN / g-C3N4-aptamer-atrazine (ATZ)-ITO.
[0041] Figure 7 This is the photoelectric signal response diagram of CoN / g-C3N4-aptamer-ITO detecting ATZ, where a is the photocurrent diagram obtained by detecting different concentrations of ATZ, and b is the linear relationship diagram of ATZ concentration-photocurrent.
[0042] Figure 8 Selectivity (a), stability (b) and repeatability (c) of ATZ detected on CoN / g-C3N4-aptamer-ITO. DETAILED DESCRIPTION
[0043] The present invention will be further described below with reference to specific implementation examples so that those skilled in the art can better understand the present invention. However, the protection scope of the present invention is not limited to the following examples.
[0044] Example 1:
[0045] (1) Preparation of g-C3N4 materials:
[0046] Weigh 2 g of urea and put it into a covered crucible. Then, place the crucible in a muffle furnace and heat it to 550 °C at a fixed heating rate of 5 °C / min, maintain it for 4 h, and obtain g-C3N4 after cooling.
[0047] (2) Preparation of CoN / g-C3N4 composite materials:
[0048] First, 0.1 mmol of cobalt nitrate hexahydrate and 0.1 mmol of hexamethylenetetramine were added to 12 mL of ionized water and stirred to form a solution. Next, 0.05 g of g-C3N4 was added to 8 mL of ionized water and stirred to form a solution. The two solutions were stirred and transferred to a polytetrafluoroethylene-lined reactor, where they were heated at 120°C for 12 hours. After the reaction, the reactor was removed and naturally cooled to room temperature. The product was centrifuged, washed, and dried to obtain a Co(OH)2 / g-C3N4 precursor. Then, 50 mg of the precursor was weighed and placed in an ark in a tube furnace under an ammonia atmosphere at a flow rate of 100 mL / min. The temperature was increased at a rate of 5°C / min and maintained at 380°C for 3 hours to obtain a CoN / g-C3N4 composite material.
[0049] (3) Preparation of CoN / g-C3N4-conductive glass (ITO) photoelectrode:
[0050] The ITO conductive glass was pretreated by ultrasonically cleaning it in deionized water and then ethanol for half an hour, followed by multiple rinses with deionized water. The ITO glass was then placed in a 0.1 mol / L sodium hydroxide solution, boiled for 30 minutes, rinsed with deionized water, and dried. A 1 mg / mL aqueous solution of CoN / g-C3N4 was prepared and ultrasonically dispersed in an ultrasonic machine to obtain a stable suspension. A 50 μL droplet of this suspension was then applied to the pretreated ITO conductive glass and allowed to air dry. The resulting modified electrode is designated CoN / g-C3N4-ITO.
[0051] A transition metal nitride CoN-modified carbon nitride acceptor-donor photoelectrode was used to construct a photoelectrochemical sensor for detecting atrazine (ATZ) pesticide residues in aquatic environments.
[0052] (4) Construction of CoN / g-C3N4 / aptamer-ITO sensor:
[0053] 10 μL of 1.5 μmol / L ATZ aptamer (sequence: 5′-TGTAC CGTCT GAGCG ATTCG TACGAACGGC TTTGT ACTGT TTGCA CTGGC GGATT TAGCC AGTCA GTGTT AAGGA GTGC-3′) was drop-coated on the surface of the CoN / g-C3N4-ITO photoelectrode prepared in step (3). After incubation at room temperature for 12 h, the unanchored aptamer on the electrode surface was rinsed with deionized water and dried at room temperature to obtain a sensor.
[0054] (5) Preparation of target detection substance ATZ: ATZ at concentrations of 0.0001fM, 0.001fM, 0.01fM, 0.1fM and 10fM was prepared for testing.
[0055] (6) Photoelectrochemical detection methods and conditions: Electrochemical experiments were performed using a CHI660E electrochemical workstation (Shanghai Chenhua Instrument Co., Ltd.) using a traditional three-electrode system: a modified electrode as the working electrode, a platinum wire electrode as the counter electrode, and a saturated Ag / AgCl electrode as the reference electrode. The excitation light source was a 300W xenon lamp (PLS-SXE300, Beijing Bofeilai Technology Co., Ltd.). Electrochemical experiments were performed at room temperature in a phosphate buffer solution (0.1 mol / L, pH = 7.0) without applying any bias. EIS experiments were performed in a solution containing 5 mmol / L Fe(CN)6 3- / 4- The experiment was carried out in a phosphate buffer solution (0.1 mol / L, pH=7.0) containing 0.1 mol / L KCl, with a frequency range of 0.01 Hz to 10 kHz and an AC amplitude of 5 mV.
[0056] Example 2:
[0057] (1) The preparation method of g-C3N4 is as follows:
[0058] 3 g of thiourea was weighed and placed in a 10 mL crucible. The crucible was then placed in a muffle furnace and heated to 580 °C at a fixed heating rate of 2 °C / min, maintained for 2 h, and then cooled to obtain g-C3N4.
[0059] (2) Preparation of Mo2N / g-C3N4 composite materials:
[0060] First, 0.2 mmol of molybdenum chloride and 0.2 mmol of hexamethylenetetramine were added to 12 mL of ionized water and stirred to form a solution. Next, 0.03 g of g-C3N4 was added to 8 mL of ionized water and stirred to form a solution. The two solutions were stirred and transferred to a polytetrafluoroethylene-lined reactor, where they were heated at 100°C for 16 hours. After the reaction, the reactor was removed and naturally cooled to room temperature. The product was centrifuged, washed, and dried to obtain a Mo2O3 / g-C3N4 precursor. Then, 100 mg of the precursor was weighed and placed in an ark in a tube furnace under an ammonia atmosphere at a flow rate of 50 mL / min. The temperature was increased at a rate of 2°C / min to 400°C and maintained for 3 hours to obtain the Mo2N / g-C3N4 composite material.
[0061] (3) Preparation of Mo2N / g-C3N4-conductive glass (ITO) photoelectrode:
[0062] The ITO conductive glass was pretreated by ultrasonically cleaning it in deionized water and then ethanol for half an hour, followed by multiple rinses with deionized water. The ITO glass was then placed in a 0.1 mol / L sodium hydroxide solution, boiled for 30 minutes, rinsed with deionized water, and dried. A 2 mg / mL Mo2N / g-C3N4 aqueous solution was prepared and ultrasonically dispersed in an ultrasonic machine to obtain a stable suspension. A 70 μL droplet of this suspension was then applied to the pretreated ITO conductive glass and allowed to air dry. The resulting modified electrode is designated Mo2N / g-C3N4-ITO.
[0063] A transition metal nitride Mo2N modified carbon nitride acceptor-donor photoelectrode was used to construct a photoelectrochemical sensor for the detection of diazinon pesticide residues in aquatic environments.
[0064] (4) Construction of Mo2N / g-C3N4 / aptamer-ITO sensor: Take 20 μL, 2 μmol / L diazinon aptamer (sequence 5′-NH 2-C6-ATCCGTCACACCTGCTCTAATATAGAGGTATTGCTCTTGGACAAGGTACAGGGATGGTGTTGGCTCCCGTAT-3′) was drop-coated on the surface of the Mo2N / g-C3N4-ITO photoelectrode prepared in step (3). After incubation at room temperature for 10 h, the unanchored aptamer on the electrode surface was rinsed with deionized water and dried at room temperature to obtain a sensor.
[0065] (5) Preparation of target test substance diazinon: diazinon at concentrations of 0.001 fM, 0.01 fM, 0.1 fM, 10 fM, and 100 fM was prepared for testing.
[0066] (6) Photoelectrochemical detection methods and conditions: Electrochemical experiments were performed using a CHI660E electrochemical workstation (Shanghai Chenhua Instrument Co., Ltd.) using a traditional three-electrode system: a modified electrode as the working electrode, a platinum wire electrode as the counter electrode, and a saturated Ag / AgCl electrode as the reference electrode. The excitation light source was a 300W xenon lamp (PLS-SXE300, Beijing Bofeilai Technology Co., Ltd.). Electrochemical experiments were performed at room temperature in a phosphate buffer solution (0.1 mol / L, pH = 7.0) without applying any bias. EIS experiments were performed in a solution containing 5 mmol / L Fe(CN)6 3- / 4- The experiment was carried out in a phosphate buffer solution (0.5 mol / L, pH=7.0) containing 0.1 mol / L KCl, with a frequency range of 0.01 Hz to 10 kHz and an AC amplitude of 5 mV.
[0067] Example 3:
[0068] (1) Preparation of g-C3N4 materials:
[0069] 3 g of a mixture of melamine and thiourea in equal mass ratio was weighed and placed in a covered crucible. The crucible was then placed in a muffle furnace and heated to 520 °C at a fixed heating rate of 5 °C / min, maintained for 4 h, and then cooled to obtain g-C3N4.
[0070] (2) Preparation of WN / g-C3N4 composite materials:
[0071] First, 0.2 mmol of phosphotungstic acid hydrate and 0.2 mmol of hexamethylenetetramine were added to 12 mL of ionized water and stirred to form a solution. Secondly, 0.06 g of g-C3N4 was added to 8 mL of ionized water and stirred to form a solution. The two solutions were stirred and transferred to a polytetrafluoroethylene-lined reactor, heated at 140°C for 12 h. After the reaction was completed, the reactor was removed and naturally cooled to room temperature. The product was centrifuged, washed, and dried to obtain a WO3 / g-C3N4 precursor. Then, 80 mg of the precursor was weighed and placed in an ark in a tube furnace under an ammonia atmosphere with a flow rate of 40 mL / min. The temperature was increased at a rate of 3°C / min to 360°C and maintained for 2 h to obtain a CoN / g-C3N4 composite material.
[0072] (3) Preparation of WN / g-C3N4-conductive glass (ITO) photoelectrode:
[0073] The ITO conductive glass was pretreated by ultrasonically cleaning it in deionized water and then ethanol for half an hour, followed by multiple rinses with deionized water. The ITO glass was then placed in a 0.1 mol / L sodium hydroxide solution, boiled for 30 minutes, rinsed with deionized water, and dried. A 1 mg / mL aqueous solution of WN / g-C3N4 was prepared and ultrasonically dispersed in an ultrasonic machine to obtain a stable suspension. A 60 μL droplet of this suspension was then applied to the pretreated ITO conductive glass and allowed to air dry. The resulting modified electrode is designated WN / g-C3N4-ITO.
[0074] A transition metal nitride WN-modified carbon nitride acceptor-donor photoelectrode was used to construct a photoelectrochemical sensor for detecting profenofos pesticide residues in aquatic environments.
[0075] (4) Construction of WN / g-C3N4 / aptamer-ITO sensor: 20 μL of 1 μmol / L bromophos aptamer (sequence: 5′-(SH)-(CH2)6-AAGCTTTTTTGACTGCAGGTGAAAAAGAG-3′) was drop-coated on the surface of the WN / g-C3N4-ITO photoelectrode prepared in step (3). After incubation at room temperature for 8 h, the unanchored aptamer on the electrode surface was rinsed with deionized water and dried at room temperature to obtain the sensor.
[0076] (5) Preparation of target test substance Profenofos: Profenofos at concentrations of 0.01 fM, 0.1 fM, 1 fM, 10 fM, 100 fM, 1 pM and 10 pM were prepared for testing.
[0077] (6) Photoelectrochemical detection methods and conditions: Electrochemical experiments were performed using a CHI660E electrochemical workstation (Shanghai Chenhua Instrument Co., Ltd.) using a traditional three-electrode system: a modified electrode as the working electrode, a platinum wire electrode as the counter electrode, and a saturated Ag / AgCl electrode as the reference electrode. The excitation light source was a 300W xenon lamp (PLS-SXE300, Beijing Bofeilai Technology Co., Ltd.). Electrochemical experiments were performed at room temperature in a phosphate buffer solution (0.1 mol / L, pH = 7.0) without applying any bias. EIS experiments were performed in a solution containing 5 mmol / L Fe(CN)6 3- / 4- The experiment was carried out in a phosphate buffer solution (0.1 mol / L, pH=7.0) containing 0.1 mol / L KCl, with a frequency range of 0.01 Hz to 10 kHz and an AC amplitude of 5 mV.
[0078] Figure 1 The X-ray diffraction (XRD) patterns of g-C3N4 and CoN / g-C3N4 composites, where a is g-C3N4 and b is CoN / g-C3N4. The peak at 13.0° for g-C3N4 corresponds to the (100) crystal plane, which is attributed to the in-plane repeating unit. The diffraction peak at 27.3° in g-C3N4 corresponds to the (002) crystal plane, corresponding to the interlayer stacking of its conjugated aromatic heterocyclic system. The diffraction peaks of g-C3N4 and CoN coexist in the CoN / g-C3N4 diffraction pattern. Among them, there are five broad peaks at 36.2°, 42.2°, 61.3°, 73.3° and 76.8°, which correspond to the (111), (200), (220), (311) and (222) crystal planes of CoN (PDF#16-0116), respectively. XRD patterns show that CoN / g-C3N4 composites were successfully prepared.
[0079] Figure 2 The transmission electron microscopy (TEM) and high magnification transmission electron microscopy (HRTEM) images of CoN / g-C3N4 composite materials, where a is TEM and b is HRTEM. Figure 2 As can be seen in Figure a, CoN / g-C3N4 maintains the folded structure of g-C3N4 and has distinct nanoparticles, indicating that the g-C3N4 surface is successfully loaded with CoN nanodots. The HRTEM image shows a lattice spacing of 0.25 nm, corresponding to the (111) crystal plane of CoN, further confirming the successful preparation of the CoN / g-C3N4 composite.
[0080] Figure 3The following are solid-state UV diffuse reflectance (DRS) images of the CoN / g-C3N4 composite. (a) represents g-C3N4, and (b) represents CoN / g-C3N4. CoN / g-C3N4 exhibits significantly stronger absorption in the UV and visible regions than g-C3N4, facilitating the generation of electron-hole pairs under light irradiation and enhancing photoelectric properties. Furthermore, the presence of a peak near 600nm in CoN / g-C3N4 is attributed to the presence of optical properties similar to those of precious metal particles in CoN, which enhances the composite's optical response range.
[0081] Figure 4 The X-ray photoelectron spectroscopy (XPS) spectra of the CoN / g-C3N4 composite are shown in Figure 1, where a is the full spectrum and bd are the high-resolution spectra of C1s, N1s, and Co2p, respectively. The full spectrum of CoN / g-C3N4 contains Co, N, and C elements. The C1s spectrum reveals two singlets at 284.8 (C–C) and 288.1 eV (N–C=N) in CoN / g-C3N4, consistent with those in g-C3N4. Furthermore, the N1s spectrum reveals four peaks at approximately 398.7, 400.1, 401.1, and 404.7 eV. The N1s peaks at 398.7 eV (C–N=C) and 400.1 eV (N–(C)3) correspond to the heterocyclic rings of carbon nitride, while the peaks at 401.1 eV and 404.7 eV correspond to C–N–H bonds and π excitations. The characteristic peaks of C 1s and N1s confirm the presence of a heptazine ring structure in CoN / g-C3N4. High-resolution Co 2p XPS spectra of CoN and CoN / g-C3N4 reveal six fitted peaks, with the peaks at 786.8 and 803.2 eV attributable to satellite peaks. For CoN / g-C3N4, the peak position of the Co element shifts toward higher binding energies. This is primarily due to the strong electronegativity of the N atom in g-C3N4, allowing for a tight binding between CoN and g-C3N4. Specifically, the outer electrons of the Co atom can be transferred to the 2p orbital of N, resulting in a weakened shielding effect of the outer electrons on the inner shell electrons and an enhanced Coulomb effect of the nucleus, resulting in a shift toward higher binding energies. The XPS data further demonstrate the successful preparation of the CoN / g-C3N4 composite.
[0082] Figure 5The photocurrent graphs of CoN / g-C3N4 composites are shown in Figure 1, where a is g-C3N4-ITO, b is CoN / g-C3N4-ITO, c is CoN / g-C3N4-aptamer-ITO, and d is CoN / g-C3N4-aptamer-ATZ-ITO. CoN / g-C3N4-ITO exhibits higher photocurrent values than g-C3N4-ITO. This is primarily because CoN has a lower Fermi level than g-C3N4, acting as an electron acceptor and possessing excellent charge capture capabilities. Once the g-C3N4-based acceptor-donor material is photoexcited, the excited electrons are rapidly extracted from the basal plane of g-C3N4 (electron donor) to the transition metal nitride (electron acceptor), which can reduce charge accumulation by accelerating charge separation. Furthermore, CoN exhibits optical properties similar to those of precious metal particles, which increases the photoresponse range of the composite and generates more charge carriers. The synergistic effect of these two factors leads to the amplification of the photoelectric signal of the carbon nitride-based photoelectrode by the introduction of CoN. Compared with CoN / g-C3N4-ITO, the photocurrent signal of CoN / g-C3N4-aptamer-ITO is reduced. This is because the presence of ATZ aptamer molecules on the CoN / g-C3N4-ITO electrode surface blocks electron transfer. In the presence of ATZ (10 μL, 1×10–3 fM), the photocurrent of CoN / g-C3N4-aptamer-ITO is further reduced. This is because ATZ and the aptamer bind to form a macromolecule, which enhances steric hindrance on the electrode surface and inhibits the directional migration of photogenerated electrons.
[0083] Figure 6 The following are electrochemical impedance spectroscopy (EIS) graphs of CoN / g-C3N4 composite materials. a is g-C3N4-ITO, b is CoN / g-C3N4-ITO, c is CoN / g-C3N4-aptamer-ITO, and d is CoN / g-C3N4-aptamer-ATZ-ITO. The successful construction of the sensor was verified by testing the impedance of the electrode. The smaller the impedance spectrum radius, the stronger the ability of the electrode to transfer electrons. CoN / g-C3N4-ITO has the strongest charge transfer ability, which is attributed to the acceptor-donor system of transition metal nitride-modified carbon nitride. When the ATZ aptamer is anchored to the electrode surface, the poorly conductive aptamer enhances steric hindrance and inhibits charge transfer. The presence of the target detection compound ATZ further enhances the surface resistance of the photoanode and inhibits the transfer of electrons from the photoanode to the external circuit. The impedance and photocurrent results indicate that the CoN / g-C3N4-ITO photoelectrode can be used to construct a photoelectrochemical aptasensor and achieve efficient ATZ detection.
[0084] Figure 7The photoelectric signal response diagram of CoN / g-C3N4-aptamer-ITO photoelectrochemical aptamer sensor detecting ATZ, where a is the photocurrent diagram obtained by detecting different concentrations of ATZ, and the ATZ concentrations are 0.0001fM, 0.005fM, 0.01fM, 0.05fM, 0.1fM, 0.5fM, 1fM, 3fM, 7fM, and 10fM. b is the linear relationship diagram of the ATZ concentration-photocurrent increment. Figure 7 It can be seen from a that with the increase of ATZ concentration, the photocurrent signal of the sensor gradually increases and shows a certain linear relationship. The linear range is 0.0001fM~10fM, and the linear equation is I(μA)=0.02195-0.02195log(C ATZ / fM )(R 2 =0.994,C ATZ :1×10 -4 fM-10fM), the detection limit is 3.3×10 -5 fM.
[0085] Figure 8 Figure 1 shows the selectivity (a), stability (b), and repeatability (c) of CoN / g-C3N4-aptamer-ITO for detecting ATZ. The anti-interference ability of ATZ detection was tested using diazinon (DIA), kerwinsan (KEW), profenofos (PRO), imidacloprid (IMI), omethoate (OME), and cypermethrin (CYP) as interfering agents. The results showed that the ATZ detection performance was significantly improved compared to 1×10 -3 Compared with fM ATZ, the photocurrent response of CoN / g-C3N4-aptamer-ATZ-ITO electrode caused by these interfering substances is relatively low and negligible ( Figure 8 a), indicating that the sensor platform has good selectivity. –3 In the presence of fM ATZ, the photocurrent response of the CoN / g-C3N4-aptamer-ATZ-ITO electrode under photoswitch illumination remained almost stable after 23 cycles at 930 s ( Figure 8 b), indicating that the constructed ATZ aptamer sensor platform has excellent stability. Five independent and parallel CoN / g-C3N4-aptamer-ATZ-ITO electrodes were prepared using the same method and –3 Tested in the presence of fM ATZ ( Figure 8 c), it was found that the photocurrent value changed little, indicating that the sensor has good repeatability.
Claims
1. A method for preparing an acceptor-donor type photoelectrode of transition metal nitride modified carbon nitride, characterized in that: The steps are as follows (1) Preparation of g-C3N4 materials: A certain amount of carbon and nitrogen sources were weighed and placed in a covered crucible and calcined at high temperature in a muffle furnace to obtain g-C3N4; The carbon and nitrogen source is one or a mixture of thiourea, melamine or urea; the calcination rate is 1 to 10°C / min, the calcination temperature is 450 to 650°C, and the holding time is 2 to 8 hours; (2) Preparation of TMN / g-C3N4 composite materials: First, a certain amount of transition metal salt and hexamethylenetetramine are added to ionized water and stirred to form solution A; Secondly, a certain amount of g-C3N4 was added to ionized water and stirred evenly to form solution B; Solution A and solution B were stirred evenly and transferred to a polytetrafluoroethylene-lined reactor for a constant temperature hydrothermal reaction. After the reaction was completed, the reactor was removed and naturally cooled to room temperature; the product was centrifuged, washed, and dried to obtain a transition metal hydroxide / g-C3N4 precursor; Then, the transition metal hydroxide / g-C3N4 precursor was calcined at high temperature in an ark under an ammonia atmosphere in a tube furnace to obtain the TMN / g-C3N4 composite material; The transition metal salt is cobalt nitrate hexahydrate, molybdenum chloride or phosphotungstic acid hydrate; The ratio of the transition metal salt, hexamethylenetetramine, g-C3N4, and deionized water is 0.01-0.2 mmol: 0.01-0.2 mmol: 0.01-0.1 g: 20 mL; The constant temperature hydrothermal reaction temperature is 100-200°C, and the constant temperature reaction time is 8-24h; The flow rate of ammonia is 10-100 mL / min; the calcination temperature is 300-450° C., the calcination rate is 1-10° C. / min, and the holding time is 1-8 h; (3) Preparation of TMN / g-C3N4-conductive glass ITO photoelectrode: A certain amount of TMN / g-C3N4 composite material is uniformly dispersed in deionized water by ultrasonication to obtain a stable suspension; then a certain amount of the above suspension is dropwise applied to the surface of the ITO electrode and dried at room temperature to obtain the TMN / g-C3N4-ITO photoelectrode.
2. The preparation method according to claim 1, wherein in step (3), the concentration of the suspension is 0.2 to 4 mg / mL, and the drop-coating amount is 20 to 70 μL.
3. Use of the transition metal nitride-modified carbon nitride acceptor-donor photoelectrode prepared by the preparation method according to any one of claims 1 to 2 in constructing a photoelectrochemical sensor for detecting pesticide residues in an aquatic environment.
4. The use according to claim 3, characterized in that Here are the steps: (4) Construction of TMN / g-C3N4 / aptamer-ITO sensor: The atrazine aptamer, diazinon aptamer or profenofos aptamer is drop-coated on the surface of the TMN / g-C3N4-ITO photoelectrode prepared in step (3), and after incubation at room temperature for a certain period of time, the unanchored aptamer on the electrode surface is rinsed with deionized water and dried at room temperature to obtain a TMN / g-C3N4 / aptamer-ITO photoelectrode sensor; (5) Determination of standard curve: The prepared TMN / g-C3N4 / aptamer-ITO photoelectrode sensor was used as the working electrode, Ag / AgCl as the reference electrode, Pt as the counter electrode, and phosphate buffer solution as the electrolyte. The photocurrent of the working electrode was measured in the presence of known concentrations of atrazine, diazinon, or profenofos at a certain bias voltage. A series of concentration-photocurrent correspondences were obtained, and then the standard curve of the sensor for different concentrations of pesticides was obtained. (6) A certain amount of the pesticide solution to be tested is added to the electrolyte, and the photocurrent response value of the sensor constructed above is used to convert the photocurrent value into a standard curve to obtain the concentration of the pesticide in the test solution.
5. The use according to claim 4, characterized in that In step (4), The atrazine aptamer sequence is 5′-TGTAC CGTCT GAGCG ATTCG TACGA ACGGCTTTGTACTGT TTGCA CTGGC GGATT TAGCC AGTCA GTGTTAAGGA GTGC-3′; The sequence of the diazinon aptamer is: 5′-NH2-C6-ATCCGTCACACCTGCTCTAATATAGAGGTATTGCTCTTGGACAAGGTACAGGG ATGGTGTTGGCTCCCGTAT-3′; The sequence of the profenofos aptamer is 5′-(SH)-(CH2)6-AAGCTTTTTTGACTGCAGGTGAAAAAGAG-3′.
6. The use according to claim 4, characterized in that In step (4), the concentration of the atrazine aptamer, diazinon aptamer or profenofos aptamer is 0.1-4 μmol / L, and the drop-coating amount is 10-30 μL.
7. The use according to claim 4, characterized in that In step (5), the amount of atrazine, diazinon or profenofos added is 10 to 100 μL, and the concentration is 0.0001 fM to 10 pM; In step (6), the amount of the pesticide test solution to be applied is 10 to 100 μL.
8. The use according to claim 4, characterized in that In step (5) and step (6), the phosphate buffer solution is prepared by mixing 0.1-1M sodium dihydrogen phosphate and disodium hydrogen phosphate to adjust the pH to 7.0, and the concentration thereof is 0.1-1M.
Citation Information
Patent Citations
Preparation method and purpose of photoelectric chemical aptamer sensor for detecting bisphenol A
CN109115851A
Preparation method and application of photoelectrochemical aptamer sensor for detecting enrofloxacin
CN112461904A